Dataset for CDS BIK of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

42 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1TZR9_BIK-01          --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q925D2_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
F6SUD3_BIK-01          --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      atgagaaagcggcggcgtcacgcagctgctaagcggcagacctgggattc
A0A673V4V4_BIK-01      atga----------------------------------------------
A0A5F5XUY6_BIK-01      atgaacttgggagtggacacaaacacccagagcacagcaaactggggtaa
A0A667G4D3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      tttc----------------------------------------------
A0A3Q7V097_BIK-03      atgacgctcgcctgcagctccatgaggaccataggaccaaa---------
A0A3Q7V097_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-02      --------------------------------------------------
A0A7N5KDU2_BIK-01      atgggcatggaaaaaagcaccgtggcctcaggactccttggagggcgaat
A0A452V3L2_BIK-01      atgg--------------------------------cttgg---------
                                                                         

G1TZR9_BIK-01          --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q925D2_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
F6SUD3_BIK-01          --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      gaactcaggccctctggtttcagagccgcgttcttcatcatcgtattc--
A0A673V4V4_BIK-01      --------------------------------------------------
A0A5F5XUY6_BIK-01      agccaattgcaaaatcagtcgccaagagaattcttgtgttgtgcttcctc
A0A667G4D3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-03      --------------------------------------------------
A0A3Q7V097_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-02      --------------------------------------------------
A0A7N5KDU2_BIK-01      gggacaatcctgtcaagatcctggatcgtatacccaaattcagccattgg
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

G1TZR9_BIK-01          --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q925D2_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
F6SUD3_BIK-01          --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A673V4V4_BIK-01      --------------------------------------------------
A0A5F5XUY6_BIK-01      taggttggagtgtcttgagcaggaaaggacataaaagaaaatctccccac
A0A667G4D3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-03      ----------------------tgtcacactcagcggagtatccccagca
A0A3Q7V097_BIK-01      ---------------------------------atggggcgttggaggag
A0A3Q7V097_BIK-02      --------------------------------------------------
A0A7N5KDU2_BIK-01      attcgtccaccagtactccgtggcgcctactaaatgcaccgccgtgctgg
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

G1TZR9_BIK-01          --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q925D2_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
F6SUD3_BIK-01          --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A673V4V4_BIK-01      --------------------------------------------------
A0A5F5XUY6_BIK-01      ggcctgttttccaaacgcggaattaggggtccagaggggctaaggaactt
A0A667G4D3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-03      ggtggcacagcctgggcccactgggaagaggctggacggagggttgcatg
A0A3Q7V097_BIK-01      ggggatgctgctgacgatgtttctgccaaagcatcactcttggttttcag
A0A3Q7V097_BIK-02      --------------------------------------------------
A0A7N5KDU2_BIK-01      gaaactgcactcgcagacggcggggcgcagacagctcacacattcaccca
A0A452V3L2_BIK-01      --------------------------------agctca------------
                                                                         

G1TZR9_BIK-01          --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q925D2_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
F6SUD3_BIK-01          --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A673V4V4_BIK-01      ---cagagccaaac------------------------------------
A0A5F5XUY6_BIK-01      gtccggagccaaacggccaagctggactaggacccaggt-----------
A0A667G4D3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-03      cctgttacgtaccccaagtttcacaaggcagttggcaggtataaaagctg
A0A3Q7V097_BIK-01      attgtgaaataggccga---------------------------------
A0A3Q7V097_BIK-02      --------------------------------------------------
A0A7N5KDU2_BIK-01      gccgccgagaacccgtggtcggggatccggagcggcggg-------gcgg
A0A452V3L2_BIK-01      ----------------------------gaagaagctag-------gt--
                                                                         

G1TZR9_BIK-01          --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q925D2_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
F6SUD3_BIK-01          --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A673V4V4_BIK-01      --------------------------------------------------
A0A5F5XUY6_BIK-01      --------------------------------------------------
A0A667G4D3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-03      gatttgctgagctgcagagaaaccaagagagcagcattagcccgttcttt
A0A3Q7V097_BIK-01      aatatacctaattccagaga------------------------------
A0A3Q7V097_BIK-02      --------------------------------------------------
A0A7N5KDU2_BIK-01      gagcggcggccccgggggcgggccggggcggggccggcggtttataaact
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

G1TZR9_BIK-01          --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q925D2_BIK-02          ----atggcgtccgcacctgtctccgcgaggacctgggagttcgcatctg
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
F6SUD3_BIK-01          --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A673V4V4_BIK-01      --------------------------------------------------
A0A5F5XUY6_BIK-01      --------------------------------------------------
A0A667G4D3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-03      tcctctcctgatgggctaggatgtggaagggggtgctcggaggatggctc
A0A3Q7V097_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-02      --------------------------------------------------
A0A7N5KDU2_BIK-01      cgcgcgccggccggaggccgcagacaatacggctcccggctcgagcgctc
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

G1TZR9_BIK-01          --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q925D2_BIK-02          tccctcccttggggatcctgggatccgtaccgttcctgccgcgatctgaa
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------atgctgtctttttgccccaaagga
F6SUD3_BIK-01          --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      ----------------tgtacctaaggctgtttggtccagtgtgggagaa
A0A673V4V4_BIK-01      --------------------------------------------agagaa
A0A5F5XUY6_BIK-01      -ggcccagcagccgagtgccccgtggcacagtgtccctgtgcatagagaa
A0A667G4D3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-03      catccgctggttgggtctccacgctgacctc----------------gga
A0A3Q7V097_BIK-01      -------------------------------------------------a
A0A3Q7V097_BIK-02      --------------------------------------------------
A0A7N5KDU2_BIK-01      cggccgccaccatcgccgccaccgccgccgccacctccgacgcgagagaa
A0A452V3L2_BIK-01      ------------------------------------------caagagaa
                                                                         

