Dataset for CDS HRK of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

30 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P62816_HRK-03          atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcgg
P62817_HRK-01          atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcgg
A0A1U7R468_HRK-01      atgtgcccgtgtccccggcatcgcggccacgggcctccggccgtgtgcgg
G3UH24_HRK-01          atgtgtccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgc
A0A4X1TMB1_HRK-01      atgtgtccgtgccccctgcaccgcggccgcggccccccagccgtgtgcgc
A0A2K5KZ69_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcga
G3QTJ6_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
O00198_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A4W2CRW4_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A4W2CRW4_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A4W2GVZ3_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A4W2GVZ3_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A2K6GL98_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
H2NIS8_HRK-01          atgtgcccgtgtcccctgcaccgcgaccgcggccccccggccgtgtgcgc
A0A096N944_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
H2Q6Y8_HRK-01          atgtgcccgtgccccctgcaccgcggccgcgaccccccggccgtgtgcgc
H0Y001_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
G1T7W1_HRK-01          atgtgcccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgc
G1QHD8_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A2K6AYL7_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A337SQ56_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A3Q2IBL3_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgtgc
A0A0D9SC73_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A2K5PIE7_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtttgcgc
A0A452DXE5_HRK-01      atgtgcccgtgccccctgcaccgcggccgtggccccccggccgtgtgcgc
U3E722_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtttgcgc
A0A2K5BYA0_HRK-01      atgtgcccgtgccccctgcaccgcggtcgcggccccccggccgtttgcgc
O00198_HRK-03          --------------------------------------------------
F7G1G0_HRK-01          atgtgcccgtgtcccctgcaccgcggtcgcggtcccccggcggtgtgcgc
A0A4X2K3J4_HRK-01      atgtgcccgtgccccctgcaccgcggtcgcggccccccggcggtgtgcgc
                                                                         

P62816_HRK-03          ttgcggcgacgctcgccccgggctgcgctgggcggcggcg---caggtga
P62817_HRK-01          ttgcggcgacgctcgccccgggctgcgctgggcggcggcg---caggtga
A0A1U7R468_HRK-01      ttgcggcgacactcgccccgggctgcgctgggcggcggca---caggtga
G3UH24_HRK-01          ctgcagcgcaggtcgcctgggtctgcgctcgtccgccgcg---cagctca
A0A4X1TMB1_HRK-01      ttgcagcgcgagccgcctgggtctgcgctcctccgccgcg---cagctca
A0A2K5KZ69_HRK-01      ctgcagcgcgggtcgtttggggctgcgctcgtccgccgcg---cagctca
G3QTJ6_HRK-01          ctgcagcgcgggtcgcctggggctgcgctcgtccgccgcg---cagctca
O00198_HRK-01          ctgcagcgcgggtcgcctggggctgcgctcgtccgccgcg---cagctca
A0A4W2CRW4_HRK-01      ctgcagcgccggccgcctgggtctgcgctcgtccgccgcg---cagctca
A0A4W2CRW4_HRK-01      ctgcagcgccggccgcctgggtctgcgctcgtccgccgcg---cagctca
A0A4W2GVZ3_HRK-01      ctgcagcgccggccgcctgggtctgcgctcgtccgccgcg---cagctca
A0A4W2GVZ3_HRK-01      ctgcagcgccggccgcctgggtctgcgctcgtccgccgcg---cagctca
A0A2K6GL98_HRK-01      ctgcagcgcgggtcgcctgggtctgcgctcgtccgccgcg---cagctca
H2NIS8_HRK-01          ctgcagcgcgggtcgcctggggctgcgctcgtccgccgcg---cagctca
A0A096N944_HRK-01      ctgcagcgcgggtcgtttggggctgcgctcgtccgccgcg---cagctca
H2Q6Y8_HRK-01          ctgcagcgcgggtcgcctggggctgcgctcgtccgccgcg---cagctca
H0Y001_HRK-01          ctgcagcgcgggtcgtctgggtctgcgctcgtctgccgcg---cagctca
G1T7W1_HRK-01          ctgcagcgcgggccgcctggggctgcgctcggccgccgcg---cagctca
G1QHD8_HRK-01          ctgcagcgcgggtcgcctggggctgcgctcgtccgccgcg---cagctca
A0A2K6AYL7_HRK-01      ctgcagcgcgggtcgcttggggctgcgctcgtccgccgcg---cagctca
A0A337SQ56_HRK-01      ctgcagcgcgggccgcctgggtctgcgctcgtccgccgcg---cagctca
A0A3Q2IBL3_HRK-01      ctgcagcgcgggccgcctgggtctgcgctcgtcagccgcg---cagctca
A0A0D9SC73_HRK-01      ctgcagcgcgggtcgcttggggctgcgctcgtccgccgcg---cagctca
A0A2K5PIE7_HRK-01      ctgcagcgcgggtcgcctggggctgcgctcgtccgccgcg---cagctca
A0A452DXE5_HRK-01      ctgcagcgccggccgtctgggtctgcgctcgtccgccgcg---cagctca
U3E722_HRK-01          ctgcagcgcgggtcgcctggggctgcgctcgtccgccgcg---cagctca
A0A2K5BYA0_HRK-01      ctgcagcgcgggtcgcctggggctgcgctcgtccgccgcg---cagctca
O00198_HRK-03          --------------------------------------------------
F7G1G0_HRK-01          ctgcagctcggaccgcctggaacagcgcgcggcggcggcagcacagctca
A0A4X2K3J4_HRK-01      ctgcagctccggccgcctcgagcagcgcgcggcggcggcggcacagctca
                                                                         

