Dataset for CDS E1B19K of organism Human adenovirus 39

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QV87_E1B19K-01      atggat-----------------gtgtggact--atccttggggattttg
M0QV87_E1B19K-02      atggagccaggacacccaactgagcaggggctacatcct---ggacttcg
                      *****                  *   ** **  *****   *** ** *

M0QV87_E1B19K-01      tcaagacacgcc-------ggcttgta---------gaggatag------
M0QV87_E1B19K-02      cagccatgcacctgtggagggcctggatcaggcagcggggacagagaatc
                           *  * **       *** ** *         * *** **      

M0QV87_E1B19K-01      ----------------ttcagacgggtgctccgggttct-----------
M0QV87_E1B19K-02      ttgaactactggcttctacagccagcagttccgggtcttcttcgtctaca
                                      * *** * *  * *******  *           

M0QV87_E1B19K-01      ---------------------------------ggagacactggtttgga
M0QV87_E1B19K-02      cagacaaacatccatgttggaggaagagatgagggaggccatggacgaga
                                                       **** *  ***    **

M0QV87_E1B19K-01      a--------------------ctcctt-----------------------
M0QV87_E1B19K-02      acccgaggagcggcctggaccctccgtcggaagaggagctggattgagtc
                      *                    **** *                       

M0QV87_E1B19K-01      ---tatctcgcct------------------ggtgtacac----------
M0QV87_E1B19K-02      aggtatccagcctgtaccctgagctaagcaaggtgttgacatccatggcc
                         ****  ****                  *****  **          

M0QV87_E1B19K-01      -----agttaagaaggattatagcgagg----------------------
M0QV87_E1B19K-02      aggggagtgaagagggagaggagcgatgggggcaataccgggatgatgac
                           *** **** ***    ***** *                      

M0QV87_E1B19K-01      -------------aatttga----------------aaatcttttttc--
M0QV87_E1B19K-02      cgagctgacggccagcctgatgaatcgcaagcgcccagagcgcattacct
                                   *   ***                * * *   ** *  

M0QV87_E1B19K-01      ----------------cgactgc---------------------------
M0QV87_E1B19K-02      ggcacgagctacagatcgagtgcagggatgaggtgggcctgatgcaggat
                                      *** ***                           

M0QV87_E1B19K-01      ---tctggcctg--------------------------------------
M0QV87_E1B19K-02      aaatacggcctggagcagataaaaacccactggttgaacccagatgagga
                         *  ******                                      

M0QV87_E1B19K-01      -------------------------------------------ctagatt
M0QV87_E1B19K-02      ttgggaggaggccattaagaagtatgccaagatagccctgcgcccagatt
                                                                 * *****

M0QV87_E1B19K-01      ---------------------ctctgaattttggcca--ccagtcccttt
M0QV87_E1B19K-02      gcaagtacagggtgaccaagacggttaatatcagacatgcctgctacatc
                                           *  * *** *  * **  ** *   * * 

M0QV87_E1B19K-01      tccaggaaag----------ggtccttcacagccttga------------
M0QV87_E1B19K-02      tcggggaacggggcagaggtggtcgtcgacaccctggacaaggccgcctt
                      **  **** *          **** *  *** *** **            

M0QV87_E1B19K-01      --------------------------------------------------
M0QV87_E1B19K-02      caggtgttgcatgatgggaatgagagccggagtgatgaatatgaattcca

M0QV87_E1B19K-01      -----------------------------------------------ttt
M0QV87_E1B19K-02      tgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgctt

M0QV87_E1B19K-01      ttcaactcc--cgggcgcac-------tacagccggggttgcttt-----
M0QV87_E1B19K-02      ttcatggccaacagccacatgaccgtgcacggctgcagtttctttgggtt
                      ****   **  * * * **         ** ** *  *** ****     

M0QV87_E1B19K-01      ----------------------------------------------tgtg
M0QV87_E1B19K-02      caacaatatgtgtgcagagatctggggtgccgctaagatcaggggatgta

M0QV87_E1B19K-01      gtttttctggttgacaaatgg----agccaggacacccaa----------
M0QV87_E1B19K-02      agttttatggctgctggatgggcgtggtcggaagacccaagagcgagatg
                        **** *** **    ****     * * * * ******          

M0QV87_E1B19K-01      -ctg---agcaggg--------------gctacatcctggacttcgc---
M0QV87_E1B19K-02      tctgtgaagcagtgtgtgtttgagaaatgctacctggcggtctctaccga
                       ***   ***** *              ***** *   ** **   *   

M0QV87_E1B19K-01      -agccatgcac------------------ctgtggag-------------
M0QV87_E1B19K-02      gggcaatgctcgagtgagacactgctcttccatggagacgggctgcttct
                        ** **** *                  *  *****             

M0QV87_E1B19K-01      ----------------ggcctggatcaggca----gcgggga-------c
M0QV87_E1B19K-02      gcctggtgaagggcacggcctcgatcaagcataatgtggtgaagggctgc
                                      ***** ***** ***    * ** **       *

M0QV87_E1B19K-01      agaga---------------------------------------------
M0QV87_E1B19K-02      acggatgagcgcatgtacaacatgctgacctgcgactcgggggtctgcca
                      *  **                                             

M0QV87_E1B19K-01      -atcttgaactac-------tggctt----ctacag--------------
M0QV87_E1B19K-02      tatcctgaagaacatccatgtgacctcccactccaggaagaagtggccag
                       *** ****  **       ** * *    ** ***              

M0QV87_E1B19K-01      --------------------------------------------------
M0QV87_E1B19K-02      tgtttgagaataacctgctgatcaagtgccatatgcacctgggtgccaga

M0QV87_E1B19K-01      -----------ccagcagttccgg--------------------------
M0QV87_E1B19K-02      aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
                                 ***** ** ** *                          

M0QV87_E1B19K-01      -------------gtcttcttc----------------------------
M0QV87_E1B19K-02      gctggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
                                   * ***** *                            

M0QV87_E1B19K-01      -----gtctacacagacaa----------------------acatccatg
M0QV87_E1B19K-02      tggatgtctcggtatacaagatcctgagatacgatgagaccaagtccagg
                           ****    * ****                      *  **** *

M0QV87_E1B19K-01      tt----------------ggaggaaga--------gatgagg---gaggc
M0QV87_E1B19K-02      gtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagccagtggc
                       *                ** ** ***        ****  *   * ***

M0QV87_E1B19K-01      catggacgagaacccgaggagc----------------------ggcctg
M0QV87_E1B19K-02      cctggatgtga--ccgaggagctgagaccagaccacctggtgatggcctg
                      * **** * **  *********                      ******

M0QV87_E1B19K-01      gacc--------------ctccgtcggaagaggagctggattga
M0QV87_E1B19K-02      taccgggaccgagttcagctccagtgg-ggaggacacagattag
                       ***              ****   **  *****    ****  

© 1998-2023Legal notice