Dataset for CDS E1B19K of organism Human adenovirus 11

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q7T8D8_E1B19K-01      atggaggtttgggccattttggaagaccttaggaagactaggcaactgtt
Q8B8U7_E1B19K-01      atggaggtttgggccattttggaagaccttaggaagactaggcaactgtt

Q7T8D8_E1B19K-01      agagaacgcttcggacggagtctccggtttttggagattctggttcgcta
Q8B8U7_E1B19K-01      agagaacgcttcggacggagtctccggtttttggagattctggttcgcta

Q7T8D8_E1B19K-01      gtgaattagctagggtagtttttaggataaaacaggactataaacaagaa
Q8B8U7_E1B19K-01      gtgaattagctagggtagtttttaggataaaacaggactataaccaagaa
                      ******************************************* ******

Q7T8D8_E1B19K-01      tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
Q8B8U7_E1B19K-01      tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt

Q7T8D8_E1B19K-01      gggccatcaggttcactttaaagaaaaagttttatcagttttagactttt
Q8B8U7_E1B19K-01      gggccatcaggttcactttaaagaaaaagttttatcagttttagactttt

Q7T8D8_E1B19K-01      caaccccaggtagaactgctgctgctgtggcttttcttacttttatatta
Q8B8U7_E1B19K-01      caaccccaggtagaactgctgctgctgtggcttttcttacttttatatta

Q7T8D8_E1B19K-01      gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
Q8B8U7_E1B19K-01      gataaatggatcccgcagactcatttcagcaggggatacgttttggattt

Q7T8D8_E1B19K-01      catagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
Q8B8U7_E1B19K-01      catagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa

Q7T8D8_E1B19K-01      tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
Q8B8U7_E1B19K-01      tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg

Q7T8D8_E1B19K-01      catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
Q8B8U7_E1B19K-01      catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa

Q7T8D8_E1B19K-01      cccgagagccggcctggaccctccagtggaggaggcggagtag
Q8B8U7_E1B19K-01      cccgagagccggcctggaccctccagtggaggaggcggagtag

© 1998-2020Legal notice