P62816_HRK-03          ccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatg
P62817_HRK-01          ccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatg
A0A1U7R468_HRK-01      ccgcgctgaggctgcaggcgctgggcgacgagctgcaccgacgcgccatg
G3UH24_HRK-01          ccgctgctcggctcaaggcgcttggagacgagctgcaccagcgcaccatg
A0A4X1TMB1_HRK-01      ctgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A2K5KZ69_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
G3QTJ6_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
O00198_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
A0A4W2CRW4_HRK-01      cggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A4W2CRW4_HRK-01      cggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A4W2GVZ3_HRK-01      cggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A4W2GVZ3_HRK-01      cggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A2K6GL98_HRK-01      cagccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
H2NIS8_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
A0A096N944_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
H2Q6Y8_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
H0Y001_HRK-01          cagctgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
G1T7W1_HRK-01          ccgccgcccggctcaaggcactcggcgacgagctgcaccagcgcaccatg
G1QHD8_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
A0A2K6AYL7_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
A0A337SQ56_HRK-01      cggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A3Q2IBL3_HRK-01      cggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A0D9SC73_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
A0A2K5PIE7_HRK-01      ccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A452DXE5_HRK-01      cggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
U3E722_HRK-01          ccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A2K5BYA0_HRK-01      ccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
O00198_HRK-03          --------------------------------------------------
F7G1G0_HRK-01          cggccgcccgcctcaaggcgcttggggacgagctgcaggaacggaccatg
A0A4X2K3J4_HRK-01      cggccgcccgcctcaaggcgctcggggacgagctgcaggagcggaccatg
                                                                         

P62816_HRK-03          ---cggcgtcgcgcgcggccccgg-gacccgctgcccgcgctgctgcc--
P62817_HRK-01          ---aggcgtcgcgcgcggccccgg-gacccgctgcccgcgctgctgcc--
A0A1U7R468_HRK-01      ---cggcgccgcgcgcggccccgg-gacccgctgcctgcgctgctgcc--
G3UH24_HRK-01          tggcggcgtcgcgcgaggagccgg-ag---------ggcgccggcgcc--
A0A4X1TMB1_HRK-01      tggcggcgcagcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A2K5KZ69_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
G3QTJ6_HRK-01          tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
O00198_HRK-01          tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A4W2CRW4_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgtc--
A0A4W2CRW4_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgtc--
A0A4W2GVZ3_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A4W2GVZ3_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A2K6GL98_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccagcgcc--
H2NIS8_HRK-01          tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A096N944_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
H2Q6Y8_HRK-01          tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
H0Y001_HRK-01          tggcggcgccgcgcgcggagccgg-ag---------ggcgccagcgcc--
G1T7W1_HRK-01          tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
G1QHD8_HRK-01          tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A2K6AYL7_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A337SQ56_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A3Q2IBL3_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A0D9SC73_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A2K5PIE7_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A452DXE5_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
U3E722_HRK-01          tggcggcgccgcgcgcggagccgg-ag---------ggcgccggcgcc--
A0A2K5BYA0_HRK-01      tggcggcgccgcgcgcggagccgg-ag---------ggcgccagcgcc--
O00198_HRK-03          --------------------------------------------------
F7G1G0_HRK-01          tggaggcgccgggcgcggagtcggcgggccgcagcggaggcggccggcag
A0A4X2K3J4_HRK-01      tggcggcgccgggcgcggagccggcgggcagcagccgaggcggccggca-
                                                                         