G1TZR9_BIK-01          ---atgtctgaagtcagacctggctccagg-------gacctcttccag-
Q925D2_BIK-01          ---atgtcagaggcgagactaatggccaga-------gacattatc----
Q925D2_BIK-02          gacatgtcagaggcgagactaatggccaga-------gacattatc----
O70337_BIK-04          ---atgtt------------------------------------------
O70337_BIK-01          ---atgtcggaggcgagacttatggccaga-------gacgtcatc----
O70337_BIK-02          ---atgtcggaggcgagacttatggccaga-------gacgtcatc----
O70337_BIK-03          ---atgtcggaggcgagacttatggccaga-------gacgtcatc----
W5QCU2_BIK-01          ---atgtatcaagcaagacccctctctagg-------aacctctttttg-
H0W025_BIK-01          ---atgtcggaagcaaaacctgtcgccagg-------gacccactgatg-
G1S1X2_BIK-01          ---atgtccgaagtaagacccatctccaga-------gacatcttgatg-
A0A2K6MCW0_BIK-01      ---atgtctggagtaagacccgtctccaga-------gacatcttgatg-
A0A2K6QK74_BIK-01      ---atgtctggagtaagacccgtctccaga-------gacatcttgatg-
A0A2K5J4Q7_BIK-01      ---atgtctggagtaagacccatctccaga-------gacatcttgatg-
A0A0D9QZY8_BIK-01      ---atgtctggagtaagacccatctccaga-------cacatcttgatg-
A0A2K5LDM6_BIK-01      ---atgtctggagtaagacccatctccaga-------gacacctggatg-
A0A096NKG5_BIK-01      ---atgtctggagttagacccatctccaga-------gacatcttgatg-
A0A2K5XSA1_BIK-01      ---atgtctggagtaagacccatctccaga-------gacaccttgatg-
A0A2K6DBJ4_BIK-01      ---atgtctggagtaagacccatctccaga-------gacaccttgatg-
A0A2K5VW94_BIK-01      gaaatgtctggagtaagacccatctccaga-------gacaccttgatg-
F6SUD3_BIK-01          ---atgtctggagtaagacccatctccaga-------gacaccttgatg-
H2P4N6_BIK-01          ---atgtctgaagtaagacctatctccaga-------gacatcctgatg-
G3QCT2_BIK-01          ---atgtctgaagtaagacccctctccaga-------gacatcttgatg-
Q13323_BIK-01          ---atgtctgaagtaagacccctctccaga-------gacatcttgatg-
A0A2R8ZXD2_BIK-01      ---atgtctgaagtaagacccctctccaga-------gacatcttgatg-
H2QLU7_BIK-01          ---atgtctgaagtaagacccctctccaga-------gacatcttgatg-
A0A2K6TBD7_BIK-01      ---atgtctgaagacagacccctctccagc-------gacatcttgatg-
A0A2K5CLG5_BIK-01      ---atgtctgaagttagacccctctccagt-------gacatcttgatg-
A0A2K5QXZ1_BIK-01      ---atgtctgaagaaagacccctctccatt-------gacatcttgatg-
H0XAE7_BIK-01          ---atgtcagcaggaaggccagtctccatg-------gaccactttatg-
A0A2K6FM79_BIK-01      ---atgtctgaggtgagacccgtctccacg-------gacctcctcatg-
I3LVX0_BIK-01          ---atggttca-----gggcagtcaccagg--------------------
A0A3Q2LHE3_BIK-01      ---atgtctcaagtaggacccgtctccagg-------gacctctttctg-
A0A3Q2LHE3_BIK-02      gaaatgtctcaagtaggacccgtctccagg-------gacctctttctg-
A0A673V4V4_BIK-01      gaaatgtctcacgcaggacccctctccagg-------gatgtctttttg-
A0A5F5XUY6_BIK-01      gaaatgtctcacgcaggacccctctccagg-------aacgtctttttg-
A0A667G4D3_BIK-01      ---atgtctcacgcaggacccctctccagg-------aacgtctttttg-
A0A452QUG1_BIK-01      ---acaccacccgcaggtgcgctcagcgggtggtagcaccctccctccac
A0A3Q7V097_BIK-03      gaaatgtctcactcaggacccctctccagg-------aacctctttctg-
A0A3Q7V097_BIK-01      gaaatgtctcactcaggacccctctccagg-------aacctctttctg-
A0A3Q7V097_BIK-02      ---atgtctcactcaggacccctctccagg-------aacctctttctg-
A0A7N5KDU2_BIK-01      gaaatgtcccacacaggacccctctccagg-------aacctctttttg-
A0A452V3L2_BIK-01      gaaatgtcccacacaggacccctctccagg-------aacctctttttg-
                          *                                              

G1TZR9_BIK-01          -gaagccctcctggatgagca---------ggtcccagaacctctgttga
Q925D2_BIK-01          -aagactcttctacacgacca---------ggtcccccaacctgcagtgg
Q925D2_BIK-02          -aagactcttctacacgacca---------ggtcccccaacctgcagtgg
O70337_BIK-04          -------------cac----------------------------------
O70337_BIK-01          -aagactgttccacacgacca---------ggtcccccaacctccagtgg
O70337_BIK-02          -aagactgttccacacgacca---------ggtcccccaacctccagtgg
O70337_BIK-03          -aagactgttccacacgacca---------ggtcccccaacctccagtgg
W5QCU2_BIK-01          -tacaccttcctacaaaaccacggcccaggcttcctggatgacc---aag
H0W025_BIK-01          -gagaccccgctgtttgagcc---------accccctgggcctc---tgc
G1S1X2_BIK-01          -gagagcctcctgtatgagca---------gctcctggaacccc---cga
A0A2K6MCW0_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---taa
A0A2K6QK74_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---taa
A0A2K5J4Q7_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---taa
A0A0D9QZY8_BIK-01      -gagagcctcctgtatgagca---------gctcctggaacccc---tga
A0A2K5LDM6_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---taa
A0A096NKG5_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---taa
A0A2K5XSA1_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---taa
A0A2K6DBJ4_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---taa
A0A2K5VW94_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---taa
F6SUD3_BIK-01          -gagaccctcctgtatgagca---------gctcctggaacccc---taa
H2P4N6_BIK-01          -gagaccctcctgtatgagca---------gctcctggaacccc---cga
G3QCT2_BIK-01          -gagaccctcctgtatgagca---------gctcctggaacccc---cga
Q13323_BIK-01          -gagaccctcctgtatgagca---------gctcctggaacccc---cga
A0A2R8ZXD2_BIK-01      -gagaccctcctgtatgagca---------gctcctggaacccc---cga
H2QLU7_BIK-01          -gagaccctcctgtatgagca---------gctcctggaacccc---cga
A0A2K6TBD7_BIK-01      -gagactctcctgtgtgagca---------gtttgtggatcccc---tga
A0A2K5CLG5_BIK-01      -gagaccctcttgtgtgagca---------gttcgtgcatcccc---tga
A0A2K5QXZ1_BIK-01      -gagaccctcctgtgtgagca---------gttcatggatcccc---tga
H0XAE7_BIK-01          -gagaccttcccatttgagca---------gctcctggagcctc---tga
A0A2K6FM79_BIK-01      -gagaccttcccgttcgagca---------tctcctggaccctc---tga
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      -gacgccttcctgcacgagcg---------cagcccggaagccc------
A0A3Q2LHE3_BIK-02      -gacgccttcctgcacgagcg---------cagcccggaagccc------
A0A673V4V4_BIK-01      -agcaccttcctgcaggagca---------tggcccggaagttc------
A0A5F5XUY6_BIK-01      -agcaccttcctgcaggagca---------tggcccggaagttc------
A0A667G4D3_BIK-01      -agcaccttcctgcaggagca---------tggcccggaagttc------
A0A452QUG1_BIK-01      caccagcaccccgcaggggaa---------ggtgct----gtcc------
A0A3Q7V097_BIK-03      -agcaccttcctacaggagca---------tggcccggaagttc------
A0A3Q7V097_BIK-01      -agcaccttcctacaggagca---------tggcccggaagttc------
A0A3Q7V097_BIK-02      -agcaccttcctacaggagca---------tggcccggaagttc------
A0A7N5KDU2_BIK-01      -agcaccttcctgcaggagca---------tggcccggaagttc------
A0A452V3L2_BIK-01      -agcaccttcctgcaggagca---------tggcccggaagttc------
                                                                         

