Dataset for CDS BIK of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

34 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
F7FUT7_BIK-02          atggaaacccctgagtgcgcgcccgtctcgggcgcagggaaaacagcgac
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          atg-----------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
F7FUT7_BIK-02          gcacgagacaaagcaagtttgcagaacagcagggggcagagaggccgtaa
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          --------------------------ccccagggcgcagttaggcactac
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
F7FUT7_BIK-02          acaagccaaccggccgcacttgtagcggttctgttgctaatgccattcag
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          ccgtccccgcggg---------------------------------gcag
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
F7FUT7_BIK-02          accccagtccagcattccgcgctcggggtgcgagaggcagctcccggggc
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          gctgccgccccccacccctcccggaacctttctgatttatctct------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-02      --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
F7FUT7_BIK-02          ggggcggcgcggggcgggacccgggcggggcggggcgtcccggtccatta
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          -------------------ccttggtgggtctctggggtccgtctcagca
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-02      ----------------------------atgagaaagcggcggcgtcacg
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      --------------------------------------------------
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
F7FUT7_BIK-02          ggtcccgcgcgggtccccgggccgcagacacgacgcctctcggctgggtc
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          ggtctgccggtgggccccctgcccccaattctctcccggtc---------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-02      cagctgctaagcggcagacctgggattcgaactcaggccctctggtttca
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      ---------tttcacaccacccgcaggtgcgctca---------------
A0A452V3L2_BIK-01      ---------------atggcttg-----gagctca---------------
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
A0A2K5QXZ1_BIK-01      --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
F7FUT7_BIK-02          gcagactctgctatcatcgccgccaccgccgccgccgccgccgccgccgc
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          --------------ccgccccgctcttgctgtccgggagcccgcgaccg-
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
A0A3Q2LHE3_BIK-02      gagccgcgttcttcatcatcgtattctgtacctaaggctgtttggtccag
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A452QUG1_BIK-01      ---------------------------------------gcgggtggtag
A0A452V3L2_BIK-01      ---------------------------------------gaagaagctag
                                                                         

W5QCU2_BIK-01          -------------atgtatcaagcaagacccctctctaggaacctctttt
G1TZR9_BIK-01          -------------atgtctgaagtcagacctggctccagggacctcttcc
A0A1S3FUQ7_BIK-01      -------------atgtcggaggccgggtctgtcaccagggacctcttca
H0W025_BIK-01          -------------atgtcggaagcaaaacctgtcgccagggacccactga
