Dataset for CDS adenoviridae of organism Human adenovirus 22

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C5HDR2_E1B19K-02      atggagccagaacacccaactgagcaggggctacattctggacttcgcag
C5HDR2_E1B19K-01      atg-----------------------------------------------
D3GBW3_E1B19K-01      --------------------------------------------------
                                                                        

C5HDR2_E1B19K-02      ccatgcacctgtggagggcatgggtcaggcagcggggacagagaatcttg
C5HDR2_E1B19K-01      ----actcatgggcggggcttagttc------------------------
D3GBW3_E1B19K-01      --------------------------------------------------
                                                                        

C5HDR2_E1B19K-02      aactactggcttatacagccagcagttccgggtcttcttcgtctacacag
C5HDR2_E1B19K-01      -----------tatataagtggcaacacctgggcacttgggcacagacct
D3GBW3_E1B19K-01      --------------------------------------------------
                                                                        

C5HDR2_E1B19K-02      acaaacatccatgttggaggaagaaatgaggcaggccatggacgagaacc
C5HDR2_E1B19K-01      tcag-----------------------ggagttcctgatggatgtg----
D3GBW3_E1B19K-01      -------------------------------------atggatgtg----
                                                           ***** * *    

C5HDR2_E1B19K-02      cgaggagcggcctggaccctccgtcggaagaggagctggattgaatcagg
C5HDR2_E1B19K-01      ------------tggactatc-----------------------------
D3GBW3_E1B19K-01      ------------tggactatc-----------------------------
                                  *****  **                             

C5HDR2_E1B19K-02      tatccagcttgtacccagagcttagcaaggtgctgacatccatggccagg
C5HDR2_E1B19K-01      -------cttg----cagactttagcaagacac-----------gcc---
D3GBW3_E1B19K-01      -------cttg----cagactttagcaagacac-----------gcc---
                             ****    ****  ********   *           ***   

C5HDR2_E1B19K-02      ggagtgaagagggagaggagcgatgggggtaataccgggatgatgaccga
C5HDR2_E1B19K-01      ggcttgtagag---------------------------------gatagt
D3GBW3_E1B19K-01      ggcttgtagag---------------------------------gatagt
                      **  ** ****                                 **  * 

C5HDR2_E1B19K-02      gctgacggccagcctgatgaatcgcaagcgcccagagcgcattacctggc
C5HDR2_E1B19K-01      tcagacgg-------------------gtgctccgggt------tctg--
D3GBW3_E1B19K-01      tcagacgg-------------------gtgctccgggt------tctg--
                       * *****                   * ** * * *        ***  

C5HDR2_E1B19K-02      acgagctacagatggagtgcagggatgagttgggcctgatgcaggataaa
C5HDR2_E1B19K-01      --gagacac----------------tggtttggaactcctct-------a
D3GBW3_E1B19K-01      --gagacac----------------tggtttggaactcctct-------a
                        ***  **                **  ****  **  *         *

C5HDR2_E1B19K-02      tatggcctggagcagataaaaacacattggttgaacccagatgaggattg
C5HDR2_E1B19K-01      tctcgcctggtgtacaca-----------gttaag-------aaggatta
D3GBW3_E1B19K-01      tctcgcctggtgtacaca-----------gttaag-------aaggatta
                      * * ****** * * * *           *** *         ****** 

C5HDR2_E1B19K-02      ggaggaggccattaagaa---atatgccaagatagccctgcgcccagatt
C5HDR2_E1B19K-01      taacgaggaatttgaaaatctttttgct--gattgctctg----------
D3GBW3_E1B19K-01      taacgaggaatttgaaaatctttttgct--gattgctctg----------
                        * ****   ** * **    * ***   *** ** ***          

C5HDR2_E1B19K-02      gcaagtacatggtgaccaagaccgtgaatattagacatgcctgctacatc
C5HDR2_E1B19K-01      --------------------------------------gcctacta----
D3GBW3_E1B19K-01      --------------------------------------gcctacta----
                                                            **** ***    

C5HDR2_E1B19K-02      tcggggaacggggcagaggtggtcatcgataccctgga-caaggccgcct
C5HDR2_E1B19K-01      ---------------------------gattctctgaatctcggccacc-
D3GBW3_E1B19K-01      ---------------------------gattctctgaatctcggccacc-
                                                 *** * *** * *  **** ** 

C5HDR2_E1B19K-02      tcaggtgttgcatgatgggaatgagagcaggagtgatgaatatgaattcc
C5HDR2_E1B19K-01      ---------------------------------------------agtcc
D3GBW3_E1B19K-01      ---------------------------------------------agtcc
                                                                   * ***

C5HDR2_E1B19K-02      atgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgct
C5HDR2_E1B19K-01      ct--tttccaggaa----------------------------agggtact
D3GBW3_E1B19K-01      ct--tttccaggaa----------------------------agggtact
                       *  * * ** ***                             **** **