G1TZR9_BIK-01          cggcggaagttccc---ggcctgacccgtcccgtggaggaaggggacttg
Q925D2_BIK-01          tctctggggctccc---agcatgaaggagcctgtgggggttgaggacgtc
Q925D2_BIK-02          tctctggggctccc---agcatgaaggagcctgtgggggttgaggacgtc
O70337_BIK-04          --------------------------------------------------
O70337_BIK-01          cctctgagactccc---agcatgaaggag---------------------
O70337_BIK-02          cctctgagactccc---agcatgaaggag---------------------
O70337_BIK-03          cctctgagactccc---agcatgaaggag---------------------
W5QCU2_BIK-01          gctcagggcttccc---ggcgtgaccagtatc------ttggagttcc--
H0W025_BIK-01          tggctgaaggggctttgggtgtgacgcagccactgtgggcagaggacctc
G1S1X2_BIK-01          ccatggaggttctt---ggcgtgactgaccct------gaagaggacctg
A0A2K6MCW0_BIK-01      ccatggaggttctt---ggtgtgactgaccct------gaagaggacctg
A0A2K6QK74_BIK-01      ccatggaggttctt---ggtgtgactgaccct------gaagaggacctg
A0A2K5J4Q7_BIK-01      ccatggaggttctt---ggtgtgactgaccct------gaagaggacctg
A0A0D9QZY8_BIK-01      ccatggaggttctt---ggtgtgactgaccct------gaagaggacctg
A0A2K5LDM6_BIK-01      ccatggaggttctt---ggtgtgactgaccct------gaagaggacctg
A0A096NKG5_BIK-01      ccatggaggttctt---ggtgtgactgaccct------gaagaggacctg
A0A2K5XSA1_BIK-01      ccatggaggttctt---ggtgtgactgaccct------gaagaggacctg
A0A2K6DBJ4_BIK-01      ccatggaggttctt---ggtgtcactgaccct------gaagaggacctg
A0A2K5VW94_BIK-01      ccatggaggttctt---ggtgtcactgaccct------gaagaggacctg
F6SUD3_BIK-01          ccatggaggttctt---ggtgtcactgaccct------gaagaggacctg
H2P4N6_BIK-01          ccatggaggttctt---ggcgtgactgactct------gaagaggacctg
G3QCT2_BIK-01          ccatggaggttctt---ggcgtgactgactct------gaagaggacctg
Q13323_BIK-01          ccatggaggttctt---ggcatgactgactct------gaagaggacctg
A0A2R8ZXD2_BIK-01      ccatggaggttctt---ggcgtgactgagtct------gaggaggacctg
H2QLU7_BIK-01          ccatggaggttctt---ggcgtgactgactct------gaagaggacctg
A0A2K6TBD7_BIK-01      ccatggaggttgtc---ggtgggagtgaccct------gaagaggacccg
A0A2K5CLG5_BIK-01      ccatggaggttgtc---ggtgggagtgaccct------gaagaggacctg
A0A2K5QXZ1_BIK-01      ccatggaggttgtcggtggtgggagtgaccct------gaagaggacctg
H0XAE7_BIK-01          caatggaggttctt---ggcatgactg------------------agccc
A0A2K6FM79_BIK-01      tcctggaggttctc---agcatcatggacaac------gaggagaatccc
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      ---tggaggttcct---ggcatgaccgagctc------acagagt-----
A0A3Q2LHE3_BIK-02      ---tggaggttcct---ggcatgaccgagctc------acagagt-----
A0A673V4V4_BIK-01      ---tggacgttccc---ggcgtgactgatctc------gtggagtactat
A0A5F5XUY6_BIK-01      ---tggacgttcct---ggcatgaccgatctc------gtggagtactat
A0A667G4D3_BIK-01      ---tggacgttcct---ggcatgaccgatctc------gtggagtactat
A0A452QUG1_BIK-01      ---tgacaggtgcg---gg--tggcatatgtc------a-----------
A0A3Q7V097_BIK-03      ---tggaggttccg---ggcatgacagatctc------atggagtattat
A0A3Q7V097_BIK-01      ---tggaggttccg---ggcatgacagatctc------atggagtattat
A0A3Q7V097_BIK-02      ---tggaggttccg---ggcatgacagatctc------atggagtattat
A0A7N5KDU2_BIK-01      ---tggaggttccg---ggcatgactgatctc------gtggaatactat
A0A452V3L2_BIK-01      ---tggaggttccg---ggcatgactgatctc------gtggagtactat
                                                                         

G1TZR9_BIK-01          gat------------------ctcatggagtgcctcgagggcagtaacca
Q925D2_BIK-01          agtcctgtgagagacttggatttcatgaggtgcctggagagcagaaacca
Q925D2_BIK-02          agtcctgtgagagacttggatttcatgaggtgcctggagagcagaaacca
O70337_BIK-04          -----------------------------------------cagaaacca
O70337_BIK-01          ---cctgtgagagacgtggacctcatggagtgcgtggaaggcagaaacca
O70337_BIK-02          ---cctgtgagagacgtggacctcatggagtgcgtggaaggcagaaacca
O70337_BIK-03          ---cctgtgagagacgtggacctcatggagtgcgtggaaggcagaaacca
W5QCU2_BIK-01          -acccc---------------atctccccctacagtgacagtccacacta
H0W025_BIK-01          agtccccctggggacactaacctcatggaatgcgtggaaggcagcagcct
G1S1X2_BIK-01          gaccctatggaggacttcgatcctttgcagtgcatggagggcagtgacgc
A0A2K6MCW0_BIK-01      gaccctatggaggacttcgatcctttggagtgtatggaggacagtgacat
A0A2K6QK74_BIK-01      gaccctatggaggacttcgatcctttggagtgtatggaggacagtgacat
A0A2K5J4Q7_BIK-01      gaccctatggaggacttcgatcctttggagtgtatggaggacagtgacat
A0A0D9QZY8_BIK-01      gaccctatggaggacttcgatcctttggagtgtatggaggacagtgacat
A0A2K5LDM6_BIK-01      gaccctatggaggacttcgatcctttggagtgtatggaggacagtgacat
A0A096NKG5_BIK-01      gaccctatggaggacttcgatcctttggagtgtatggaggacagtgacat
A0A2K5XSA1_BIK-01      gaccctatggaggacttcgatcctttggagtgtatggaggacagtgacat
A0A2K6DBJ4_BIK-01      gaccctatggaggacttcgatcctttggagtgtatagaggacagtgacat
A0A2K5VW94_BIK-01      gaccctatggaggacttcgatcctttggagtgtatggaggacagtgacat
F6SUD3_BIK-01          gaccctatggaggacttcaatcctttggagtgtatggaggacagtgacat
H2P4N6_BIK-01          gaccctatggaggacttcagtcctttggagtgcatggagggcagtgacgc
G3QCT2_BIK-01          gaccctatggaggacttcgattctttggagtgcatggagggcagtgacgc
Q13323_BIK-01          gaccctatggaggacttcgattctttggaatgcatggagggcagtgacgc
A0A2R8ZXD2_BIK-01      gaccctatggaggacttcgattctttggagtgcatggagggcagtgacgc
H2QLU7_BIK-01          gaccctatggaggacttcgattctttggagtgcatggagggcagtgacgc
A0A2K6TBD7_BIK-01      gactctgtggaggac------cctttggaatgcatggagaacagtgacgc
A0A2K5CLG5_BIK-01      gaccctgtggaggac------cctttggaatgcatggagaacagtgacgc
A0A2K5QXZ1_BIK-01      gaccctgtggaggac------ccgttggaatgcatggagaacagtgacgc
H0XAE7_BIK-01          aac------------------cccatggagtgcctggaggacagtgacca
A0A2K6FM79_BIK-01      gac------------------ccctcggggtgcctcgaggacagtgacga
I3LVX0_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-01      ----------------------cctcccccgacagtgacaaccgtgactc
A0A3Q2LHE3_BIK-02      ----------------------cctcccccgacagtgacaaccgtgactc
A0A673V4V4_BIK-01      gatcccggg------------ccctcccctaacagcaacagccccgatga
A0A5F5XUY6_BIK-01      gatcccggg------------ccctcccctaacagcaacagccccgacga
A0A667G4D3_BIK-01      gatcctggg------------ccctcccctaacagcaacagccccgacga
A0A452QUG1_BIK-01      ggccacggg------------ccctttgt-----gcaacaaccccgacga
A0A3Q7V097_BIK-03      gaccctggg------------ccctcccctaacagcaacaacccggacga
A0A3Q7V097_BIK-01      gaccctggg------------ccctcccctaacagcaacaacccggacga
A0A3Q7V097_BIK-02      gaccctggg------------ccctcccctaacagcaacaacccggacga
A0A7N5KDU2_BIK-01      gatccaggg------------ccctcccctaacagcaacaaccccgacga
A0A452V3L2_BIK-01      gatccgggg------------ccctcccctaacagcaacaaccccgacga
                                                                         