I3LVX0_BIK-01          -------------at-----------------------------------
A0A2K5QXZ1_BIK-01      -------------atgtctgaagaaagacccctctccattgacatcttga
A0A2K6TBD7_BIK-01      -------------atgtctgaagacagacccctctccagcgacatcttga
F7FUT7_BIK-02          cgccagaggagaaatgtctgaagtaagacccctctccagtgacatcttca
A0A2K5CLG5_BIK-01      -------------atgtctgaagttagacccctctccagtgacatcttga
F7FUT7_BIK-01          -gagggaggagaaatgtctgaagtaagacccctctccagtgacatcttca
G1S1X2_BIK-01          -------------atgtccgaagtaagacccatctccagagacatcttga
A0A2K6MCW0_BIK-01      -------------atgtctggagtaagacccgtctccagagacatcttga
A0A2K6QK74_BIK-01      -------------atgtctggagtaagacccgtctccagagacatcttga
A0A2K5J4Q7_BIK-01      -------------atgtctggagtaagacccatctccagagacatcttga
A0A0D9QZY8_BIK-01      -------------atgtctggagtaagacccatctccagacacatcttga
A0A2K5VW94_BIK-01      -------------atgtctggagtaagacccatctccagagacaccttga
A0A2K6DBJ4_BIK-01      -------------atgtctggagtaagacccatctccagagacaccttga
A0A2K5LDM6_BIK-01      -------------atgtctggagtaagacccatctccagagacacctgga
A0A2K5XSA1_BIK-01      -------------atgtctggagtaagacccatctccagagacaccttga
A0A096NKG5_BIK-01      -------------atgtctggagttagacccatctccagagacatcttga
H2P4N6_BIK-01          -------------atgtctgaagtaagacctatctccagagacatcctga
G3QCT2_BIK-01          -------------atgtctgaagtaagacccctctccagagacatcttga
A0A2R8ZXD2_BIK-01      -------------atgtctgaagtaagacccctctccagagacatcttga
H2QLU7_BIK-01          -------------atgtctgaagtaagacccctctccagagacatcttga
H0XAE7_BIK-01          -------------atgtcagcaggaaggccagtctccatggaccacttta
A0A2K6FM79_BIK-01      -------------atgtctgaggtgagacccgtctccacggacctcctca
Q925D2_BIK-01          -------------atgtcagaggcgagactaatggccagagacattatc-
O70337_BIK-04          -------------atgtt--------------------------------
O70337_BIK-02          -------------atgtcggaggcgagacttatggccagagacgtcatc-
O70337_BIK-01          -------------atgtcggaggcgagacttatggccagagacgtcatc-
A0A3Q2LHE3_BIK-02      tgtgggagaagaaatgtctcaagtaggacccgtctccagggacctctttc
A0A3Q2LHE3_BIK-01      -------------atgtctcaagtaggacccgtctccagggacctctttc
A0A452QUG1_BIK-01      ---------------------cac----cctccctccaccacc-------
A0A452V3L2_BIK-01      gtcaagagaagaaatgtcccacacaggacccctctccaggaacctctttt
                                                                         

W5QCU2_BIK-01          tgtacaccttcctacaaaaccacggcccaggcttcctggatgaccaaggc
G1TZR9_BIK-01          aggaagccctcctggatgagca-ggtcccagaacctctgttgacgg----
A0A1S3FUQ7_BIK-01      tcaagaccctcctgtaccagca-gatgcccggacctcggccggcag----
H0W025_BIK-01          tggagaccccgctgtttgagcc-accccctgggcctctgctggctg----
I3LVX0_BIK-01          --------------------------------------------------
A0A2K5QXZ1_BIK-01      tggagaccctcctgtgtgagca-gttcatggatccc---ctgacca----
A0A2K6TBD7_BIK-01      tggagactctcctgtgtgagca-gtttgtggatccc---ctgacca----
F7FUT7_BIK-02          tggagaccctcctgtgtgagca-gttcgtggatccc---ctgacca----
A0A2K5CLG5_BIK-01      tggagaccctcttgtgtgagca-gttcgtgcatccc---ctgacca----
F7FUT7_BIK-01          tggagaccctcctgtgtgagca-gttcgtggatccc---ctgacca----
G1S1X2_BIK-01          tggagagcctcctgtatgagca-gctcctggaaccc---ccgacca----
