Dataset for CDS E1B19K of organism Human adenovirus 23

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QUB4_E1B19K-02      --------------------------------------------------
W8CZB0_E1B19K-02      --------------------------------------------------
M0QUB4_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt
W8CZB0_E1B19K-01      atggaggtgtggactatccttggagactttaacaagacacgccggcttgt

M0QUB4_E1B19K-02      --------------------------------------------------
W8CZB0_E1B19K-02      --------------------------------------------------
M0QUB4_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
W8CZB0_E1B19K-01      agaggatagttcagacgggtgctccgggttttggagacactggtttggaa

M0QUB4_E1B19K-02      --------------------------------------------------
W8CZB0_E1B19K-02      --------------------------------------------------
M0QUB4_E1B19K-01      ctcctctatctcgcctggtgtacacagttaagaaggattataaagaggaa
W8CZB0_E1B19K-01      ctcctctatctcgcctggtgtacacagttaagaaggattataacgaggaa

M0QUB4_E1B19K-02      --------------------------------------------------
W8CZB0_E1B19K-02      --------------------------------------------------
M0QUB4_E1B19K-01      tttgaaaatctttttgctgactgctctggcctgctagattctctgaatct
W8CZB0_E1B19K-01      tttgaaaatctttttgctgactgctctggcctgcttgattctctgaattt

M0QUB4_E1B19K-02      --------------------------------------------------
W8CZB0_E1B19K-02      --------------------------------------------------
M0QUB4_E1B19K-01      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
W8CZB0_E1B19K-01      tggccaccagtcccttttccaggaaagggtcctgcacagccttgattttt

M0QUB4_E1B19K-02      --------------------------------------------------
W8CZB0_E1B19K-02      --------------------------------------------------
M0QUB4_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
W8CZB0_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt

M0QUB4_E1B19K-02      -----atggagccaggacacccaactgagcaggggctacatcctggactt
W8CZB0_E1B19K-02      -----atggagccagaacacccaactgagcaggggctacattctggactt
M0QUB4_E1B19K-01      gacaaatggagccaggacacccaactgagcaggggctacatcctggactt
W8CZB0_E1B19K-01      gacaaatggagccagaacacccaactgagcaggggctacattctggactt
                           ********** ************************* ********

M0QUB4_E1B19K-02      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
W8CZB0_E1B19K-02      cgcagccatgcacctgtggagggcctgggtcaggcagcggggacagagaa
M0QUB4_E1B19K-01      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
W8CZB0_E1B19K-01      cgcagccatgcacctgtggagggcctgggtcaggcagcggggacagagaa
                      **************************** *********************

M0QUB4_E1B19K-02      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta
W8CZB0_E1B19K-02      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta
M0QUB4_E1B19K-01      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta
W8CZB0_E1B19K-01      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta

M0QUB4_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
W8CZB0_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
M0QUB4_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
W8CZB0_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

M0QUB4_E1B19K-02      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa
W8CZB0_E1B19K-02      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa
M0QUB4_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga-
W8CZB0_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga-