G1TZR9_BIK-01          ggtggccctgaggctggcgtacatcggcgacgagatggacctgcaccccc
Q925D2_BIK-01          ggtggccctgaggctagcctgcatcggcgatgagatggaccggtgtcttc
Q925D2_BIK-02          ggtggccctgaggctagcctgcatcggcgatgagatggaccggtgtcttc
O70337_BIK-04          ggtggccttgaggctggcctgcatcggcgatgagatggacctgtgtctgc
O70337_BIK-01          ggtggccttgaggctggcctgcatcggcgatgagatggacctgtgtctgc
O70337_BIK-02          ggtggccttgaggctggcctgcatcggcgatgagatggacctgtgtctgc
O70337_BIK-03          ggtggccttgaggctggcctgcatcggcgatgagatggacctgtgtctgc
W5QCU2_BIK-01          cctggccatgcagctggcctccattgccgacgagatggagctgaggttgc
H0W025_BIK-01          ggtggccctgcggctggcctgcatcggtgacgagatggacctgcgcctac
G1S1X2_BIK-01          gctggccccgcggctggcctgcatcggggacgagatggacgtgagcctca
A0A2K6MCW0_BIK-01      gttggccctgcggctggcctgcatcggggatgagatggacgtgagcctca
A0A2K6QK74_BIK-01      gttggccctgcggctggcctgcatcggggatgagatggacgtgagcctca
A0A2K5J4Q7_BIK-01      gttggccctgcggctggcctgcatcggggatgagatggacgtgagcctca
A0A0D9QZY8_BIK-01      gttggccctgcggctggcctgcatcggggacgagatggacgtgagcctca
A0A2K5LDM6_BIK-01      gttggccctgcggctggcctgcatcggggacgagatggatgtgagcctca
A0A096NKG5_BIK-01      gttggccctgcggctggcctgcatcggggacgagatggatgtgagcctca
A0A2K5XSA1_BIK-01      gttggccctgcggctggcctgcatcggggacgagatggatgtgagcctca
A0A2K6DBJ4_BIK-01      gttggccctgcggctggcctgcatcggggacgagatggatgtgagcctca
A0A2K5VW94_BIK-01      gttggccctgcggctggcctgcatcggggacgagatggatgtgagcctca
F6SUD3_BIK-01          gttggccctgcggctggcctgcatcggggacgagatggatgtgagcctca
H2P4N6_BIK-01          gttggccttgcggctggcctgcatcggggacgagatggacgtgagcctca
G3QCT2_BIK-01          gttggccctgcggctggcctgcatcggggatgagatggacgtgagcctca
Q13323_BIK-01          attggccctgcggctggcctgcatcggggacgagatggacgtgagcctca
A0A2R8ZXD2_BIK-01      gttggccctgcggctggcctgcatcggggacgagatggacgtgagcctca
H2QLU7_BIK-01          gttggccctgcggctggcctgcatcggggacgagatggacgtgagcctca
A0A2K6TBD7_BIK-01      actggccctgcagctggcctgcatcgcggaccagatggatgtgagcctca
A0A2K5CLG5_BIK-01      actggtcctgcagctggcctgcatcgcggaccagatggatgtgagcctta
A0A2K5QXZ1_BIK-01      actggccctgcagctggcctgcatcgcggaccagatggatgtgagcctta
H0XAE7_BIK-01          ggtggccctgcggctagcctgcattggggacgagatggacctgcatctca
A0A2K6FM79_BIK-01      ggtggccctgcggctagcctgcattggggatgagatggacctgtgtctca
I3LVX0_BIK-01          --tggccctgcgactggcctgcattggggatgagatggatctgtgttttc
A0A3Q2LHE3_BIK-01      tgtggccatgcggctggccttcatcggggacgagatggaagtgagatgga
A0A3Q2LHE3_BIK-02      tgtggccatgcggctggccttcatcggggacgagatggaagtgagatgga
A0A673V4V4_BIK-01      cgtggccatgcggctggccttcatcggggacgagatggaagtgaggtgga
A0A5F5XUY6_BIK-01      tgtggccatgcggctggccttcatcggggacgagatggaggtgaggtgga
A0A667G4D3_BIK-01      tgtggccatgcggctggccttcatcggggacgagatggaggggcggtgga
A0A452QUG1_BIK-01      tgtggccatgcggctggccttcatcggggacgagatggaagtgagatgga
A0A3Q7V097_BIK-03      tgtggccatgcggctggccttcatcggggacgagatggaagtgagatgga
A0A3Q7V097_BIK-01      tgtggccatgcggctggccttcatcggggacgagatggaagtgagatgga
A0A3Q7V097_BIK-02      tgtggccatgcggctggccttcatcggggacgagatggaagtgagatgga
A0A7N5KDU2_BIK-01      tgtggccatgcggctggccttcatcggggacgagatggaagtgagatgga
A0A452V3L2_BIK-01      tgtggccatgcggctggccttcatcggggacgagatggaagtgagatgga
                         *** *  *   ** ** * *** *  **  *******   *       

G1TZR9_BIK-01          gacggtacacctctgcccggctgcttgttccgtct---tacagcttgg--
Q925D2_BIK-01          ggagcccccgtctggtccagctgcctgggattgctatgcacagacttg--
Q925D2_BIK-02          ggagcccccgtctggtccagctgcctgggattgctatgcacagacttg--
O70337_BIK-04          ggagcccccgtctggtccagctgcctgggattgctatacacagactcg--
O70337_BIK-01          ggagcccccgtctggtccagctgcctgggattgctatacacagactcg--
O70337_BIK-02          ggagcccccgtctggtccagctgcctgggattgctatacacagactcg--
O70337_BIK-03          ggagcccccgtctggtccagctgcctgggattgctatacacagactcg--
W5QCU2_BIK-01          tgctgccccagttcgttgagcccttctggatgcccatgtacagcttgt--
H0W025_BIK-01          ggagcccccgcctggcccagctgccagggagggcagtgcacagcctgg--
G1S1X2_BIK-01          gggccccgcgcctggcccagctctccgaggtggccatgcacagcctgggt
A0A2K6MCW0_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctaggt
A0A2K6QK74_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctaggt
A0A2K5J4Q7_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggt
A0A0D9QZY8_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggt
A0A2K5LDM6_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggt
A0A096NKG5_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggt
A0A2K5XSA1_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggt
A0A2K6DBJ4_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggt
A0A2K5VW94_BIK-01      gggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggt
F6SUD3_BIK-01          gggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggt
H2P4N6_BIK-01          gggccccgcgccgggcccagctccccgaggtggccatgcacagcctgggt
G3QCT2_BIK-01          gggccccgcgcctggcccagctctccgaggtggccatgcacagcctgggt
Q13323_BIK-01          gggccccgcgcctggcccagctctccgaggtggccatgcacagcctgggt
A0A2R8ZXD2_BIK-01      gggccccgcgcctggcccagctctccgacgtggccatgcacagcctgggt
H2QLU7_BIK-01          gggccccacgcctggcccagctctccgacgtggccatgcacagcctgggt
A0A2K6TBD7_BIK-01      gggcccggaggctggcccagctctacgaggtggccacgtacagcccgggt
A0A2K5CLG5_BIK-01      gggcccggaggctggcccagctctatgaggtggccatgtacagcccgggt
A0A2K5QXZ1_BIK-01      gggcccggaagctggcccagctctacgaggtggccatgtacagcccgggt
H0XAE7_BIK-01          ggagcccccgactagcccagctgtccaggatgaccatgcacagcctggg-
A0A2K6FM79_BIK-01      ggagcccccgcctggcctggctgcccgggatgaccatgcacagcctgggg
I3LVX0_BIK-01          aggacctccaactggcccagctgcctgggatggccatgcacagccttg--
A0A3Q2LHE3_BIK-01      tgctgccccacatcgctgagctgcctggggtggccgtgtacagcttgg--
A0A3Q2LHE3_BIK-02      tgctgccccacatcgctgagctgcctggggtggccgtgtacagcttgg--
A0A673V4V4_BIK-01      tggtgccccgcgttggcgagctgcctgggatggccttgtacagcttgg--
A0A5F5XUY6_BIK-01      tgatgccccgcgttggcgagctgcccgggatggccgtgtacagcttgg--
A0A667G4D3_BIK-01      tgatgccccgcgttggcgagctgcccgggatggccgtgtacagcttgg--
A0A452QUG1_BIK-01      tgcttccccgcgttggcgagctccccgggatggccatgtacagcttgg--
A0A3Q7V097_BIK-03      tgcttccccgtgttggcgagctgcccgggatggccatgtacagcttgg--
A0A3Q7V097_BIK-01      tgcttccccgtgttggcgagctgcccgggatggccatgtacagcttgg--
A0A3Q7V097_BIK-02      tgcttccccgtgttggcgagctgcccgggatggccatgtacagcttgg--
A0A7N5KDU2_BIK-01      tgcttccccgcgttggcgagctgcccgggatggccatgtacagcttgg--
A0A452V3L2_BIK-01      tgcttccccgcgttggcgagctgcccgggatggccatgtacagcttgg--
                                     *    **            *     ****       

