Dataset for CDS E1B19K of organism Human adenovirus 14

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q32UI6_E1B19K-01      atgga-----------------------------ggtttgggc-------
Q32UI6_E1B19K-02      atggatcccgcagactcatttcagcaggggatacgttttggatttcgtag
                      *****                             * *****         

Q32UI6_E1B19K-01      ------cattttggaagacc-------ttagaaagactagg---------
Q32UI6_E1B19K-02      ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
                            **** ****  **        ** * ****  ***         

Q32UI6_E1B19K-01      --------------------------------------------------
Q32UI6_E1B19K-02      ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc

Q32UI6_E1B19K-01      -----------caactgtt-----------------agagaacgcttcg-
Q32UI6_E1B19K-02      accggtcatgccagcggttctggaggaggaacagcaagaggacaacccga
                                 ** * ***                 **** **    ** 

Q32UI6_E1B19K-01      ----------------------------gacgga-----------gtctc
Q32UI6_E1B19K-02      gagccggcctggaccctccagtggaggaggcggagtagctgacttgtctc
                                                  * ****           *****

Q32UI6_E1B19K-01      c-------------------------------------------------
Q32UI6_E1B19K-02      ctgaactgcaacgggtgcttactggatctacgtccactggacgggatagg

Q32UI6_E1B19K-01      --------------------------------------------------
Q32UI6_E1B19K-02      ggcgttaaaagggagagggcatctagtggtactgatgctagatctgagtt

Q32UI6_E1B19K-01      ggtttt--------------------------------------------
Q32UI6_E1B19K-02      ggctttaagtttaatgagtcgcagacgtcctgaaaccatttggtggcatg
                      ** ***                                            

Q32UI6_E1B19K-01      ----------------------tggagattctggttcgctagtgaatta-
Q32UI6_E1B19K-02      aggtccagaaagagggaagggatgaagtttctgtattgcaggagaaatat
                                            ** ** *****  * **  * *** ** 

Q32UI6_E1B19K-01      --------------------------------------------------
Q32UI6_E1B19K-02      tcactggaacaggtgaaaacatgttggttggagcctgaggatgattggga

Q32UI6_E1B19K-01      -------------------gctagggtagtttttag----gataaa----
Q32UI6_E1B19K-02      ggtggccattaaaaattatgccaagatagctttgaggcctgataaacagt
                                         ** * * *** *** **    ******    

Q32UI6_E1B19K-01      acaggactataaagaaga-------------------------atttgaa
Q32UI6_E1B19K-02      ataagattactagacggattaatatccggaatgcttgttacatatctgga
                      * * ** **  *    **                         ** ** *

Q32UI6_E1B19K-01      a---------agttgttggtagattgtccag-------gactttttgaag
Q32UI6_E1B19K-02      aatggggctgaggtggtaatagatactccagacaagacagttattagatg
                      *         ** ** *  *****  *****          * ** ** *

Q32UI6_E1B19K-01      ct-----cttaatttgggccatcaagttcactttaaagaaaaag----tt
Q32UI6_E1B19K-02      ctgcatgatggatatgtggcctggagtagtcggtatggaagcagtaactt
                      **      *  ** ** * * *  ***   *  **  ***  **    **

Q32UI6_E1B19K-01      ttatcagttttagact----------------------------tttcga
Q32UI6_E1B19K-02      ttgtaaatgttaagtttaggggagatggttataatggaatagtgtttatg
                      ** * * * ***   *                            ***   

Q32UI6_E1B19K-01      ccccaggtagaactgccgctgc-----tgtggcttttcttacttttatat
Q32UI6_E1B19K-02      gccaataccaaacttatattgcatggttgtagcttttttggttttaacaa
                       ** *     ****     ***     *** ****** *   *** * * 

Q32UI6_E1B19K-01      tagataaatggat-cccgcagactcatttcagcagggg------------
Q32UI6_E1B19K-02      tacctgtgtagatgcctggggacaggttagtgtacggggatgtagtttct
                      **  *   * *** ** *  ***   **   * * ***            

Q32UI6_E1B19K-01      atacgttttggatttcgtagccacagc------------------attg-
Q32UI6_E1B19K-02      atgcgtgttggatt-----gccacagctggcagaaccaagagtcaattgt
                      ** *** *******     ********                  **** 

Q32UI6_E1B19K-01      ---tggag---------------------aacatgg--------------
Q32UI6_E1B19K-02      ctctgaagaaatgcatattccaaagatgtaacctgggcattcttaatgaa
                         ** **                     *** ***              

Q32UI6_E1B19K-01      ---------aaggttcgcaa--------------------gatg------
Q32UI6_E1B19K-02      ggcgaagcaagggtccgccactgcgcttctacagatactggatgttttat
                               * *** *** *                    ****      

Q32UI6_E1B19K-01      --------aggacaat----------------------------------
Q32UI6_E1B19K-02      tttaattaagggcaatgccagcgtaaagcataacatgatttgcggtgctt
                              *** ****                                  

Q32UI6_E1B19K-01      ------------ctta----------------------------------
Q32UI6_E1B19K-02      ccgatgagaggccttatcaaatgctcacttgtgccggagggcattgtaac

Q32UI6_E1B19K-01      -----ggttactg-------------------------------------
Q32UI6_E1B19K-02      atgctggctactgtgcatattgtttctcatcaacgcaaaaaatggcctgt
                           ** *****                                     

Q32UI6_E1B19K-01      --------------------------------------------------
Q32UI6_E1B19K-02      ttttgatcacaatgtgttgaccaagtgtaccatgcatgcaggtgggcgta

Q32UI6_E1B19K-01      ------------------gccagtgca-----------------------
Q32UI6_E1B19K-02      gaggaatgtttatgccttaccagtgtaacatgaatcatgtaaaagtgttg
                                         ****** *                       

Q32UI6_E1B19K-01      ------------gcctt--------tgggtgtagcggga-----------
Q32UI6_E1B19K-02      ttggaaccagatgccttttccagaatgagtctaacaggaatgtttgacat
                                  *****        ** ** ** * ***           

Q32UI6_E1B19K-01      -------------------atcctgaggcat------------ccaccgg
Q32UI6_E1B19K-02      gaacatgcaaatctggaagatcctgaggtatgatgatacaagatcgaggg
                                         ********* **             *   **

Q32UI6_E1B19K-01      t-catgccagcggttctggagg-aggaa----------cagcaagag---
Q32UI6_E1B19K-02      tgcgcgcatgcgaatgcggaggcaagcatgccaggttccagccggtgtgt
                      * *  **  ***  *  ***** * * *          ****  * *   

Q32UI6_E1B19K-01      ------------gacaacccgaga------------------gccggc-c
Q32UI6_E1B19K-02      gtagatgtgactgaagatctgagaccggatcatttggttattgcccgcac
                                  **  * * ****                  *** ** *

Q32UI6_E1B19K-01      tggacc---------ctccagtggag--gaggcggagtag
Q32UI6_E1B19K-02      tggagcagagttcggatccagtggagaagaaactgactaa
                      **** *          **********  **  * ** ** 

© 1998-2022Legal notice