Dataset for CDS E1B19K of organism Human adenovirus 4a

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3G9JTX5_E1B19K-      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
A0A3G9K5X3_E1B19K-      atggagatttggacggtcttggaagacttttacaagactaggcagctgct

A0A3G9JTX5_E1B19K-      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
A0A3G9K5X3_E1B19K-      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg

A0A3G9JTX5_E1B19K-      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
A0A3G9K5X3_E1B19K-      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa

A0A3G9JTX5_E1B19K-      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
A0A3G9K5X3_E1B19K-      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt

A0A3G9JTX5_E1B19K-      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
A0A3G9K5X3_E1B19K-      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta

A0A3G9JTX5_E1B19K-      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
A0A3G9K5X3_E1B19K-      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt

A0A3G9JTX5_E1B19K-      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
A0A3G9K5X3_E1B19K-      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt

A0A3G9JTX5_E1B19K-      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
A0A3G9K5X3_E1B19K-      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa

A0A3G9JTX5_E1B19K-      tc-ccggctacttgccggtacagccgctag--------------------
A0A3G9K5X3_E1B19K-      tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
                        ** ***************************                    

A0A3G9JTX5_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga

A0A3G9JTX5_E1B19K-      --------------------------------------------------
A0A3G9K5X3_E1B19K-      tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagt

A0A3G9JTX5_E1B19K-      --
A0A3G9K5X3_E1B19K-      ag

© 1998-2023Legal notice