Dataset for CDS adenoviridae of organism Human adenovirus 43

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QVG6_E1B19K-01      atggaggtgtggactatccttgcagactttagcaagacacgccggcttgt
M0QVG6_E1B19K-02      --------------------------------------------------

M0QVG6_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
M0QVG6_E1B19K-02      --------------------------------------------------

M0QVG6_E1B19K-01      ctcctctatctcgcctggtgtacacagttaagaaggattataacgaggaa
M0QVG6_E1B19K-02      --------------------------------------------------

M0QVG6_E1B19K-01      tttgaaaatctttttgtcgactgctctggcctgctagattctctgaatct
M0QVG6_E1B19K-02      --------------------------------------------------

M0QVG6_E1B19K-01      tggccaccaggctctattccaggaaagggtactccacagccttgattttt
M0QVG6_E1B19K-02      --------------------------------------------------

M0QVG6_E1B19K-01      ccagcccagggcgcactacagccggggttgcgtttgtggtgtttctggtt
M0QVG6_E1B19K-02      --------------------------------------------------

M0QVG6_E1B19K-01      gacaaatggagccagcaaacccatctgaccagggattacatcctggactt
M0QVG6_E1B19K-02      -----atggagccagcaaacccatctgaccagggattacatcctggactt

M0QVG6_E1B19K-01      cacggccatgcatctgtggaaggcctgggtcaggcagcggggacagagaa
M0QVG6_E1B19K-02      cacggccatgcatctgtggaaggcctgggtcaggcagcggggacagagaa

M0QVG6_E1B19K-01      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta
M0QVG6_E1B19K-02      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta

M0QVG6_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgagggaggccatggacga
M0QVG6_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgagggaggccatggacga

M0QVG6_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga-
M0QVG6_E1B19K-02      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      tcaggtatccagcctgtacccagagcttagcaaggtgctgacatccatgg

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      ccaggggagtgaagagggagaggagcgatgggggcaataccgggatgatg

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      accgagctgacggccagcctgatgaatcgcaagcgcccagagcgcattac

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      ctggcacgagctacagcaagagtgcagggatgagataggcctgatgcagg

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      ataaatatgggctggagcagataaaaactcactggttgaacccagatgag

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      gattgggaggaggccattaagaaatatgccaagatagccctgcgcccaga

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      ttgcaagtacaaggtgaccaagacagtgaatatcagacatgcctgctaca

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      tctcagggaacggggcagaggtggtcatcgataccctggacaagtcagcc

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      ttcaggtgttgcatgatgggaatgagagccggagtgatgaatatgaattc

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      catgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgc

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      tgttcatggccaacagccacatgaccctgcatggttgcagcttcttcggt

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      ttcaacaacatgtgcgccgaggtctggggagctgctaagatcaggggctg

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      taagttttatggctgctggatgggagtggtcggaagacccaagagcgaga

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      tgtctgtgaagcagtgtgtgtttgagaagtgctacctgggggtgtctacc

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      gagggcaatgctagagtgagacactgctcttccttggagacgggctgctt

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      ctgcctggtgaagggcacagcctcgatcaagcataatgtggtgaagggct

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      gcacggatgagcgtatgtacaacatgctgacctgcgactcaggggtctgc

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      catatcctgaagaacatccatgtgacctcccacgccagaaagaagtggcc

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      agtgtttgagaataacctgctgatcaagtgccatatgcacctgggcgcca

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      gaaggggcaccttccagccgtaccagtgcaactttagccagaccaagctg

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      ctgttggagaacgatgccttctccagggtgaacctgaacggcatctttga

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      catggatgtctcggtgtacaagatcctgagatacgatgagaccaggtcca

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      gggtgcgcgcttgcgagtgtgggggcagacacaccaggatgcagcctgtg

M0QVG6_E1B19K-01      --------------------------------------------------
M0QVG6_E1B19K-02      gccctggatgtgacagaggagctgagacccgaccacctggtgatggcctg

M0QVG6_E1B19K-01      -------------------------------------------
M0QVG6_E1B19K-02      taccgggaccgagttcagctccagcggggaggacacagattag

© 1998-2023Legal notice