Dataset for CDS E1B19K of organism Human adenovirus 11

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q7T8D8_E1B19K-03      atgag----------------------tggaaacgcttc-----------
Q7T8D8_E1B19K-02      atggatcccgcagactcatttcagcaggggatacgttttggatttcatag
Q7T8D8_E1B19K-01      atgga-----------------------------ggtttgggc-------
Q8B8U7_E1B19K-01      atgga-----------------------------ggtttgggc-------
                      ***                               * **            

Q7T8D8_E1B19K-03      --------ttttaaggg-------------gggagtctt-----------
Q7T8D8_E1B19K-02      ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
Q7T8D8_E1B19K-01      ------cattttggaagacc-------ttaggaagactagg---------
Q8B8U7_E1B19K-01      ------cattttggaagacc-------ttaggaagactagg---------
                              ** *                  *  **               

Q7T8D8_E1B19K-03      --------------------------------------------------
Q7T8D8_E1B19K-02      ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc
Q7T8D8_E1B19K-01      --------------------------------------------------
Q8B8U7_E1B19K-01      --------------------------------------------------

Q7T8D8_E1B19K-03      -----------cagcccttatct---------------------------
Q7T8D8_E1B19K-02      accggtcatgccagcggttctggaggaggaacagcaagaggacaacccga
Q7T8D8_E1B19K-01      -----------caactgtt-----------------agagaacgcttcg-
Q8B8U7_E1B19K-01      -----------caactgtt-----------------agagaacgcttcg-
                                 ** *  **                               

Q7T8D8_E1B19K-03      ----------------------------gacagggc---------gtctc
Q7T8D8_E1B19K-02      gagccggcctggaccctccagtggaggaggcggagtagctgacttgtctc
Q7T8D8_E1B19K-01      ----------------------------gacgga-----------gtctc
Q8B8U7_E1B19K-01      ----------------------------gacgga-----------gtctc
                                                  * * *            *****

Q7T8D8_E1B19K-03      c-------------------------------------------------
Q7T8D8_E1B19K-02      ctgaactgcaacgggtgcttactggatctacgtccactggacgggatagg
Q7T8D8_E1B19K-01      c-------------------------------------------------
Q8B8U7_E1B19K-01      c-------------------------------------------------

Q7T8D8_E1B19K-03      --------------------------------------------------
Q7T8D8_E1B19K-02      ggcgttaagagggagagggcatctagtggtactgatgctagatctgagtt
Q7T8D8_E1B19K-01      --------------------------------------------------
Q8B8U7_E1B19K-01      --------------------------------------------------

Q7T8D8_E1B19K-03      --------------------------------------------------
Q7T8D8_E1B19K-02      ggctttaagtttaatgagtcgcagacgtcctgaaaccatttggtggcatg
Q7T8D8_E1B19K-01      ggtttt--------------------------------------------
Q8B8U7_E1B19K-01      ggtttt--------------------------------------------

Q7T8D8_E1B19K-03      --------------------------catcctgg---gcaggag------
Q7T8D8_E1B19K-02      aggttcagaaagagggaagggatgaagtttctgtattgcaggagaaatat
Q7T8D8_E1B19K-01      ----------------------tggagattctggttcgctagtgaatta-
Q8B8U7_E1B19K-01      ----------------------tggagattctggttcgctagtgaatta-
                                                  * ***    **  * *      

Q7T8D8_E1B19K-03      --------------------------------------------------
Q7T8D8_E1B19K-02      tcactggaacaggtgaaaacatgttggttggagcctgaggatgattggga
Q7T8D8_E1B19K-01      --------------------------------------------------
Q8B8U7_E1B19K-01      --------------------------------------------------

Q7T8D8_E1B19K-03      ----------------ttcgtcagaat-gttatggg--------------
Q7T8D8_E1B19K-02      ggtggccattaaaaattatgccaagatagctttgaggcctgataaacagt
Q7T8D8_E1B19K-01      -------------------gctagggtagtttttag----gataaa----
Q8B8U7_E1B19K-01      -------------------gctagggtagtttttag----gataaa----
                                         *  *   * * * *  *              