M0QUB4_E1B19K-02      tcaggtatccagcctgtacccagagcttagcaaggtgctgacaaccatgg
W8CZB0_E1B19K-02      tcaggtagccagcctatacccagagcttagtaaggtgctgacaaccatgg
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      ccaggggagtgaagagggagaggagcgatgggggcaatacagggatgatg
W8CZB0_E1B19K-02      ccaggggagtgaagagggagaggagtgatgggggcaataccgggatgatg
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      accgagctgacggccagcctgatgaatcgcaagcgcccagagcgcattac
W8CZB0_E1B19K-02      accgagctgactgccagcctgatgaatcgcaagcgcccagagcgcattac
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      ctggcacgagctacagcaggagtgcagggatgagataggcctgatgcagg
W8CZB0_E1B19K-02      ctggcacgagctacagcaggagtgcagggatgagataggcctgatgcagg
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      ataaatatgggctggagcagataaaaactcactggttgaacccagatgag
W8CZB0_E1B19K-02      ataaatatgggcttgagcagataaaaactcactggttgaacccagatgag
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      gattgggaggaggccataaagaaatatgccaagatagccctgcgcccaga
W8CZB0_E1B19K-02      gattgggaggaggccataaagaaatatgccaagatagccctgcgcccaga
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      ttgcaagtacaaaatcaccaagacggtgaatatcagacatgcctgctaca
W8CZB0_E1B19K-02      ttgcaagtacaaaatcaccaagacggtgaatatcagacatgcctgctaca
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      tctcagggaacggggcagaggtgatgatcgataccctggacaagtcagcc
W8CZB0_E1B19K-02      tctcagggaatggggcagaggtgatgatcgataccctggacaagtcagcc
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      ttcaggtgttgcatgatgggaatgagagccggtgtgatgaatatgaattc
W8CZB0_E1B19K-02      ttcaggtgttgcatgatgggaatgagagccggtgtgatgaatatgaattc
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      catgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgc
W8CZB0_E1B19K-02      catgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgc
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      tgttcatggccaacagccacatgaccctgcatggctgcagcttcttcggt
W8CZB0_E1B19K-02      tgttcatgaccaacagccacatgaccctgcatggctgcagcttcttcggt
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      ttcaacaacatgtgcgccgaggtctggggagctgctaagatcaggggctg
W8CZB0_E1B19K-02      ttcaacaacatgtgcgccgaggtctggggcgctgctaagatcaggggctg
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      taagttttatggctgctggatgggagtggtcggaagacccaagagcgaga
W8CZB0_E1B19K-02      taagttttatggctgctggatgggagtggtcggaagacccaagagcgaga
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      tgtctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctacc
W8CZB0_E1B19K-02      tgtctgtgaagcagtgtgtgtttgagaagtgctaccttggggtgtctaca
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      gagggcaatgctagagtgagacattgctcttccctggagacgggctgctt
W8CZB0_E1B19K-02      gagggcaatgctagagtgagacattgctcttccctggagacgggctgctt
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      ttgcctggtgaagggcacagcttctatcaagcataatgtggtgaaaggct
W8CZB0_E1B19K-02      ctgcctggtgaagggcacagcttcgatcaagcataatgtggtgaaaggct
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      gcacggatgagcgcatgtacaacatgctgacctgcgactcaggggtctgt
W8CZB0_E1B19K-02      gcacggatgagcgcatgtacaacatgctgacctgcgactcaggggtctgt
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      catatcctgaagaacatccatgtgaccgcccactccagaaagaagtggcc
W8CZB0_E1B19K-02      catatcctgaagaacatccatgtgaccgcccactccagaaagaagtggcc
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      agtgtttgagaataacctgctgatcaagtgccatatgcacctgggagcca
W8CZB0_E1B19K-02      agtgtttgagaataacctgctaatcaagtgccatatgcacctgggagcca
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      gaaggggcaccttccagccgtaccagtgcaactttagccagaccaagctg
W8CZB0_E1B19K-02      gaaggggcaccttccagccgtaccagtgcaactttagccagaccaagctg
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      ctgctggagaacgatgccttctccagggtgaacctgaacggcatctttga
W8CZB0_E1B19K-02      ctgctggagaacgatgccttctccagggtgaacctgaacggcatctttga
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      catggatgtctcggtgtacaagattctaagatatgatgagaccaggtcca
W8CZB0_E1B19K-02      catggatgtctcggtatacaagattctgagatatgatgagaccaggtcca
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      gggtgcgcgcttgcgagtgtgggggcagacacaccaggatgcagcctgtg
W8CZB0_E1B19K-02      gggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagcctgtg
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      gccctggatgtgacagaggagctgagacccgaccacctggtgatggcctg
W8CZB0_E1B19K-02      gccctggatgtgacagaggagctgagaccagaccacctggtgatggcctg
M0QUB4_E1B19K-01      --------------------------------------------------
W8CZB0_E1B19K-01      --------------------------------------------------

M0QUB4_E1B19K-02      taccgggaccgagttcagctccagcggggaggacacagattag
W8CZB0_E1B19K-02      taccgggaccgagttcagctccagcggggaggacacagattag
M0QUB4_E1B19K-01      -------------------------------------------
W8CZB0_E1B19K-01      -------------------------------------------

© 1998-2022Legal notice