A0A2K6MCW0_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ctaacca----
A0A2K6QK74_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ctaacca----
A0A2K5J4Q7_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ctaacca----
A0A0D9QZY8_BIK-01      tggagagcctcctgtatgagca-gctcctggaaccc---ctgacca----
A0A2K5VW94_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ctaacca----
A0A2K6DBJ4_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ctaacca----
A0A2K5LDM6_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ctaacca----
A0A2K5XSA1_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ctaacca----
A0A096NKG5_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ctaacca----
H2P4N6_BIK-01          tggagaccctcctgtatgagca-gctcctggaaccc---ccgacca----
G3QCT2_BIK-01          tggagaccctcctgtatgagca-gctcctggaaccc---ccgacca----
A0A2R8ZXD2_BIK-01      tggagaccctcctgtatgagca-gctcctggaaccc---ccgacca----
H2QLU7_BIK-01          tggagaccctcctgtatgagca-gctcctggaaccc---ccgacca----
H0XAE7_BIK-01          tggagaccttcccatttgagca-gctcctggagcct---ctgacaa----
A0A2K6FM79_BIK-01      tggagaccttcccgttcgagca-tctcctggaccct---ctgatcc----
Q925D2_BIK-01          --aagactcttctacacgacca-ggtcccccaacctgcagtggtct----
O70337_BIK-04          --------------cac---------------------------------
O70337_BIK-02          --aagactgttccacacgacca-ggtcccccaacctccagtggcct----
O70337_BIK-01          --aagactgttccacacgacca-ggtcccccaacctccagtggcct----
A0A3Q2LHE3_BIK-02      tggacgccttcctgcacgagcg-cagcccggaa---------gccc----
A0A3Q2LHE3_BIK-01      tggacgccttcctgcacgagcg-cagcccggaa---------gccc----
A0A452QUG1_BIK-01      --agcac---cccgcaggggaa-ggtgct-------------gtcc----
A0A452V3L2_BIK-01      tgagcaccttcctgcaggagca-tggcccggaa---------gttc----
                                                                         

W5QCU2_BIK-01          tcagggcttccc---ggcgtgaccagtatctt---------ggagttcca
G1TZR9_BIK-01          -cggaagttccc---ggcctgacccgtcccgtggaggaaggggacttgga
A0A1S3FUQ7_BIK-01      -ccgggcttttc---ccgatcaccgagcctatgggggaagaggtctggga
H0W025_BIK-01          -aaggggctttg---ggtgtgacgcagccactgtgggcagaggacctcag
I3LVX0_BIK-01          -----ggttc----------------------------------------
A0A2K5QXZ1_BIK-01      -tggaggttgtcggtggtgggagtgaccc------tgaagaggacctgga
A0A2K6TBD7_BIK-01      -tggaggttgtc---ggtgggagtgaccc------tgaagaggacccgga
F7FUT7_BIK-02          -tggaggttgtt---ggtgggagtgaccc------tgaagaggacctgga
A0A2K5CLG5_BIK-01      -tggaggttgtc---ggtgggagtgaccc------tgaagaggacctgga
F7FUT7_BIK-01          -tggaggttgtt---ggtgggagtgaccc------tgaagaggacctgga
G1S1X2_BIK-01          -tggaggttctt---ggcgtgactgaccc------tgaagaggacctgga
A0A2K6MCW0_BIK-01      -tggaggttctt---ggtgtgactgaccc------tgaagaggacctgga
A0A2K6QK74_BIK-01      -tggaggttctt---ggtgtgactgaccc------tgaagaggacctgga
A0A2K5J4Q7_BIK-01      -tggaggttctt---ggtgtgactgaccc------tgaagaggacctgga
A0A0D9QZY8_BIK-01      -tggaggttctt---ggtgtgactgaccc------tgaagaggacctgga
A0A2K5VW94_BIK-01      -tggaggttctt---ggtgtcactgaccc------tgaagaggacctgga
A0A2K6DBJ4_BIK-01      -tggaggttctt---ggtgtcactgaccc------tgaagaggacctgga
A0A2K5LDM6_BIK-01      -tggaggttctt---ggtgtgactgaccc------tgaagaggacctgga