G1TZR9_BIK-01          ----ccttcacctacagccagac---gggcttcacgggtgttctcggaag
Q925D2_BIK-01          ----ctgccacctacagccagac---gggtgtcagaggtattttcagaag
Q925D2_BIK-02          ----ctgccacctacagccagac---gggtgtcagaggtattttcagaag
O70337_BIK-04          ----ctgtcacctacagccggac---aggtgtcagaggtattttcaggag
O70337_BIK-01          ----ctgtcacctacagccggac---aggtgtcagaggtattttcaggag
O70337_BIK-02          ----ctgtcacctacagccggac---aggtgtcagaggtattttcaggag
O70337_BIK-03          ----ctgtcacctacagccggac---aggtgtcagaggtattttcaggag
W5QCU2_BIK-01          ----gtttcccctacagccacgt---agggctcagggatgttctgagaag
H0W025_BIK-01          ----ccatcacttacagccagat---ggggctctggggtgtgctcggaag
G1S1X2_BIK-01          ctggctttcatctatgaccagactgaggacatcagggatgttcttagaag
A0A2K6MCW0_BIK-01      ctggctttcatctacgaccagaccgacgacatcagggatgttcttacaag
A0A2K6QK74_BIK-01      ctggctttcatctacgaccagaccgacgacatcagggatgttcttacaag
A0A2K5J4Q7_BIK-01      ctggctttcatctacgaccagaccgacgacatcagggatgttcttagaag
A0A0D9QZY8_BIK-01      ctggctttcatctacgaccagacggacgacatcagggatgttcttagaag
A0A2K5LDM6_BIK-01      ctggctttcatctgcgaccagacggacgacatcagggatgttcttagaag
A0A096NKG5_BIK-01      ctggctttcatctacgaccagacggacgacatcagggatgttcttagaag
A0A2K5XSA1_BIK-01      ctggctttcatctacgaccagacggacgacatcagggatgttcttagaag
A0A2K6DBJ4_BIK-01      ctggctttcatctacgaccagatggacgacatcagggatgttcttagaag
A0A2K5VW94_BIK-01      ctggctttcatctacgaccagatggacgacatcagggatgttcttagaag
F6SUD3_BIK-01          ctggctttcatctacgaccagatggacgacatcagggatgttcttagaag
H2P4N6_BIK-01          ctggctttcatctacgaccagactgaggacatcagggatgttcttagaag
G3QCT2_BIK-01          ctggctttcatctacgaccagaccgaggacatcagggatgttcttagaag
Q13323_BIK-01          ctggctttcatctacgaccagactgaggacatcagggatgttcttagaag
A0A2R8ZXD2_BIK-01      ctggctttcatctacgaccagactgaggacatcagggatgttcttagaag
H2QLU7_BIK-01          ctggctttcatctacgaccagactgaggacatcagggatgttcttagaag
A0A2K6TBD7_BIK-01      ctcgctttcatccttgaccggac---cgacatcagggatgttcttagcgg
A0A2K5CLG5_BIK-01      ctcgctttcatcctcgaccggac---cgacatcggggatgttcttagcgg
A0A2K5QXZ1_BIK-01      ctcgctgtcacccttgaccagac---cgacatcagggatgttctcggcgg
H0XAE7_BIK-01          -----tctatcctacaaccagac---tgatggccagggtgtcctcagaag
A0A2K6FM79_BIK-01      ctggcgctgtcctgtgaccagcc---ggtccgctggggcgtgctcgggag
I3LVX0_BIK-01          ----ctctcagctacagccaggc---gagagtcacgggtgtgctcagaag
A0A3Q2LHE3_BIK-01      ----ccttcacctacaaccagac---aggcctgaggggtgtttttagaag
A0A3Q2LHE3_BIK-02      ----ccttcacctacaaccagac---aggcctgaggggtgtttttagaag
A0A673V4V4_BIK-01      ----cctttacctacaaccagac---gggcctgaggggtgttctcaggag
A0A5F5XUY6_BIK-01      ----ccttcacctacaaccagac---gggcctgagaggtgttctcagaag
A0A667G4D3_BIK-01      ----ccttcacctacaaccagac---gggcctgagaggtgttctcagaag
A0A452QUG1_BIK-01      ----cttttacctacaaccagac---aggcctgagaggtgttcttcgaag
A0A3Q7V097_BIK-03      ----cttttacctacaaccagac---aggcctgagaggtgttcttagaag
A0A3Q7V097_BIK-01      ----cttttacctacaaccagac---aggcctgagaggtgttcttagaag
A0A3Q7V097_BIK-02      ----cttttacctacaaccagac---aggcctgagaggtgttcttagaag
A0A7N5KDU2_BIK-01      ----cttttacctacaaccagac---aggcctgagaggtgttcttcgaag
A0A452V3L2_BIK-01      ----cttttacctacaaccagac---aggcctgagaggtgttcttcgaag
                                        **                 *   *  *     *

G1TZR9_BIK-01          cgtggggctccaccttgccagcctcgtaga------------gctctgga
Q925D2_BIK-01          cttgattggaagcctcaccaacctcagggaaaatatc---tggtcctgga
Q925D2_BIK-02          cttgattggaagcctcaccaacctcagggaaaatatc---tggtcctgga
O70337_BIK-04          cttgattcgaagcctcaccaacctcagggaaaacatc---tggtcctgga
O70337_BIK-01          cttgattcgaagcctcaccaacctcagggaaaacatc---tggtcctgga
O70337_BIK-02          cttgattcgaagcctcaccaacctcagggaaaacatc---tggtcctgga
O70337_BIK-03          cttgattcgaagcctcaccaacctcagggaaaacatc---tggtcctgga
W5QCU2_BIK-01          ctttatggttgctttcaccaacctcagggagaaccga---aggctctgga
H0W025_BIK-01          gctgaccctcagtctcgccagcctcagggacaatgtg---tgggcctgtg
G1S1X2_BIK-01          tttcatggacggtttcaccacctttaaggagaacataataaggctctgga
A0A2K6MCW0_BIK-01      tttcatggacggcttcaccacccttaaggagaacataatgaggttctgga
A0A2K6QK74_BIK-01      tttcatggacggcttcaccacccttaaggagaacataatgaggttctgga
A0A2K5J4Q7_BIK-01      tttcatggacggcttcaccacccttaaggagaacataatgaggttctgga
A0A0D9QZY8_BIK-01      tttcatagatggtttcaccacccttagggagaacataatgaggttctgga
A0A2K5LDM6_BIK-01      tttcatggatggtttcaccacccttagggagaacataatgaggttctgga
A0A096NKG5_BIK-01      tttcatggatggtttcaccacccttagggagaacataatgaggttctgga
A0A2K5XSA1_BIK-01      tttcctggatggtttcaccacccttagggagaacataatgaggttctgga
A0A2K6DBJ4_BIK-01      tttcatggatggtttcaccacccttagggagaacataatgaggttctgga
A0A2K5VW94_BIK-01      tttcatggatggtttcaccacccttagggagaacataatgaggttctgga
F6SUD3_BIK-01          tttcatggatggtttcaccacccttagggagaacataatgaggttctgga
H2P4N6_BIK-01          tttcacggacggtttcaccacccttaaggaaaacataatgaggttctgga
G3QCT2_BIK-01          tttcatggacggtttcaccacccttaaggagaacataatgaggttctgga
Q13323_BIK-01          tttcatggacggtttcaccacacttaaggagaacataatgaggttctgga
A0A2R8ZXD2_BIK-01      tttcatggacggtttcaccacacttaaggagaacataatgaggttctgga
H2QLU7_BIK-01          tttcatggacggtttcaccacacttaaggagaacataatgaggttctgga
A0A2K6TBD7_BIK-01      tgtcgtggatgttttcgctgacttccaggaggacatagtgaggctctgga
A0A2K5CLG5_BIK-01      tatcgtggaagttttcgctaacttccaggaggacatagtgaggctctgga
A0A2K5QXZ1_BIK-01      tattgtggacattttcgctaacttccaggaggacgtagtgaggctctgga
H0XAE7_BIK-01          tgttatcagcggtttcaccaacctcagggagaatatagcagggttctgga
A0A2K6FM79_BIK-01      ccttagcgacggtttcgccaacctcagggagtacgtggccaggctctgga
I3LVX0_BIK-01          cttggcccagggtctcgccagcctcagggagaacatg---tggttctgga
A0A3Q2LHE3_BIK-01      tttcatggatggtctcactaacctcagggagaacata---aggttctgga
A0A3Q2LHE3_BIK-02      tttcatggatggtctcactaacctcagggagaacata---aggttctgga
A0A673V4V4_BIK-01      tctcatggacgggctcgccagcctcagggagaacatc---cgcgtgtgga
A0A5F5XUY6_BIK-01      tctcatggatggtctggccaacctcagggagaacata---tggatctggg
A0A667G4D3_BIK-01      tctcatggatggtctggccaacctcagggagaacata---cggatctggg
A0A452QUG1_BIK-01      tctcatggacggactcactaacctcagggagaacata---aggatttgga
A0A3Q7V097_BIK-03      tttcctggatggtcttgctaacctcagggagaacatc---cgcatctgga
A0A3Q7V097_BIK-01      tttcctggatggtcttgctaacctcagggagaacatc---cgcatctgga
A0A3Q7V097_BIK-02      tttcctggatggtcttgctaacctcagggagaacatc---cgcatctgga
A0A7N5KDU2_BIK-01      tctcgtggacggactcactaacctcagggagaatgta---aggatctgga
A0A452V3L2_BIK-01      tctcatggacggactcactaacctcagggagaacata---aggatctgga
                         *           *  *     *    **                **  