Q7T8D8_E1B19K-03      -------------------------------------------atct---
Q7T8D8_E1B19K-02      ataagattactagacggattaatatccggaatgcttgttacatatctgga
Q7T8D8_E1B19K-01      acaggactataaacaaga-------------------------atttgaa
Q8B8U7_E1B19K-01      acaggactataaccaaga-------------------------atttgaa
                                                                 ** *   

Q7T8D8_E1B19K-03      -----------actgtggatggaagacccgtccaacccgccaattcttca
Q7T8D8_E1B19K-02      aatggggctgaggtggtaataga-tactcaa--gacaaggcagttattag
Q7T8D8_E1B19K-01      a---------agttgttggtagattgcccag--gac--------tttttg
Q8B8U7_E1B19K-01      a---------agttgttggtagattgcccag--gac--------tttttg
                                   **    * **   * *     **        * **  

Q7T8D8_E1B19K-03      acgct--------gacctatgct---------------------------
Q7T8D8_E1B19K-02      atgctgcatgatggatatgtggcctggggtagtcggtatggaagcagtaa
Q7T8D8_E1B19K-01      aagct-----cttaatttgggccatcaggttcactttaaagaaaaag---
Q8B8U7_E1B19K-01      aagct-----cttaatttgggccatcaggttcactttaaagaaaaag---
                      * ***         *  *  *                             

Q7T8D8_E1B19K-03      ---------actttaagtt----------------------------ctt
Q7T8D8_E1B19K-02      cttttgtaaatgttaagtttaggggagatggttataatggaatagtgttt
Q7T8D8_E1B19K-01      -ttttatcagttttagact----------------------------ttt
Q8B8U7_E1B19K-01      -ttttatcagttttagact----------------------------ttt
                                  ***   *                             **

Q7T8D8_E1B19K-03      cacctttggacgcagctgcagctgc--cgccgccgcttctgttgccgcta
Q7T8D8_E1B19K-02      atggccaataccaaacttatattgcatggttgtagcttttttggtt-tca
Q7T8D8_E1B19K-01      caaccccaggtagaactgctgctgc-----tgtggcttttcttact-ttt
Q8B8U7_E1B19K-01      caaccccaggtagaactgctgctgc-----tgtggcttttcttact-ttt
                                   * **     ***      *  **** * *        

Q7T8D8_E1B19K-03      acact----------gtgcttggaa-------------------------
Q7T8D8_E1B19K-02      acaatacctgtgtagatgcctggggacaggttagtgtacggggatgtagt
Q7T8D8_E1B19K-01      atattagataaatggat-cccgcagactcatttcagcagggg--------
Q8B8U7_E1B19K-01      atattagataaatggat-cccgcagactcatttcagcagggg--------
                      * * *           * *  *                            

Q7T8D8_E1B19K-03      ------------tgggtt-------------------------------a
Q7T8D8_E1B19K-02      ttctatgcgtgttggatt-----gccacagctggcagaaccaagagtcaa
Q7T8D8_E1B19K-01      ----atacgttttggatttcatagccacagc------------------a
Q8B8U7_E1B19K-01      ----atacgttttggatttcatagccacagc------------------a
                                  *** **                               *

Q7T8D8_E1B19K-03      cta----tggaa-------------------gcatcatgg----------
Q7T8D8_E1B19K-02      ttgtctctgaagaaatgcatatttcaaagatgtaacctgggcattctgaa
Q7T8D8_E1B19K-01      ttg----tggag---------------------aacatgg----------
Q8B8U7_E1B19K-01      ttg----tggag---------------------aacatgg----------
                       *     ** *                      * * ***          

Q7T8D8_E1B19K-03      --------------------ctaattccacttcctctaata---accctt
Q7T8D8_E1B19K-02      tgaaggcgaagcaagggtccgccactgcgcttctacagatactggatgtt
Q7T8D8_E1B19K-01      -------------aaggttcgcaa--------------------gatg--
Q8B8U7_E1B19K-01      -------------aaggttcgcaa--------------------gatg--