A0A2K5XSA1_BIK-01      -tggaggttctt---ggtgtgactgaccc------tgaagaggacctgga
A0A096NKG5_BIK-01      -tggaggttctt---ggtgtgactgaccc------tgaagaggacctgga
H2P4N6_BIK-01          -tggaggttctt---ggcgtgactgactc------tgaagaggacctgga
G3QCT2_BIK-01          -tggaggttctt---ggcgtgactgactc------tgaagaggacctgga
A0A2R8ZXD2_BIK-01      -tggaggttctt---ggcgtgactgagtc------tgaggaggacctgga
H2QLU7_BIK-01          -tggaggttctt---ggcgtgactgactc------tgaagaggacctgga
H0XAE7_BIK-01          -tggaggttctt---ggcatgactg------------------agcccaa
A0A2K6FM79_BIK-01      -tggaggttctc---agcatcatggacaa------cgaggagaatcccga
Q925D2_BIK-01          -ctggggctccc---agcatgaaggagcctgtgggggttgaggacgtcag
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          -ctgagactccc---agcatgaaggag-----------------------
O70337_BIK-01          -ctgagactccc---agcatgaaggag-----------------------
A0A3Q2LHE3_BIK-02      -tggaggttcct---ggcatgaccgag-----------------------
A0A3Q2LHE3_BIK-01      -tggaggttcct---ggcatgaccgag-----------------------
A0A452QUG1_BIK-01      -tgacaggtgcg---gg--tggcatat-----------------------
A0A452V3L2_BIK-01      -tggaggttccg---ggcatgactgat-----------------------
                                                                         

W5QCU2_BIK-01          ccccat---------------------ctccccctacagtgacagtccac
G1TZR9_BIK-01          t------------------ctcatggagtgcctcgagggcagtaacc---
A0A1S3FUQ7_BIK-01      c------------------cccatggactgtctggagggcagtaacc---
H0W025_BIK-01          tccccctggggacactaacctcatggaatgcgtggaaggcagcagcc---
I3LVX0_BIK-01          -----------------------------------agggcagtcacc---
A0A2K5QXZ1_BIK-01      ccctgtggaggac------ccgttggaatgcatggagaacagtgacg---
A0A2K6TBD7_BIK-01      ctctgtggaggac------cctttggaatgcatggagaacagtgacg---
F7FUT7_BIK-02          ccctgtggaggac------cctttggaatgcatggagaacagtgacg---
A0A2K5CLG5_BIK-01      ccctgtggaggac------cctttggaatgcatggagaacagtgacg---
F7FUT7_BIK-01          ccctgtggaggac------cctttggaatgcatggagaacagtgacg---
G1S1X2_BIK-01          ccctatggaggacttcgatcctttgcagtgcatggagggcagtgacg---
A0A2K6MCW0_BIK-01      ccctatggaggacttcgatcctttggagtgtatggaggacagtgaca---
A0A2K6QK74_BIK-01      ccctatggaggacttcgatcctttggagtgtatggaggacagtgaca---
A0A2K5J4Q7_BIK-01      ccctatggaggacttcgatcctttggagtgtatggaggacagtgaca---
A0A0D9QZY8_BIK-01      ccctatggaggacttcgatcctttggagtgtatggaggacagtgaca---
A0A2K5VW94_BIK-01      ccctatggaggacttcaatcctttggagtgtatggaggacagtgaca---
A0A2K6DBJ4_BIK-01      ccctatggaggacttcgatcctttggagtgtatagaggacagtgaca---
A0A2K5LDM6_BIK-01      ccctatggaggacttcgatcctttggagtgtatggaggacagtgaca---
A0A2K5XSA1_BIK-01      ccctatggaggacttcgatcctttggagtgtatggaggacagtgaca---
A0A096NKG5_BIK-01      ccctatggaggacttcgatcctttggagtgtatggaggacagtgaca---
H2P4N6_BIK-01          ccctatggaggacttcagtcctttggagtgcatggagggcagtgacg---
G3QCT2_BIK-01          ccctatggaggacttcgattctttggagtgcatggagggcagtgacg---
A0A2R8ZXD2_BIK-01      ccctatggaggacttcgattctttggagtgcatggagggcagtgacg---
H2QLU7_BIK-01          ccctatggaggacttcgattctttggagtgcatggagggcagtgacg---
H0XAE7_BIK-01          c------------------cccatggagtgcctggaggacagtgacc---
A0A2K6FM79_BIK-01      c------------------ccctcggggtgcctcgaggacagtgacg---