G1TZR9_BIK-01          gcccctggg---taagagcttggg----------------------gggc
Q925D2_BIK-01          gagtcttcactcctggcgcctggg----------------------tgtc
Q925D2_BIK-02          gagtcttcactcctggcgcctggg----------------------tgtc
O70337_BIK-04          gagtcttgactcctggcgcctggg----------------------tgtc
O70337_BIK-01          gagtcttgactcctggcgcctggg----------------------tgtc
O70337_BIK-02          gagtcttgactcctggcgcctggg----------------------tgtc
O70337_BIK-03          gagtcttgactcctggcgcctggg----------------------tgtc
W5QCU2_BIK-01          gcttcctgactctcagggaccggg----------------------tgtc
H0W025_BIK-01          gacgcccagcctcccgtgcctggg----------------------tgtc
G1S1X2_BIK-01          gatccccgaaccccgggtcccggg----------------------tgtc
A0A2K6MCW0_BIK-01      gatccctgaatcccgggtcccagg----------------------tgtc
A0A2K6QK74_BIK-01      gatccctgaatcccgggtcccagg----------------------tgtc
A0A2K5J4Q7_BIK-01      gatccccgaatcccgggtcccggg----------------------tgtc
A0A0D9QZY8_BIK-01      gatccctgaatcccgggtcctggg----------------------tgtc
A0A2K5LDM6_BIK-01      gatccccgaatcccaggtcctggg----------------------tgtc
A0A096NKG5_BIK-01      gatccccgaatcccaggtcctggg----------------------tgtc
A0A2K5XSA1_BIK-01      gatccccgaatcccaggtcctggg----------------------tgtc
A0A2K6DBJ4_BIK-01      gatccccgaatcccaggtcctggg----------------------tgtc
A0A2K5VW94_BIK-01      gatccccgaatcccaggtcctggg----------------------tgtc
F6SUD3_BIK-01          gatccccgaatcccaggtcctggg----------------------tgtc
H2P4N6_BIK-01          gctccctgaaccccgggtcctggg----------------------tgtc
G3QCT2_BIK-01          gatccccgaaccccgggtcctggg----------------------tgtc
Q13323_BIK-01          gatccccgaaccccgggtcctggg----------------------tgtc
A0A2R8ZXD2_BIK-01      gatccccgaaccccaggtcctggg----------------------tgtc
H2QLU7_BIK-01          gatccccgaaccccgggtcctggg----------------------tgtc
A0A2K6TBD7_BIK-01      gatccctgagctctgggtcctggg----------------------tgtc
A0A2K5CLG5_BIK-01      gatccctgagctccgggtcctggg----------------------tgtc
A0A2K5QXZ1_BIK-01      gatccctgagctccgggtcctggg----------------------tgtc
H0XAE7_BIK-01          gatccctgagccgcgggccctggg----------------------tgtg
A0A2K6FM79_BIK-01      ggtcgctcagcccccggccctggg----------------------tgtg
I3LVX0_BIK-01          gacctgcagcccccagcacccggg----------------------tgcc
A0A3Q2LHE3_BIK-01      gcttcctgacccgcagggacagggtaagcctgagatttcatgaccttgac
A0A3Q2LHE3_BIK-02      gcttcctgacccgcagggacagggtaagcctgagatttcatgaccttgac
A0A673V4V4_BIK-01      gcttcctgaccctcaggaacaggg----------------------tgtc
A0A5F5XUY6_BIK-01      gcttcctgaccctcaggaacaggg----------------------tgtc
A0A667G4D3_BIK-01      gcttcctgaccctcaggaacaggg----------------------tgtc
A0A452QUG1_BIK-01      gcttcctgaccttcaggaacaggg----------------------tgtc
A0A3Q7V097_BIK-03      gcttcctgaccttccggaacaggg----------------------tgtc
A0A3Q7V097_BIK-01      gcttcctgaccttccggaacaggg----------------------tgtc
A0A3Q7V097_BIK-02      gcttcctgaccttccggaacaggg----------------------tgtc
A0A7N5KDU2_BIK-01      gtttcctgaccttcaggaacaggg----------------------tgtc
A0A452V3L2_BIK-01      gcttcctgaccttcaggaacaggg--gcctggatttggagccttccctgc
                       *              *      **                          

