Dataset for CDS E1B19K of organism Human adenovirus 42

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QVC7_E1B19K-01      at--------------------------------------gact------
M0QVC7_E1B19K-02      atggagccagaacacccaactgagcaggggctacattctggacttcgcag
                      **                                      ****      

M0QVC7_E1B19K-01      ------------------catgggcgtggc--------------------
M0QVC7_E1B19K-02      ccatgcacctgtggagggcatgggtgaggcagcggggacagagaatcttg
                                        ****** * ***                    

M0QVC7_E1B19K-01      --tta--gtcctatataagtggcaacacctgg------------------
M0QVC7_E1B19K-02      aactactggcttatacagccagcagctccgggtcttcttcgtctacacag
                         **  * * **** *    *** * ** **                  

M0QVC7_E1B19K-01      ----------------------gcactggggca-----------------
M0QVC7_E1B19K-02      acaaacatccatgttggaggaagaaatgaggcaggccatggacgagaacc
                                            * * ** ****                 

M0QVC7_E1B19K-01      ------------cagaccttc------aggaagttcctgatggatgtgtg
M0QVC7_E1B19K-02      cgaggagcggcctggaccctccgtcggaagaggagctggattgaatcagg
                                    **** **      * ** *  *  *** **     *

M0QVC7_E1B19K-01      gactatccttg----cagactttagcaagacac-----------------
M0QVC7_E1B19K-02      tatccagcttgtacccagagcttagcaaggtgctgacatccatggccagg
                       *     ****    ****  ********   *                 

M0QVC7_E1B19K-01      --------------------------------------------------
M0QVC7_E1B19K-02      ggagtgaagagggagaggagcgatgggggcaataccgggatgatgaccga

M0QVC7_E1B19K-01      -------gccggcttg----------------tagaggatagttca-gac
M0QVC7_E1B19K-02      gctgacggccagcctgatgaatcgcaagcgcccagagcgcattacatggc
                             *** ** **                 ****   * * ** * *

M0QVC7_E1B19K-01      gggtgctccgggt----tctggagacactggtttggaactcctct-----
M0QVC7_E1B19K-02      acgagctacagatggagtgcaggga---tgagttgggcctgatgcaggat
                        * *** * * *    *   * **   **  ****  **  *       

M0QVC7_E1B19K-01      --atctcgtctggtgtacaca-----------gttaag-------aagga
M0QVC7_E1B19K-02      aaatatggcctggagcagataaaaacacattggttgaacccagatgagga
                        ** * * **** * * * *           *** *         ****

M0QVC7_E1B19K-01      ttataacgaggaatttgaaaatctttttgct--gattgctctg-------
M0QVC7_E1B19K-02      ttgggaggaggccattaagaa---atatgccaagatagccctgcgcccag
                      **   * ****   ** * **    * ***   *** ** ***       

M0QVC7_E1B19K-01      -----------------------------------------gcctgctag
M0QVC7_E1B19K-02      attgcaagtacatagtgaccaagaccgtgaatattagacatgcctgctac

M0QVC7_E1B19K-01      attctctgaatctcggc---------caccagtccctt------------
M0QVC7_E1B19K-02      atttcgggtaacggggcagaggtggtcatcgataccctggacaaggccgc
                      ***    * * *  ***         ** *  * ** *            

M0QVC7_E1B19K-01      ---------ttccaggaaagg------------------------gtact
M0QVC7_E1B19K-02      cttcaggtgttgcatgatgggaatgagagcaggagtgatgaatatgaatt
                               ** ** **  **                        * * *

M0QVC7_E1B19K-01      ccacagccttgat-------------------------------------
M0QVC7_E1B19K-02      ccatgatcttcatgaacatgaagttcaatggagagaagtttaatggggtg
                      ***    *** **                                     

M0QVC7_E1B19K-01      -ttttc--------cagcc-cagggcgcactacagccggggttgcttt--
M0QVC7_E1B19K-02      ctgttcatggccaacagccacatgaccctgcatggctgcagtttctttgg
                       * ***        ***** ** * * *   *  ** *  *** ****  

M0QVC7_E1B19K-01      -------------------------------------------------t
M0QVC7_E1B19K-02      cttcaacaatatgtgcgccgaggtctggggcgcttccaagatcaggggat

M0QVC7_E1B19K-01      gtggtttttctggttgacaaatgg----agccagaacacccaa-------
M0QVC7_E1B19K-02      gtaagttttatggctgttggatgggcgtagtcggaagacccaagagcgag
                      **   **** *** **    ****    ** * *** ******       

M0QVC7_E1B19K-01      --------------------------------------------------
M0QVC7_E1B19K-02      atgtctgtaaagcagtgtgtgtttgagaaatgctacctgggagtctctac

M0QVC7_E1B19K-01      ----------------------------------ctgagcaggggct---
M0QVC7_E1B19K-02      cgagggcaatgctagagtgagacactgctcttccctggatacgggctgtt
                                                        ***   * *****   

M0QVC7_E1B19K-01      --------------------------------------------------
M0QVC7_E1B19K-02      tctgcctggtgaagggtacggcctctctgaagcataatatggtgaagggc

M0QVC7_E1B19K-01      ----------------------acattctggacttcg-------------
M0QVC7_E1B19K-02      tgcacagatgagcgcatgtacaacatgctgacctgcgactcgggggtctg
                                            **** ***  ** **             

M0QVC7_E1B19K-01      ---------------cagccatgc--------------------------
M0QVC7_E1B19K-02      ccatatcctgaagaacatccatgtgacctcccaccccagaaagaagtggc
                                     ** *****                           

M0QVC7_E1B19K-01      ---------------acctgtgga-------------gggcatgggtg--
M0QVC7_E1B19K-02      cagtgtttgagaataacctgctgatcaagtgccatatgcacctgggtgcc
                                     *****  **             *  * ******  

M0QVC7_E1B19K-01      ---agg---------cagcggggacagagaatcttgaacta---------
M0QVC7_E1B19K-02      agaaggggcaccttccagccgtaccagtgcaactttagccagaccaagct
                         ***         **** *   *** * * *** * * *         

M0QVC7_E1B19K-01      --------------ctggcttatacag-----------ccagcagctccg
M0QVC7_E1B19K-02      gctgttggagaacgatgccttctccagggtgaacctgaacggcatctttg
                                     ** *** * ***            * *** **  *

M0QVC7_E1B19K-01      ----ggtcttcttcgtctacac-----------------agacaaacatc
M0QVC7_E1B19K-02      acatggatgtctcggtgtacaagatcctgagatacgatgagacgaa-gtc
                          **   ***  ** ****                  **** **  **

M0QVC7_E1B19K-01      catgtt----------------ggaggaagaaat-----gaggca-----
M0QVC7_E1B19K-02      cagggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagccag
                      ** * *                ** ** *** *      ** ***     

M0QVC7_E1B19K-01      -ggccatggacgagaacccgaggagc----------------------gg
M0QVC7_E1B19K-02      tggccctggatgtga--ccgaggagctgagaccagaccacctggtgatgg
                       **** **** * **  *********                      **

M0QVC7_E1B19K-01      cctggacc--------------ctccgtcggaagaggagctggattga
M0QVC7_E1B19K-02      cctgtaccgggaccgagttcagctccagcgg-ggaggacacagattag
                      **** ***              ****  ***  *****    ****  

© 1998-2022Legal notice