Q925D2_BIK-01          tcctgtgagagacttggatttcatgaggtgcctggagagcagaaacc---
O70337_BIK-04          ---------------------------------------cagaaacc---
O70337_BIK-02          -cctgtgagagacgtggacctcatggagtgcgtggaaggcagaaacc---
O70337_BIK-01          -cctgtgagagacgtggacctcatggagtgcgtggaaggcagaaacc---
A0A3Q2LHE3_BIK-02      -ctca---------------cagagtcctcccccgacagtgacaaccgtg
A0A3Q2LHE3_BIK-01      -ctca---------------cagagtcctcccccgacagtgacaaccgtg
A0A452QUG1_BIK-01      -gtca-----------ggccacgggccctttgt-----gcaacaaccccg
A0A452V3L2_BIK-01      -ctcgtggagtactatgatccggggccctcccctaacagcaacaaccccg
                                                                         

W5QCU2_BIK-01          actacctggccatgcagctggcctccattgccgacgagatggagctgagg
G1TZR9_BIK-01          ---aggtggccctgaggctggcgtacatcggcgacgagatggacctgcac
A0A1S3FUQ7_BIK-01      ---aggtggccctgtggctggtgtgcatcggcgacgaaatggaccagcgc
H0W025_BIK-01          ---tggtggccctgcggctggcctgcatcggtgacgagatggacctgcgc
I3LVX0_BIK-01          ---aggtggccctgcgactggcctgcattggggatgagatggatctgtgt
A0A2K5QXZ1_BIK-01      ---cactggccctgcagctggcctgcatcgcggaccagatggatgtgagc
A0A2K6TBD7_BIK-01      ---cactggccctgcagctggcctgcatcgcggaccagatggatgtgagc
F7FUT7_BIK-02          ---cactggccctgcagctggcctgcatcgcggaccagatggatgtgagc
A0A2K5CLG5_BIK-01      ---cactggtcctgcagctggcctgcatcgcggaccagatggatgtgagc
F7FUT7_BIK-01          ---cactggccctgcagctggcctgcatcgcggaccagatggatgtgagc
G1S1X2_BIK-01          ---cgctggccccgcggctggcctgcatcggggacgagatggacgtgagc
A0A2K6MCW0_BIK-01      ---tgttggccctgcggctggcctgcatcggggatgagatggacgtgagc
A0A2K6QK74_BIK-01      ---tgttggccctgcggctggcctgcatcggggatgagatggacgtgagc
A0A2K5J4Q7_BIK-01      ---tgttggccctgcggctggcctgcatcggggatgagatggacgtgagc
A0A0D9QZY8_BIK-01      ---tgttggccctgcggctggcctgcatcggggacgagatggacgtgagc
A0A2K5VW94_BIK-01      ---tgttggccctgcggctggcctgcatcggggacgagatggatgtgagc
A0A2K6DBJ4_BIK-01      ---tgttggccctgcggctggcctgcatcggggacgagatggatgtgagc
A0A2K5LDM6_BIK-01      ---tgttggccctgcggctggcctgcatcggggacgagatggatgtgagc
A0A2K5XSA1_BIK-01      ---tgttggccctgcggctggcctgcatcggggacgagatggatgtgagc
A0A096NKG5_BIK-01      ---tgttggccctgcggctggcctgcatcggggacgagatggatgtgagc
H2P4N6_BIK-01          ---cgttggccttgcggctggcctgcatcggggacgagatggacgtgagc
G3QCT2_BIK-01          ---cgttggccctgcggctggcctgcatcggggatgagatggacgtgagc
A0A2R8ZXD2_BIK-01      ---cgttggccctgcggctggcctgcatcggggacgagatggacgtgagc
H2QLU7_BIK-01          ---cgttggccctgcggctggcctgcatcggggacgagatggacgtgagc
H0XAE7_BIK-01          ---aggtggccctgcggctagcctgcattggggacgagatggacctgcat
A0A2K6FM79_BIK-01      ---aggtggccctgcggctagcctgcattggggatgagatggacctgtgt
Q925D2_BIK-01          ---aggtggccctgaggctagcctgcatcggcgatgagatggaccggtgt
O70337_BIK-04          ---aggtggccttgaggctggcctgcatcggcgatgagatggacctgtgt
O70337_BIK-02          ---aggtggccttgaggctggcctgcatcggcgatgagatggacctgtgt
O70337_BIK-01          ---aggtggccttgaggctggcctgcatcggcgatgagatggacctgtgt
A0A3Q2LHE3_BIK-02      actctgtggccatgcggctggccttcatcggggacgagatggaagtgaga
A0A3Q2LHE3_BIK-01      actctgtggccatgcggctggccttcatcggggacgagatggaagtgaga
A0A452QUG1_BIK-01      acgatgtggccatgcggctggccttcatcggggacgagatggaagtgaga