G1TZR9_BIK-01          cccttggagccgcttctgcctgtccggt---ttgccactgtccccacccc
Q925D2_BIK-01          ac-------ctgaccaggaccctggg-----cagctgtttcccatggtgc
Q925D2_BIK-02          ac-------ctgaccaggaccctggg-----cagctgtttcccatggtgc
O70337_BIK-04          ac-------ctgaccaggaccctggg-----cagctgtttccgatggtgc
O70337_BIK-01          ac-------ctgaccaggaccctggg-----cagctgtttccgatggtgc
O70337_BIK-02          ac-------ctgaccaggaccctggg-----cagctgtttccgatggtgc
O70337_BIK-03          ac-------ctgaccaggaccctggg-----cagctgtttccgatggtgc
W5QCU2_BIK-01          gc-------ccagcctgtggcccgag-----ctggcactgtccctgctgg
H0W025_BIK-01          cc-------cccgctggacctgcagg-----tggctgctgcctgtgctgc
G1S1X2_BIK-01          cc-------gcgaacagatgctgctg-----gtgctgctggtgctgctgc
A0A2K6MCW0_BIK-01      cc-------gcgaacaggtgctgctg-----gcgctgctgctgctgctgg
A0A2K6QK74_BIK-01      cc-------gcgaacaggtgctgctg-----gcgctgctgctgctgctgg
A0A2K5J4Q7_BIK-01      cc-------gcgaacaggtgctgctg-----gcgctgctgctgctgctgg
A0A0D9QZY8_BIK-01      cc-------gcgaacaggtgctgctg-----g---cgctgctgctgctgg
A0A2K5LDM6_BIK-01      cc-------atgaacagg-----------------tgctgctgctgctgg
A0A096NKG5_BIK-01      cc-------gtgaacaggtgctgctg-----gcgctgctgctgctgctgg
A0A2K5XSA1_BIK-01      cc-------gtgaacagg-----------------tgctgctgctgctgg
A0A2K6DBJ4_BIK-01      cc-------gtgaacaggtgctgctg-----gtgctgctgctgctgctgg
A0A2K5VW94_BIK-01      cc-------gtgaacaggtgctgctg-----gtgctgctgctgctgctgg
F6SUD3_BIK-01          cc-------gtgaacaggtgctgctg-----gtgctgctgctgctgctgg
H2P4N6_BIK-01          cc-------gcgaacaggtgctgctg-----gcgctgctgctgtt-----
G3QCT2_BIK-01          cc-------gcgaacaggtgctgctg-----gcgctgctgctgctgctgg
Q13323_BIK-01          ct-------gcgaacaggtgctgctg-----gcgctgctgctgctgctgg
A0A2R8ZXD2_BIK-01      cc-------gcgaacaggtgctgctg-----gcgctgctgctgctgctgg
H2QLU7_BIK-01          cc-------gcgaacaggtgctgctg-----gcgctgctgctgctgctgg
A0A2K6TBD7_BIK-01      cg-------gcaaacagg------cc-----gtgctgctggcgctcctgg
A0A2K5CLG5_BIK-01      cc-------gcaaacagg------ca-----gtgctgctggcactcctgg
A0A2K5QXZ1_BIK-01      cc-------gcaaacagg------ca-----gtgctgctggcattcctgg
H0XAE7_BIK-01          cc-------ctgccccggcgtgggaa-----caggtgctgttgctgctgt
A0A2K6FM79_BIK-01      cc-------ccgccccggcgtgggag-----caggtgctgctgctgctgc
I3LVX0_BIK-01          tc-------ctgcccgggcctgccgg-----gagctgctgcccgtgctgc
A0A3Q2LHE3_BIK-01      tc-------accttcctgcatgtgtagccctctggagccgtgga-gcagc
A0A3Q2LHE3_BIK-02      tc-------accttcctgcatgtgtagccctctggagccgtgga-gcagc
A0A673V4V4_BIK-01      cc-------cgaacgctggccgtggg-----ctggcgctgtccctgctgc
A0A5F5XUY6_BIK-01      cc-------ccaactcggggcgcggg-----ctggcgctgtccctgctgc
A0A667G4D3_BIK-01      cc-------ccaactcggggcgcggg-----ctggcgctgtccctgctgc
A0A452QUG1_BIK-01      cc-------cccacccggggcgcagg-----ctggtgctgtccctgctgc
A0A3Q7V097_BIK-03      cc-------ccaacccggggcgtggg-----ctggtgctgtcgctgctgc
A0A3Q7V097_BIK-01      cc-------ccaacccggggcgtggg-----ctggtgctgtcgctgctgc
A0A3Q7V097_BIK-02      cc-------ccaacccggggcgtggg-----ctggtgctgtcgctgctgc
A0A7N5KDU2_BIK-01      cc-------cccacccggggcgcggg-----ctggtgctgtccctgctgc
A0A452V3L2_BIK-01      cc-------gccacccagccccagag-----ccgatccagcagatgcagt
                                                                         

G1TZR9_BIK-01          agcctgatcctgcaggcctctgggtcggtgcccaggctagctgggtgg--
Q925D2_BIK-01          tgct-------------------ggtcttcttgctgctgggtggg--g--
Q925D2_BIK-02          tgct-------------------ggtcttcttgctgctgggtggg--g--
O70337_BIK-04          tgct-------------------ggtcttcttgctgctgggtggg--g--
O70337_BIK-01          tgct-------------------ggtcttcttgctgctgggtggg--g--
O70337_BIK-02          tgct-------------------ggtcttcttgctgctgggtggg--g--
O70337_BIK-03          tgct-------------------ggtcttcttgctgctgggtggg-----
W5QCU2_BIK-01          t-------------------------ggtggcgatgctcagctggggg--
H0W025_BIK-01          tgtt-------------------gctgctgctgctgctggg------g--
G1S1X2_BIK-01          tgct-------------------gctgctgccgctgctcagcggg--g--
A0A2K6MCW0_BIK-01      c----------------------------ggcgctgctcagcggg--g--
A0A2K6QK74_BIK-01      c----------------------------ggcgctgctcagcggg--g--
A0A2K5J4Q7_BIK-01      cact-------------------gctgctggcgctgctcagcggg--g--
A0A0D9QZY8_BIK-01      cact-------------------gctgctggcgctgctcagcggg--g--
A0A2K5LDM6_BIK-01      cact-------------------gctgctggcgctgctcagcggg--g--
A0A096NKG5_BIK-01      cact-------------------gctgctggcgctgctcagcggg--g--
A0A2K5XSA1_BIK-01      cact-------------------gctgctggcgctgctcagcggg--g--
A0A2K6DBJ4_BIK-01      cact-------------------gctgctggcgctgctcagcggg--g--
A0A2K5VW94_BIK-01      cact-------------------gctgctggcgctgctcagcggg--g--
F6SUD3_BIK-01          cact-------------------gctgctggcgctgctcagcggg--g--
H2P4N6_BIK-01          --------------------------------gctgctcagcggg--g--
G3QCT2_BIK-01          cgct-------------------gctgctgccgctgctcagtggg--g--
Q13323_BIK-01          cgct-------------------gctgctgccgctgctcagcggg--g--
A0A2R8ZXD2_BIK-01      cgct-------------------gctgctgccgctgctcagcggg--g--
H2QLU7_BIK-01          cgct-------------------gctgctgccgctgctcagcggg--g--
A0A2K6TBD7_BIK-01      cgct-------------------gctgctggcgatgttcagcggg--g--
A0A2K5CLG5_BIK-01      cgct-------------------gctgctggcgatgttcagcggg--g--
A0A2K5QXZ1_BIK-01      cgct-------------------gctgctggcgacgttcagcggg--g--
H0XAE7_BIK-01          tgtt-------------------gctggtgctgctgctggcaggg--g--
A0A2K6FM79_BIK-01      tggt-------------------gc---tgctgctgctgggcggg--g--
I3LVX0_BIK-01          tgct-------------------gctgggcctgttgctgagcagg--g--
A0A3Q2LHE3_BIK-01      tgcc-------------------ccgtagggcacagcctcgctggttgcc
A0A3Q2LHE3_BIK-02      tgcc-------------------ccgtagggcacagcctcgctggttgcc
A0A673V4V4_BIK-01      tgct----------------------ggtgctgctgctcagctgg--g--
A0A5F5XUY6_BIK-01      tgct----------------------ggtgttgctgctgggctgg--g--
A0A667G4D3_BIK-01      tgct----------------------ggtgttgctgctgggctgg--g--
A0A452QUG1_BIK-01      tgct-------------------gctggggctgctgctaggctgg--g--
A0A3Q7V097_BIK-03      tgct-------------------gctggtgctgctactaggctgg--g--
A0A3Q7V097_BIK-01      tgct-------------------gctggtgctgctactaggctgg--g--
A0A3Q7V097_BIK-02      tgct-------------------gctggtgctgctactaggctgg--g--
A0A7N5KDU2_BIK-01      tgct-------------------gctggggctgctgctaggctgg--g--
A0A452V3L2_BIK-01      gact--------------------caccacctccggccgggctggtca--
                                                                         

