Dataset for CDS E1B19K of organism Human adenovirus 27

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QUN2_E1B19K-01      atggat-----------------gtgtggactatccttgcagactt--ta
M0QUN2_E1B19K-02      atggagccaggacacccaactgagcaggggcta-catcctggacttcgca
                      *****                  *   ** *** * *    *****   *

M0QUN2_E1B19K-01      gcaagacac-----gccggcttgta---------gaggatag--------
M0QUN2_E1B19K-02      gccatgcacctgtggagggcctggatcaggcagcggggacagagaatctt
                      ** *  ***     *  *** ** *         * *** **        

M0QUN2_E1B19K-01      --------------ttcagacgggtgctccgggttct-------------
M0QUN2_E1B19K-02      gaattactggcttctacagccagcagctccgggtcttcttcgtctacaca
                                    * *** * *  *********  *             

M0QUN2_E1B19K-01      --------------------------------------------------
M0QUN2_E1B19K-02      gacaaacatccatgttggaggaagaaatgaggcaggccatggacgagaac

M0QUN2_E1B19K-01      -----------------------------ggagacactggtttggaactc
M0QUN2_E1B19K-02      ccgaggagcggcctggaccctccgtcggaagaggagctggattgaa--tc
                                                    ***   **** *** *  **

M0QUN2_E1B19K-01      ctctatctcgcct------------------ggtgtacac----------
M0QUN2_E1B19K-02      aggtatccagcctgtacccagagcttagcaaggtgctgacatccatggcc
                         ****  ****                  ****   **          

M0QUN2_E1B19K-01      -----agttaagaagga---------------------------------
M0QUN2_E1B19K-02      aggggagttaagagggagaggagcgatgggggtaataccgggatgatgac
                           ******** ***                                 

M0QUN2_E1B19K-01      --------------------------------------------------
M0QUN2_E1B19K-02      cgagctgacggccagcctgatgaatcggaagcgcccagagcgccttacct

M0QUN2_E1B19K-01      --------------------------------------------------
M0QUN2_E1B19K-02      ggtacgagctacagcaggagtgcagggatgagttgggcctgatgcaggat

M0QUN2_E1B19K-01      --------------------------------------------------
M0QUN2_E1B19K-02      aaatatggcctggagcagataaaaacccattggttgaacccagatgagga

M0QUN2_E1B19K-01      -----------ttataaagaggaatttgaaaatatttttgct----gact
M0QUN2_E1B19K-02      ttgggaggaggctattaagaagtatgccaagatagccctgcgcccagatt
                                  *** **** * **   ** ***    ***     ** *

M0QUN2_E1B19K-01      gc----------------------------tctg----gcctgctagatt
M0QUN2_E1B19K-02      gcaagtacatagtgaccaagaccgtgaatatcagacatgcctgctacatc
                      **                            ** *    ******** ** 

M0QUN2_E1B19K-01      ctctgaatc---------ttggccaccagtccctt---------------
M0QUN2_E1B19K-02      tcggggaacggggcagaggtggtcatcgataccctggacaaggccgcctt
                          * * *          *** ** *  * ** *               

M0QUN2_E1B19K-01      ---------------------------------------------ttcca
M0QUN2_E1B19K-02      caggtgttgcatgatgggaatgagagcaggagtgatgaatatgaattcca

M0QUN2_E1B19K-01      --------------------------ggaaa-----------gggtact-
M0QUN2_E1B19K-02      tgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgctg
                                                *** *           **** ** 

M0QUN2_E1B19K-01      --------------ccaca------------gccttgatttttccagccc
M0QUN2_E1B19K-02      ttcatggccaacagccacatgaccctgcatggctgcagtttcttcggctt
                                    *****            **     *** * * **  

M0QUN2_E1B19K-01      agg------gcgcactacagccggggttgcttt-------------tgtg
M0QUN2_E1B19K-02      caacaatatgtgcgcagaggtctggggcgcttccaagatcaggggatgta
                               * ** *    * * ***  ****              *** 

M0QUN2_E1B19K-01      gtttttctggttgacaaatgg----agccaggacacccaa----------
M0QUN2_E1B19K-02      agttttatggctgctggatgggcgtggtcggaagacccaagagcgagatg
                        **** *** **    ****     * * * * ******          

M0QUN2_E1B19K-01      --------------------------------------------------
M0QUN2_E1B19K-02      tctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctaccga

M0QUN2_E1B19K-01      -------------------------------ctgagcaggggctacatcc
M0QUN2_E1B19K-02      gggcaatgctagagtgagacactgctcttccctggagacgggctgcttct
                                                     ***   * ***** * ** 

M0QUN2_E1B19K-01      ------tggacttcgcagc-------------------------------
M0QUN2_E1B19K-02      gcctggtgaagggcacagcctctctgaagcataatatggtgaagggctgc
                            ** *   * ****                               

M0QUN2_E1B19K-01      --------------------catgc--acctgtg----gagggcctg---
M0QUN2_E1B19K-02      acggatgagcgcatgtacaacatgctgacctgcgattcgggggtctgcca
                                          *****  ***** *    * *** ***   

M0QUN2_E1B19K-01      --------------------------------------------------
M0QUN2_E1B19K-02      tatcctgaagaacatccatgtgacctcccaccccagaaagaagtggccag

M0QUN2_E1B19K-01      -------------------gatcagg------------------------
M0QUN2_E1B19K-02      tgtttgagaataacctgctgatcaagtgccatatgcacctgggagccaga
                                         ***** *                        

M0QUN2_E1B19K-01      ------------cagcggggacagagaatcttgaatta------------
M0QUN2_E1B19K-02      aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
                                  **** *   *** * * *** *   *            

M0QUN2_E1B19K-01      -----------ctggcttctacag-----------ccagcagctccg---
M0QUN2_E1B19K-02      gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
                                  ** ***** ***            * *** **  *   

M0QUN2_E1B19K-01      -ggtcttcttcgtctacac-----------------agacaaacatccat
M0QUN2_E1B19K-02      tggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtccag
                       **   ***  ** ****                  **** **  **** 

M0QUN2_E1B19K-01      gtt----------------ggaggaagaaat-----gaggca------gg
M0QUN2_E1B19K-02      ggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagccagtgg
                      * *                ** ** *** *      ** ***      **

M0QUN2_E1B19K-01      ccatggacgagaacccgaggagc----------------------ggcct
M0QUN2_E1B19K-02      ccctggatgtga--ccgaggagctgagaccagaccacctggtgatggcct
                      ** **** * **  *********                      *****

M0QUN2_E1B19K-01      ggacc--------------ctccgtcggaagaggagctggattga
M0QUN2_E1B19K-02      gtaccgggaccgagttcagctccagtgg-ggaggacacagattag
                      * ***              ****   **  *****    ****  

© 1998-2022Legal notice