Q7T8D8_E1B19K-03      ctaccctgactcaggacaa-------------------------------
Q7T8D8_E1B19K-02      ttattttgattaagggaaatgccagcgtaaagcataacatgatttgcggt
Q7T8D8_E1B19K-01      ------------aggacaat------------------------------
Q8B8U7_E1B19K-01      ------------aggacaat------------------------------
                                  ***  **                               

Q7T8D8_E1B19K-03      --------------------------------------------------
Q7T8D8_E1B19K-02      gcttccgatgagaggccttatcaaatgctcacttgtgctggtgggcattg
Q7T8D8_E1B19K-01      ----------------ctta------------------------------
Q8B8U7_E1B19K-01      ----------------ctta------------------------------

Q7T8D8_E1B19K-03      ----------gttactt---------------------------------
Q7T8D8_E1B19K-02      taatatgctggctactgtgcatattgtttcccatcaacgcaaaaaatggc
Q7T8D8_E1B19K-01      ---------ggttactg---------------------------------
Q8B8U7_E1B19K-01      ---------ggttactg---------------------------------
                                * ****                                  

Q7T8D8_E1B19K-03      --------------------------------------------------
Q7T8D8_E1B19K-02      ctgtttttgatcacaatgtgatgacgaagtgtaccatgcatgcaggtggg
Q7T8D8_E1B19K-01      --------------------------------------------------
Q8B8U7_E1B19K-01      --------------------------------------------------

Q7T8D8_E1B19K-03      --------------------------------------------------
Q7T8D8_E1B19K-02      cgtagaggaatgtttatgccttaccagtgtaacatgaatcatgtgaaagt
Q7T8D8_E1B19K-01      ----------------------gccagtgca-------------------
Q8B8U7_E1B19K-01      ----------------------gccagtgca-------------------

Q7T8D8_E1B19K-03      ----------------gtcctt-------ttggcccagctggaggctttg
Q7T8D8_E1B19K-02      gttgttggaaccagatgccttttccagaatgagcctaacaggaatttttg
Q7T8D8_E1B19K-01      ----------------gcctt--------tgggtgtagcggga-------
Q8B8U7_E1B19K-01      ----------------gcctt--------tgggtgtagcggga-------
                                      * * *        *  *   * * ***       

Q7T8D8_E1B19K-03      a------------------------cccaacgtct---------------
Q7T8D8_E1B19K-02      acatgaacatgcaaatctggaagatcctgaggtatgatgatacgagatcg
Q7T8D8_E1B19K-01      -----------------------atcctgaggcat------------cca
Q8B8U7_E1B19K-01      -----------------------atcctgaggcat------------cca
                                               **  * *  *               

Q7T8D8_E1B19K-03      -gggt----------------------gaactttct----------cagc
Q7T8D8_E1B19K-02      agggtacgcgcatgcgaatgcggaggcaagcatgccaggttccagccggt
Q7T8D8_E1B19K-01      ccggt-------------------------catgccag--------cggt
Q8B8U7_E1B19K-01      ccggt-------------------------catgccag--------cggt
                        ***                         * * *           * * 

Q7T8D8_E1B19K-03      aggtggtcgagttgc-----gagtacaaactgagtctgctg---------
Q7T8D8_E1B19K-02      gtgtgtagatgtgactg-aagatctcagaccggatcatttggttattgcc
Q7T8D8_E1B19K-01      -tctggaggaggaacagcaagaggacaacccgag-------------agc
Q8B8U7_E1B19K-01      -tctggaggaggaacagcaagaggacaacccgag-------------agc
                         **     *   *     **   **  * *                  

Q7T8D8_E1B19K-03      ----------------------tcggcacggcaaagtctaaataa
Q7T8D8_E1B19K-02      cgcactggagcagagttcggatccagtggagaagaaactgactaa
Q7T8D8_E1B19K-01      cggcctggacc---------ctccagtggag--gaggcggagtag
Q8B8U7_E1B19K-01      cggcctggacc---------ctccagtggag--gaggcggagtag
                                             * *    *   *  *  * ** 

© 1998-2022Legal notice