G1TZR9_BIK-01          -----------------------------------acataagcctgagac
Q925D2_BIK-01          -----------------------------------------cctgg----
Q925D2_BIK-02          -----------------------------------------cctgg----
O70337_BIK-04          -----------------------------------------cctgg----
O70337_BIK-01          -----------------------------------------cctgg----
O70337_BIK-02          -----------------------------------------cctgg----
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------------------------------------------------
H0W025_BIK-01          ----------------------------------------accctg----
G1S1X2_BIK-01          -----------------------------------------gcctg----
A0A2K6MCW0_BIK-01      -----------------------------------------gcctg----
A0A2K6QK74_BIK-01      -----------------------------------------gcctg----
A0A2K5J4Q7_BIK-01      -----------------------------------------gcctg----
A0A0D9QZY8_BIK-01      -----------------------------------------gcctg----
A0A2K5LDM6_BIK-01      -----------------------------------------gcctg----
A0A096NKG5_BIK-01      -----------------------------------------gcctg----
A0A2K5XSA1_BIK-01      -----------------------------------------gcctg----
A0A2K6DBJ4_BIK-01      -----------------------------------------gcctg----
A0A2K5VW94_BIK-01      -----------------------------------------gcctg----
F6SUD3_BIK-01          -----------------------------------------gcctg----
H2P4N6_BIK-01          -----------------------------------------gcctg----
G3QCT2_BIK-01          -----------------------------------------gcctg----
Q13323_BIK-01          -----------------------------------------gcctg----
A0A2R8ZXD2_BIK-01      -----------------------------------------gcctg----
H2QLU7_BIK-01          -----------------------------------------gcctg----
A0A2K6TBD7_BIK-01      -----------------------------------------gtctg----
A0A2K5CLG5_BIK-01      -----------------------------------------gtctg----
A0A2K5QXZ1_BIK-01      -----------------------------------------gtctg----
H0XAE7_BIK-01          -----------------------------------------gcctg----
A0A2K6FM79_BIK-01      -----------------------------------------gcctg----
I3LVX0_BIK-01          -----------------------------------------ccctg----
A0A3Q2LHE3_BIK-01      acagtccccaccaatccctattgtcttcttttgcctgcttcaccca----
A0A3Q2LHE3_BIK-02      acagtccccaccaatccctattgtcttcttttgcctgcttcaccca----
A0A673V4V4_BIK-01      --------------------------------------------gg----
A0A5F5XUY6_BIK-01      --------------------------------------------gg----
A0A667G4D3_BIK-01      --------------------------------------------gg----
A0A452QUG1_BIK-01      --------------------------------------------gg----
A0A3Q7V097_BIK-03      --------------------------------------------gc----
A0A3Q7V097_BIK-01      --------------------------------------------gc----
A0A3Q7V097_BIK-02      --------------------------------------------gc----
A0A7N5KDU2_BIK-01      --------------------------------------------gg----
A0A452V3L2_BIK-01      --------------------------------------------gg----
                                                                         

G1TZR9_BIK-01          cagtcggctgccacccg-----------------------gag----cag
Q925D2_BIK-01          ----catttgcagcttc------------------------ag-------
Q925D2_BIK-02          ----catttgcagcttc------------------------ag-------
O70337_BIK-04          ----tatttgcagcttc------------------------ag-------
O70337_BIK-01          ----tatttgcagcttc------------------------ag-------
O70337_BIK-02          ----tatttgcagcttc------------------------ag-------
O70337_BIK-03          --------------------------------------------------
W5QCU2_BIK-01          --------tgccgcttc---------------------------------
H0W025_BIK-01          ----cgcctgctgctgc------------------------ag-------
G1S1X2_BIK-01          ----tacctgctg---a------------------------at-------
A0A2K6MCW0_BIK-01      ----cacctgctgctca------------------------ag-------
A0A2K6QK74_BIK-01      ----cacctgctgctca------------------------ag-------
A0A2K5J4Q7_BIK-01      ----cacctgctgctca------------------------ag-------
A0A0D9QZY8_BIK-01      ----cacctgctgctca------------------------ag-------
A0A2K5LDM6_BIK-01      ----cacctgctgctca------------------------ag-------
A0A096NKG5_BIK-01      ----cacctgctgctca------------------------ag-------
A0A2K5XSA1_BIK-01      ----cacctgctgctca------------------------ag-------
A0A2K6DBJ4_BIK-01      ----cacctgctgctca------------------------ag-------
A0A2K5VW94_BIK-01      ----cacctgctgctca------------------------ag-------
F6SUD3_BIK-01          ----cacctgctgctca------------------------ag-------
H2P4N6_BIK-01          ----cacctgctgctca------------------------ag-------
G3QCT2_BIK-01          ----cacctgctgctca------------------------ag-------
Q13323_BIK-01          ----cacctgctgctca------------------------ag-------
A0A2R8ZXD2_BIK-01      ----cacctgctgctca------------------------ag-------
H2QLU7_BIK-01          ----cacctgctgctca------------------------ag-------
A0A2K6TBD7_BIK-01      ----cgcctgctgctca------------------------ag-------
A0A2K5CLG5_BIK-01      ----cacctgctgctca------------------------ag-------
A0A2K5QXZ1_BIK-01      ----cacctgctgctca------------------------ag-------
H0XAE7_BIK-01          ----cacctgctgctca------------------------ag-------
A0A2K6FM79_BIK-01      ----cacctgctgctca------------------------ag-------
I3LVX0_BIK-01          ----tacctgcggctcc------------------------ag-------
A0A3Q2LHE3_BIK-01      ----ttcctcctcctgcctgttccctgggcctttgggtttgagatggctg
A0A3Q2LHE3_BIK-02      ----ttcctcctcctgcctgttccctgggcctttgggtttgagatggctg
A0A673V4V4_BIK-01      ----ctccaccacctcc------------------------ag-------
A0A5F5XUY6_BIK-01      ----ctccacctcctcc------------------------ag-------
A0A667G4D3_BIK-01      ----ctccacctcctcc------------------------ag-------
A0A452QUG1_BIK-01      ----ttccgcctcctcc------------------------ag-------
A0A3Q7V097_BIK-03      ----ctccgcctcctcc------------------------ag-------
A0A3Q7V097_BIK-01      ----ctccgcctcctcc------------------------ag-------
A0A3Q7V097_BIK-02      ----ctccgcctcctcc------------------------ag-------
A0A7N5KDU2_BIK-01      ----ttccgcctcctcc------------------------ag-------
A0A452V3L2_BIK-01      ----tcctgcccactcccagctgccccgtccggccctcacgac-------
                                                                         

G1TZR9_BIK-01          cactgctga
Q925D2_BIK-01          ------tga
Q925D2_BIK-02          ------tga
O70337_BIK-04          ------tga
O70337_BIK-01          ------tga
O70337_BIK-02          ------tga
O70337_BIK-03          ---------
W5QCU2_BIK-01          ---------
H0W025_BIK-01          ------tga
G1S1X2_BIK-01          ------tga
A0A2K6MCW0_BIK-01      ------tga
A0A2K6QK74_BIK-01      ------tga
A0A2K5J4Q7_BIK-01      ------tga
A0A0D9QZY8_BIK-01      ------tga
A0A2K5LDM6_BIK-01      ------tga
A0A096NKG5_BIK-01      ------tga
A0A2K5XSA1_BIK-01      ------tga
A0A2K6DBJ4_BIK-01      ------tga
A0A2K5VW94_BIK-01      ------tga
F6SUD3_BIK-01          ------tga
H2P4N6_BIK-01          ------tga
G3QCT2_BIK-01          ------tga
Q13323_BIK-01          ------tga
A0A2R8ZXD2_BIK-01      ------tga
H2QLU7_BIK-01          ------tga
A0A2K6TBD7_BIK-01      ------tga
A0A2K5CLG5_BIK-01      ------tga
A0A2K5QXZ1_BIK-01      ------tga
H0XAE7_BIK-01          ------tga
A0A2K6FM79_BIK-01      ------tga
I3LVX0_BIK-01          ------tga
A0A3Q2LHE3_BIK-01      gcttactga
A0A3Q2LHE3_BIK-02      gcttactga
A0A673V4V4_BIK-01      ------tga
A0A5F5XUY6_BIK-01      ------tga
A0A667G4D3_BIK-01      ------tga
A0A452QUG1_BIK-01      ------tga
A0A3Q7V097_BIK-03      ------tga
A0A3Q7V097_BIK-01      ------tga
A0A3Q7V097_BIK-02      ------tga
A0A7N5KDU2_BIK-01      ------tga
A0A452V3L2_BIK-01      ------tga
                                

© 1998-2022Legal notice