A0A452V3L2_BIK-01      acgatgtggccatgcggctggccttcatcggggacgagatggaagtgaga
                             *** *  *   ** *  * *** *  **  * *****   *   

W5QCU2_BIK-01          ttgctgctgccccagttcgttgagcccttctggatgcccatgtacagct-
G1TZR9_BIK-01          ccccgacggtacacctctgcccggctgcttgttccgtct---tacagct-
A0A1S3FUQ7_BIK-01      ctccgaagtcctcgcctggcccagctgccggggatggccatacacagcc-
H0W025_BIK-01          ctacggagcccccgcctggcccagctgccagggagggcagtgcacagcc-
I3LVX0_BIK-01          tttcaggacctccaactggcccagctgcctgggatggccatgcacagcc-
A0A2K5QXZ1_BIK-01      cttagggcccggaagctggcccagctctacgaggtggccatgtacagccc
A0A2K6TBD7_BIK-01      ctcagggcccggaggctggcccagctctacgaggtggccacgtacagccc
F7FUT7_BIK-02          ctcagggcccggaggctggcccagctctacgaggtggccatgtacagccc
A0A2K5CLG5_BIK-01      cttagggcccggaggctggcccagctctatgaggtggccatgtacagccc
F7FUT7_BIK-01          ctcagggcccggaggctggcccagctctacgaggtggccatgtacagccc
G1S1X2_BIK-01          ctcagggccccgcgcctggcccagctctccgaggtggccatgcacagcct
A0A2K6MCW0_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
A0A2K6QK74_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
A0A2K5J4Q7_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
A0A0D9QZY8_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
A0A2K5VW94_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
A0A2K6DBJ4_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
A0A2K5LDM6_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
A0A2K5XSA1_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
A0A096NKG5_BIK-01      ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcct
H2P4N6_BIK-01          ctcagggccccgcgccgggcccagctccccgaggtggccatgcacagcct
G3QCT2_BIK-01          ctcagggccccgcgcctggcccagctctccgaggtggccatgcacagcct
A0A2R8ZXD2_BIK-01      ctcagggccccgcgcctggcccagctctccgacgtggccatgcacagcct
H2QLU7_BIK-01          ctcagggccccacgcctggcccagctctccgacgtggccatgcacagcct
H0XAE7_BIK-01          ctcaggagcccccgactagcccagctgtccaggatgaccatgcacagcct
A0A2K6FM79_BIK-01      ctcaggagcccccgcctggcctggctgcccgggatgaccatgcacagcct
Q925D2_BIK-01          cttcggagcccccgtctggtccagctgcctgggattgctatgcacagac-
O70337_BIK-04          ctgcggagcccccgtctggtccagctgcctgggattgctatacacagac-
O70337_BIK-02          ctgcggagcccccgtctggtccagctgcctgggattgctatacacagac-
O70337_BIK-01          ctgcggagcccccgtctggtccagctgcctgggattgctatacacagac-
A0A3Q2LHE3_BIK-02      tggatgctgccccacatcgctgagctgcctggggtggccgtgtacagct-
A0A3Q2LHE3_BIK-01      tggatgctgccccacatcgctgagctgcctggggtggccgtgtacagct-
A0A452QUG1_BIK-01      tggatgcttccccgcgttggcgagctccccgggatggccatgtacagct-
A0A452V3L2_BIK-01      tggatgcttccccgcgttggcgagctgcccgggatggccatgtacagct-
                                         *    **            *     ****   

W5QCU2_BIK-01          -----tgtgtttcccctacagccacgt---agggctcagggatgttctga
G1TZR9_BIK-01          -----tggccttcacctacagccagac---gggcttcacgggtgttctcg
A0A1S3FUQ7_BIK-01      -----tggctctgacctacagccagat---gggtgtctggggagtgctcc
H0W025_BIK-01          -----tggccatcacttacagccagat---ggggctctggggtgtgctcg
I3LVX0_BIK-01          -----ttgctctcagctacagccaggc---gagagtcacgggtgtgctca
A0A2K5QXZ1_BIK-01      gggtctcgctgtcacccttgaccagac---cgacatcagggatgttctcg
