Dataset for CDS adenoviridae of organism Human adenovirus 20

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QU76_E1B19K-01      atggat-----------------gtgtggactatccttgcagactttagc
M0QU76_E1B19K-02      atggagccagaacacccaactgagcaggggcta-cattctggacttcg--
                      *****                  *   ** *** * **   *****    

M0QU76_E1B19K-01      aagacacgccggcttgtagaggata-------------------------
M0QU76_E1B19K-02      cagccatgc--acctgtggagggcatgggtgaggcagcggggacagagaa
                       ** ** **   * *** ****  *                         

M0QU76_E1B19K-01      -----------------gttcagacgggtgctccgggttct---------
M0QU76_E1B19K-02      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
                                        * *** * *  *********  *         

M0QU76_E1B19K-01      --------------------------------------------------
M0QU76_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

M0QU76_E1B19K-01      ---------------------------------ggagacactggtttg--
M0QU76_E1B19K-02      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa
                                                        ***   **** ***  

M0QU76_E1B19K-01      ----------------------gaact--------------cctctat--
M0QU76_E1B19K-02      tcaggtatccagcttgtacccagagcttagcaaggtgctgacatccatgg
                                            ** **              * ** **  

M0QU76_E1B19K-01      --------------------------------------------------
M0QU76_E1B19K-02      ccaggggagtgaagagggagaggagcgatgggggcaataccgggatgatg

M0QU76_E1B19K-01      -------------ctcgtctggtg--------------------------
M0QU76_E1B19K-02      accgagctgacggccagcctgatgaatcgcaagcgcccagagcgcattac
                                   *  * *** **                          

M0QU76_E1B19K-01      -----------taca-----------------------------------
M0QU76_E1B19K-02      atggcacgagctacagatggagtgcagggatgagttgggcctgatgcagg

M0QU76_E1B19K-01      -----------------cagttaaga----------------------ag
M0QU76_E1B19K-02      ataaatatggcctggagcagataaaaacacattggttgaacccagatgag
                                       *** *** *                      **

M0QU76_E1B19K-01      gattataacgaggaaattgaaaatctttttgct--gattgctctg-----
M0QU76_E1B19K-02      gattgggaggaggccattaagaa---atatgccaagatagccctgcgccc
                      ****   * ****  *** * **    * ***   *** ** ***     

M0QU76_E1B19K-01      -------------------------------------------gcctgct
M0QU76_E1B19K-02      agattgcaagtacatagtgaccaagaccgtgaatattagacatgcctgct

M0QU76_E1B19K-01      agattctctgaatctcggc---------caccagtccctt----------
M0QU76_E1B19K-02      acatttcgggtaacggggcagaggtggtcatcgataccctggacaaggcc
                      * ***    * * *  ***         ** *  * ** *          

M0QU76_E1B19K-01      -----------ttccaggaaagg------------------------gta
M0QU76_E1B19K-02      gccttcaggtgttgcatgatgggaatgagagcaggagtgatgaatatgaa
                                 ** ** **  **                        * *

M0QU76_E1B19K-01      ctccacagccttgat-----------------------------------
M0QU76_E1B19K-02      ttccatgatcttcatgaacatgaagttcaatggagagaagtttaatgggg
                       ****    *** **                                   

M0QU76_E1B19K-01      ---ttttc--------cagcc-cagggcgcactacagccggggttgcttt
M0QU76_E1B19K-02      tgctgttcatggccaacagccacatgaccctgcatggctgcagtttcttt
                         * ***        ***** ** * * *   *  ** *  *** ****

M0QU76_E1B19K-01      --------------------------------------------------
M0QU76_E1B19K-02      ggcttcaacaatatgtgcgccgaggtctggggcgcttccaagatcagggg

M0QU76_E1B19K-01      -tgtggtttttctggttgacaaatgg----agccagaacacccaa-----
M0QU76_E1B19K-02      atgtaagttttatggctgttggatgggcgtagtgggaagacccaagagcg
                       ***   **** *** **    ****    **   *** ******     

M0QU76_E1B19K-01      --------------------------------------------------
M0QU76_E1B19K-02      agatgtctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctct

M0QU76_E1B19K-01      ------------------------------------ctgagcaggggct-
M0QU76_E1B19K-02      accgagggcaatgctagagtgagacactgctcttccctggatacgggctg
                                                          ***   * ***** 

M0QU76_E1B19K-01      --------------------------------------------------
M0QU76_E1B19K-02      tttctgcctggtgaagggtacggcctctctgaagcataatatggtgaagg

M0QU76_E1B19K-01      ------------------------acattctggacttcg-----------
M0QU76_E1B19K-02      gctgcacagatgagcgcatgtacaacatgctgacctgcgactcgggggtc
                                              **** ***  ** **           

M0QU76_E1B19K-01      -----------------cagccatgc------------------------
M0QU76_E1B19K-02      tgccatatcctgaagaacatccatgtgacctcccaccccagaaagaagtg
                                       ** *****                         

M0QU76_E1B19K-01      -----------------acctgtgga-------------gggcatgggtg
M0QU76_E1B19K-02      gccagtgtttgagaataacctgctgatcaagtgccatatgcacctgggtg
                                       *****  **             *  * ******

M0QU76_E1B19K-01      -----agg---------cagcggggacagagaatcttgaacta-------
M0QU76_E1B19K-02      ccagaaggggcaccttccagccgtaccagtgcaactttagccagaccaag
                           ***         **** *   *** * * *** * * *       

M0QU76_E1B19K-01      ----------------ctggcttatacag-----------ccagcagctc
M0QU76_E1B19K-02      ctgctgttggagaacgatgccttctccagggtgaacctgaacggcatctt
                                       ** *** * ***            * *** ** 

M0QU76_E1B19K-01      cg----ggtcttcttcgtctaca-----cagacaaac-----------at
M0QU76_E1B19K-02      tgacatggatgtctcggtgtacaagatcctgagatacgatgagaccaggt
                       *    **   ***  ** ****     * ** * **            *

M0QU76_E1B19K-01      ccatgtt----------------ggaggaagaaat-----gaggca----
M0QU76_E1B19K-02      ccagggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagcct
                      *** * *                ** ** *** *      ** ***    

M0QU76_E1B19K-01      --ggccatggacgagaacccgaggagc----------------------g
M0QU76_E1B19K-02      gtggccctggatgtga--cagaggagctgagaccagaccacctggtgatg
                        **** **** * **  * *******                      *

M0QU76_E1B19K-01      gcctggacc--------------ctccgtcggaagaggagctggattga
M0QU76_E1B19K-02      gcctgtaccgggaccgagttcagctccagcgg-ggaggacacagattag
                      ***** ***              ****  ***  *****    ****  

© 1998-2020Legal notice