C5HDR2_E1B19K-02      gttcatggctaacagccacatgaccctgcatggctgcagtttttttggct
C5HDR2_E1B19K-01      ---------------ccaca------------gccttgatttttccagcc
D3GBW3_E1B19K-01      ---------------ccaca------------gccttgatttttccagcc
                                     *****            **     *****   ** 

C5HDR2_E1B19K-02      tcaacaatatgtgcgccgaggtctggggtgcttccaaggtcaggggatgt
C5HDR2_E1B19K-01      cagg------gcgcactacagccggggttgcttt-------------tgt
D3GBW3_E1B19K-01      cagg------gcgcactacagccggggttgcttt-------------tgt
                                * ** *    * * *** *****              ***

C5HDR2_E1B19K-02      aagttttatggctgctggatgggcgtggtcggaagacccaagagcgagat
C5HDR2_E1B19K-01      ggtttttctggttgacaaatgg----agccagaacacccaa---------
D3GBW3_E1B19K-01      ggtttttctggttgacaaatgg----agccagaacacccaa---------
                         **** *** **    ****     * * *** ******         

C5HDR2_E1B19K-02      gtctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctaccg
C5HDR2_E1B19K-01      --ctg---agcaggg--------------gctac----------------
D3GBW3_E1B19K-01      --ctg---agcaggg--------------gctac----------------
                        ***   ***** *              *****                

C5HDR2_E1B19K-02      agggcaatgctagagtgagacactgctcttccctggatacgggctgcttc
C5HDR2_E1B19K-01      ------attctgg--------acttcgcagccatgca-------------
D3GBW3_E1B19K-01      ------attctgg--------acttcgcagccatgca-------------
                            ** ** *        *** * *  ** ** *             

C5HDR2_E1B19K-02      tgcctggtgaagggcacagcttctatcaagcataatgtggtgaagggctg
C5HDR2_E1B19K-01      ---cctgtggagggcatgg-----gtcaggca------------------
D3GBW3_E1B19K-01      ---cctgtggagggcatgg-----gtcaggca------------------
                         *  *** ******  *      *** ***                  

C5HDR2_E1B19K-02      cacggatgagcgcatgtacaacatgctgacctgcgactcgggggtctgcc
C5HDR2_E1B19K-01      -----------gcggggaca------------------------------
D3GBW3_E1B19K-01      -----------gcggggaca------------------------------
                                 **  * ***                              

C5HDR2_E1B19K-02      atatcctgaaaaacatccatgtgacctcccaccccagaaagaagtggcca
C5HDR2_E1B19K-01      --------------------------------------------------
D3GBW3_E1B19K-01      --------------------------------------------------
                                                                        

C5HDR2_E1B19K-02      gtgtttgagaataacctgctgatcaagtgccatatgcacctgggcgccag
C5HDR2_E1B19K-01      ------gagaatc-----ttgaactactggcttataca-------gccag
D3GBW3_E1B19K-01      ------gagaatc-----ttgaactactggcttataca-------gccag
                            ******       *** * * ** * *** **       *****

C5HDR2_E1B19K-02      aaggggcaccttccagccgtaccagtgcaactttagccagaccaagctgc
C5HDR2_E1B19K-01      cag-------ttccgg----------------------------------
D3GBW3_E1B19K-01      cag-------ttccgg----------------------------------
                       **       **** *                                  

C5HDR2_E1B19K-02      tgttggagaacgatgccttctccagggtgaacctgaatggcatctttgac
C5HDR2_E1B19K-01      --------------gtcttcttc---------------------------
D3GBW3_E1B19K-01      --------------gtcttcttc---------------------------
                                    * ***** *                           

C5HDR2_E1B19K-02      atggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtcca
C5HDR2_E1B19K-01      ------------gtctacac-----------------agacaaacatcca
D3GBW3_E1B19K-01      ------------gtctacac-----------------agacaaacatcca
                                  ** ****                  **** **  ****

C5HDR2_E1B19K-02      gggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcaaccagtg
C5HDR2_E1B19K-01      tgtt----------------ggaggaagaaat-----gaggca------g
D3GBW3_E1B19K-01      tgtt----------------ggaggaagaaat-----gaggca------g
                       * *                ** ** *** *      ** ***      *

C5HDR2_E1B19K-02      gccctggatgtga--ccgaggagctgagaccagaccacctggtgatggcc
C5HDR2_E1B19K-01      gccatggacgagaacccgaggagc----------------------ggcc
D3GBW3_E1B19K-01      gccatggacgagaacccgaggagc----------------------ggcc
                      *** **** * **  *********                      ****

C5HDR2_E1B19K-02      tgtaccgggaccgagttcagctccagtgg-ggaggacacagattag
C5HDR2_E1B19K-01      tggacc--------------ctccgtcggaagaggagctggattga
D3GBW3_E1B19K-01      tggacc--------------ctccgtcggaagaggagctggattga
                      ** ***              ****   **  *****    ****  

© 1998-2022Legal notice