Dataset for CDS E1B19K of organism Human adenovirus 32

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QUS9_E1B19K-01      atggag-----------------gtgtggactatccttgcggactttaac
M0QUS9_E1B19K-02      atggagccaggacacccaactgagcaggggcta-catcctggacttcacg
                      ******                 *   ** *** * *   ****** *  

M0QUS9_E1B19K-01      aagacacgcc-------ggcttgtg---------gaggatag--------
M0QUS9_E1B19K-02      gccatgcacctgtggagggcctgggtcaggcagcggggacagagaatctt
                         *  * **       *** ** *         * *** **        

M0QUS9_E1B19K-01      --------------ttcagacgggtgctccggtttct-------------
M0QUS9_E1B19K-02      gaactactggcttctacagccagcagctccgggtcttcttcgtctacaca
                                    * *** * *  ******* *  *             

M0QUS9_E1B19K-01      -------------------------------ggagacactggtttggaac
M0QUS9_E1B19K-02      gacaaacatccatgttggaggaagagatgagggaggccatggacgagaac
                                                     **** *  ***    ****

M0QUS9_E1B19K-01      -----------------tcctc----------------------------
M0QUS9_E1B19K-02      ccgaggagcggcctggaccctccgtcggaagaggagctggattgaatcag

M0QUS9_E1B19K-01      -tatctcgcct---------------------------------------
M0QUS9_E1B19K-02      gtatccagcctgtacccagagcttagcaaggtgctgacaaccatggccag
                       ****  ****                                       

M0QUS9_E1B19K-01      --------------------------------------------------
M0QUS9_E1B19K-02      gggagtgaagagggagaggagcgatgggggcaatactgggatgatgaccg

M0QUS9_E1B19K-01      --------------------------------------------------
M0QUS9_E1B19K-02      agctgacagccagcctgatgaatcgcaggcgacctgagcgcattacctgg

M0QUS9_E1B19K-01      --------------ggtgtacacagttaaga-------------------
M0QUS9_E1B19K-02      catgagctacagcaggagtgcagggatgagataggcctgatgcaggataa
                                    ** ** **  * * ***                   

M0QUS9_E1B19K-01      --------------------------------------------aggatt
M0QUS9_E1B19K-02      atatggcctggagcagataaaaacccactggttgaacccagatgaggatt

M0QUS9_E1B19K-01      ataaagaggaatttgaaaatctttttgcc--gactgctctg---------
M0QUS9_E1B19K-02      gggaggaggccattaagaa---atatgccaagatagccctgcgcccagat
                         * ****   ** * **    * ****  **  ** ***         

M0QUS9_E1B19K-01      ---------------------------------------gcctgcta---
M0QUS9_E1B19K-02      tgcaagtacagggtgaccaagacggtgaatatcagacatgcctgctacat

M0QUS9_E1B19K-01      ----------------------------gattctctgaa-----------
M0QUS9_E1B19K-02      ctcagggaacggggcagaggtgatcatcgataccctggataaggctgcct
                                                  *** * *** *           

M0QUS9_E1B19K-01      --------------------------------------------------
M0QUS9_E1B19K-02      tcaggtgttgcatgatgggaatgagagccggtgtgatgaatatgaattcc

M0QUS9_E1B19K-01      -------tcttggccaccaggctctattccaggaa---------------
M0QUS9_E1B19K-02      atgatattcatgaacatcaagttcaatggagagaagtttaatggggtgct
                             ** **  ** ** * ** **     ***               

M0QUS9_E1B19K-01      -------------------agggtcctccacagccttgatttttccagcc
M0QUS9_E1B19K-02      gttcatggccaacagccacatgaccctgcacggctgtaatttctttggct
                                         * *  *** *** **  * **** *   ** 

M0QUS9_E1B19K-01      cagg------gcgcactacagccggtgttgctt-------------ttgt
M0QUS9_E1B19K-02      ttaacaacatgtgtgcagaagtctggggtgcttccaagatcaggggctgt
                                * *  *   ** * * * *****              ***

M0QUS9_E1B19K-01      ggtttttctggttgacaaatgg----agccaggacacccaa---------
M0QUS9_E1B19K-02      aagttttatggctgctggatgggagtggtcggaagacccaagagcgagat
                         **** *** **    ****     * * * * ******         

M0QUS9_E1B19K-01      --ctg---agcag-----------gggctacatcctggacttcac-----
M0QUS9_E1B19K-02      gtctgtgaagcagtgtgtgtttgagaagtgctacctggccgtgtctaccg
                        ***   *****           *   * *  ***** * *  *     

M0QUS9_E1B19K-01      --ggccatg------------------cacctgtggagg------gcctg
M0QUS9_E1B19K-02      agggcaatgctagagtgagacattgctcttccatggagacgggctgcttc
                        *** ***                  *  *  *****       ** * 

M0QUS9_E1B19K-01      ggtcaggcagcggggacag------------agaatct----------tg
M0QUS9_E1B19K-02      tgcctggtgaagggcacagcttctatcaagcataatgtgatcaaggggtg
                       * * **    *** ****            * *** *          **

M0QUS9_E1B19K-01      aactactg---gcttctacagccagcagctccgggtcttcttcgtctac-
M0QUS9_E1B19K-02      tactgatgagcgcatgtacaacatgctgacctgcgactctggggtctgcc
                       ***  **   ** * **** *  ** *  * * * **     **** * 

M0QUS9_E1B19K-01      ----acagacaaacatccatgt----------------------------
M0QUS9_E1B19K-02      atatcctgaagaacatccatgtgacttcccatcccaggaagaggtggcca
                           * **  ***********                            

M0QUS9_E1B19K-01      --------------------------------------------------
M0QUS9_E1B19K-02      tcatttgaaaataatgtcctgatcaagtgccatgtgcacctgggagccag

M0QUS9_E1B19K-01      --------------------------------------------------
M0QUS9_E1B19K-02      aaggggtaccttccagccgtaccagtgcaactttagccagaccaagctgc

M0QUS9_E1B19K-01      ---tggaggaaga-------------------------------------
M0QUS9_E1B19K-02      tgctggagaacgatgccttctccagggtgaacctgaacggcatctttgac
                         ***** * **                                     

M0QUS9_E1B19K-01      ---------------------------------gatgagg----------
M0QUS9_E1B19K-02      atggatgtctcggtgtacaagattctgagatatgatgagaccaggtccag

M0QUS9_E1B19K-01      ----------------------------------------------gagg
M0QUS9_E1B19K-02      ggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagcctgtgg
                                                                    * **

M0QUS9_E1B19K-01      ccatggacgagaacccgaggagc----------------------ggcct
M0QUS9_E1B19K-02      ccctggatgtga--ccgaggagctgagaccagaccacctggtgatggcct
                      ** **** * **  *********                      *****

M0QUS9_E1B19K-01      ggacc--------------ctccgtcggaagaggagctggattga
M0QUS9_E1B19K-02      gtaccgggaccgagttcagctccagcgg-ggaggacacagattag
                      * ***              ****  ***  *****    ****  

© 1998-2020Legal notice