P62816_HRK-03          ---------cgcgctccgcgcccgctggccctggctgtgcgcggccgcgc
P62817_HRK-01          ---------cgcgctccgcgcccgctggccctggctgtgcgcggccgcgc
A0A1U7R468_HRK-01      ---------cgcactccgcgcccgctggccctggctgtgcgcggccgcgc
G3UH24_HRK-01          ------cggcgcgctccccacctactggccctggctgtgcgcggcggcgc
A0A4X1TMB1_HRK-01      ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A2K5KZ69_HRK-01      ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
G3QTJ6_HRK-01          ------cggcgcgctccccacctactggccttggctgtgcgcggccgcgc
O00198_HRK-01          ------cggcgcgctccccacctactggccttggctgtgcgcggccgcgc
A0A4W2CRW4_HRK-01      ------cggcgcgctccctacctactggccctggctgtgcgcggccgcgc
A0A4W2CRW4_HRK-01      ------cggcgcgctccctacctactggccctggctgtgcgcggccgcgc
A0A4W2GVZ3_HRK-01      ------cggcgcgctccctacctactggccctggctgtgcgcggccgcgc
A0A4W2GVZ3_HRK-01      ------cggcgcgctccctacctactggccctggctgtgcgcggccgcgc
A0A2K6GL98_HRK-01      ------cggcgcgctcaccacctactggccctggctgtgcgcggccgcgc
H2NIS8_HRK-01          ------cagcgcgctcccaacctactggccctggctgtgcgcggccgcgc
A0A096N944_HRK-01      ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
H2Q6Y8_HRK-01          ------cggcgcgctccccacctactggccttggctgtgcgcggccgcgc
H0Y001_HRK-01          ------cggcgcgctcaccacctactggccctggctgtgcgctgccgcgc
G1T7W1_HRK-01          ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
G1QHD8_HRK-01          ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A2K6AYL7_HRK-01      ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A337SQ56_HRK-01      ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A3Q2IBL3_HRK-01      ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A0D9SC73_HRK-01      ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A2K5PIE7_HRK-01      ------cagcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A452DXE5_HRK-01      ------cggcgcgctccctacctactggccctggctgtgcgcggccgcgc
U3E722_HRK-01          ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A2K5BYA0_HRK-01      ------cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
O00198_HRK-03          ----------------------------------------gcggccgcgc
F7G1G0_HRK-01          cggcggcggcgggctccccgcctactgggcttggctgtgcgcggccgctc
A0A4X2K3J4_HRK-01      --gcggcggcgggctccccgcctgctgggcttggctgtgcgcggccgctc
                                                               ** ** ** *

P62816_HRK-03          aggtggcggcgctggcggcctggctgctcggcaggcggagcgcgtag
P62817_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggagcgcgtag
A0A1U7R468_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggagcgcgtag
G3UH24_HRK-01          aggtggcggcgctggcggcctggctgctccgcaggcggaacttg---
A0A4X1TMB1_HRK-01      aggtggcggcgctggcagcctggctgctcggcaggcggaacttgtag
A0A2K5KZ69_HRK-01      aggtggcggcgctggcggcctggctgctcagcaggcggaacttgtag
G3QTJ6_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
O00198_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A4W2CRW4_HRK-01      aggtggcagcgctggcggcctggctgctcggcaggcggaacttgtag
A0A4W2CRW4_HRK-01      aggtggcagcgctggcggcctggctgctcggcaggcggaacttgtag
A0A4W2GVZ3_HRK-01      aggtggcagcgctggcggcctggctgctcggcaggcggaacttgtag
A0A4W2GVZ3_HRK-01      aggtggcagcgctggcggcctggctgctcggcaggcggaacttgtag
A0A2K6GL98_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
H2NIS8_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A096N944_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
H2Q6Y8_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
H0Y001_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
G1T7W1_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
G1QHD8_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A2K6AYL7_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A337SQ56_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A3Q2IBL3_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A0D9SC73_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A2K5PIE7_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A452DXE5_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
U3E722_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A2K5BYA0_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
O00198_HRK-03          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
F7G1G0_HRK-01          atgtggcggcgctggcggcctggctgctccggaggagaaacttgtag
A0A4X2K3J4_HRK-01      aggtggcggcgctggcggcctggctgctccggaggaggaacttgtag
                       * ***** ******** ************ * *** * * *  *   

© 1998-2020Legal notice