A0A2K6TBD7_BIK-01      gggtctcgctttcatccttgaccggac---cgacatcagggatgttctta
F7FUT7_BIK-02          gggtctcgctttcgtcctcgaccggac---cgacatcggggatgttctta
A0A2K5CLG5_BIK-01      gggtctcgctttcatcctcgaccggac---cgacatcggggatgttctta
F7FUT7_BIK-01          gggtctcgctttcgtcctcgaccggac---cgacatcggggatgttctta
G1S1X2_BIK-01          gggtctggctttcatctatgaccagactgaggacatcagggatgttctta
A0A2K6MCW0_BIK-01      aggtctggctttcatctacgaccagaccgacgacatcagggatgttctta
A0A2K6QK74_BIK-01      aggtctggctttcatctacgaccagaccgacgacatcagggatgttctta
A0A2K5J4Q7_BIK-01      gggtctggctttcatctacgaccagaccgacgacatcagggatgttctta
A0A0D9QZY8_BIK-01      gggtctggctttcatctacgaccagacggacgacatcagggatgttctta
A0A2K5VW94_BIK-01      gggtctggctttcatctacgaccagatggacgacatcagggatgttctta
A0A2K6DBJ4_BIK-01      gggtctggctttcatctacgaccagatggacgacatcagggatgttctta
A0A2K5LDM6_BIK-01      gggtctggctttcatctgcgaccagacggacgacatcagggatgttctta
A0A2K5XSA1_BIK-01      gggtctggctttcatctacgaccagacggacgacatcagggatgttctta
A0A096NKG5_BIK-01      gggtctggctttcatctacgaccagacggacgacatcagggatgttctta
H2P4N6_BIK-01          gggtctggctttcatctacgaccagactgaggacatcagggatgttctta
G3QCT2_BIK-01          gggtctggctttcatctacgaccagaccgaggacatcagggatgttctta
A0A2R8ZXD2_BIK-01      gggtctggctttcatctacgaccagactgaggacatcagggatgttctta
H2QLU7_BIK-01          gggtctggctttcatctacgaccagactgaggacatcagggatgttctta
H0XAE7_BIK-01          ggg------tctatcctacaaccagac---tgatggccagggtgtcctca
A0A2K6FM79_BIK-01      ggggctggcgctgtcctgtgaccagcc---ggtccgctggggcgtgctcg
Q925D2_BIK-01          -----ttgctgccacctacagccagac---gggtgtcagaggtattttca
O70337_BIK-04          -----tcgctgtcacctacagccggac---aggtgtcagaggtattttca
O70337_BIK-02          -----tcgctgtcacctacagccggac---aggtgtcagaggtattttca
O70337_BIK-01          -----tcgctgtcacctacagccggac---aggtgtcagaggtattttca
A0A3Q2LHE3_BIK-02      -----tggccttcacctacaaccagac---aggcctgaggggtgttttta
A0A3Q2LHE3_BIK-01      -----tggccttcacctacaaccagac---aggcctgaggggtgttttta
A0A452QUG1_BIK-01      -----tggcttttacctacaaccagac---aggcctgagaggtgttcttc
A0A452V3L2_BIK-01      -----tggcttttacctacaaccagac---aggcctgagaggtgttcttc
                                            **                 *   *  *  

W5QCU2_BIK-01          gaagctttatggttgctttcaccaacctcagggagaaccg---aaggctc
G1TZR9_BIK-01          gaagcgtggggctccaccttgccagcctcgtaga------------gctc
A0A1S3FUQ7_BIK-01      gacgcctcatccgtggggtcgcccacctgagggcgcacat---cagggcc
H0W025_BIK-01          gaaggctgaccctcagtctcgccagcctcagggacaatgt---gtgggcc
I3LVX0_BIK-01          gaagcttggcccagggtctcgccagcctcagggagaacat---gtggttc
A0A2K5QXZ1_BIK-01      gcggtattgtggacattttcgctaacttccaggaggacgtagtgaggctc
A0A2K6TBD7_BIK-01      gcggtgtcgtggatgttttcgctgacttccaggaggacatagtgaggctc
F7FUT7_BIK-02          gcggtgtcgtggatgttttcgctaacttccaggaggacatagtgaggctc
A0A2K5CLG5_BIK-01      gcggtatcgtggaagttttcgctaacttccaggaggacatagtgaggctc
F7FUT7_BIK-01          gcggtgtcgtggatgttttcgctaacttccaggaggacatagtgaggctc
G1S1X2_BIK-01          gaagtttcatggacggtttcaccacctttaaggagaacataataaggctc
A0A2K6MCW0_BIK-01      caagtttcatggacggcttcaccacccttaaggagaacataatgaggttc
A0A2K6QK74_BIK-01      caagtttcatggacggcttcaccacccttaaggagaacataatgaggttc
A0A2K5J4Q7_BIK-01      gaagtttcatggacggcttcaccacccttaaggagaacataatgaggttc
A0A0D9QZY8_BIK-01      gaagtttcatagatggtttcaccacccttagggagaacataatgaggttc
A0A2K5VW94_BIK-01      gaagtttcatggatggtttcaccacccttagggagaacataatgaggttc
A0A2K6DBJ4_BIK-01      gaagtttcatggatggtttcaccacccttagggagaacataatgaggttc
A0A2K5LDM6_BIK-01      gaagtttcatggatggtttcaccacccttagggagaacataatgaggttc
A0A2K5XSA1_BIK-01      gaagtttcctggatggtttcaccacccttagggagaacataatgaggttc
A0A096NKG5_BIK-01      gaagtttcatggatggtttcaccacccttagggagaacataatgaggttc
H2P4N6_BIK-01          gaagtttcacggacggtttcaccacccttaaggaaaacataatgaggttc
G3QCT2_BIK-01          gaagtttcatggacggtttcaccacccttaaggagaacataatgaggttc
A0A2R8ZXD2_BIK-01      gaagtttcatggacggtttcaccacacttaaggagaacataatgaggttc
H2QLU7_BIK-01          gaagtttcatggacggtttcaccacacttaaggagaacataatgaggttc
H0XAE7_BIK-01          gaagtgttatcagcggtttcaccaacctcagggagaatatagcagggttc
A0A2K6FM79_BIK-01      ggagccttagcgacggtttcgccaacctcagggagtacgtggccaggctc
Q925D2_BIK-01          gaagcttgattggaagcctcaccaacctcagggaaaatat---ctggtcc
O70337_BIK-04          ggagcttgattcgaagcctcaccaacctcagggaaaacat---ctggtcc
O70337_BIK-02          ggagcttgattcgaagcctcaccaacctcagggaaaacat---ctggtcc
O70337_BIK-01          ggagcttgattcgaagcctcaccaacctcagggaaaacat---ctggtcc
A0A3Q2LHE3_BIK-02      gaagtttcatggatggtctcactaacctcagggagaacat---aaggttc
A0A3Q2LHE3_BIK-01      gaagtttcatggatggtctcactaacctcagggagaacat---aaggttc
A0A452QUG1_BIK-01      gaagtctcatggacggactcactaacctcagggagaacat---aaggatt
A0A452V3L2_BIK-01      gaagtctcatggacggactcactaacctcagggagaacat---aaggatc
                          *  *           *  *     *    *             *   

W5QCU2_BIK-01          tggagcttcctgactctcagggaccggg----------------------
G1TZR9_BIK-01          tggagcccctggg---taagagcttggg----------------------
A0A1S3FUQ7_BIK-01      tggagaccccccatcccccgcctccagg----------------------
H0W025_BIK-01          tgtggacgcccagcctcccgtgcctggg----------------------
I3LVX0_BIK-01          tggagacctgcagcccccagcacccggg----------------------
A0A2K5QXZ1_BIK-01      tggagatccctgagctccgggtcctggg----------------------
A0A2K6TBD7_BIK-01      tggagatccctgagctctgggtcctggg----------------------
F7FUT7_BIK-02          tggagatccctgagctccgggtcctggg----------------------
A0A2K5CLG5_BIK-01      tggagatccctgagctccgggtcctggg----------------------
F7FUT7_BIK-01          tggagatccctgagctccgggtcctggg----------------------
G1S1X2_BIK-01          tggagatccccgaaccccgggtcccggg----------------------
A0A2K6MCW0_BIK-01      tggagatccctgaatcccgggtcccagg----------------------
A0A2K6QK74_BIK-01      tggagatccctgaatcccgggtcccagg----------------------
A0A2K5J4Q7_BIK-01      tggagatccccgaatcccgggtcccggg----------------------
A0A0D9QZY8_BIK-01      tggagatccctgaatcccgggtcctggg----------------------
A0A2K5VW94_BIK-01      tggagatccccgaatcccaggtcctggg----------------------
A0A2K6DBJ4_BIK-01      tggagatccccgaatcccaggtcctggg----------------------
A0A2K5LDM6_BIK-01      tggagatccccgaatcccaggtcctggg----------------------
A0A2K5XSA1_BIK-01      tggagatccccgaatcccaggtcctggg----------------------
A0A096NKG5_BIK-01      tggagatccccgaatcccaggtcctggg----------------------
H2P4N6_BIK-01          tggagctccct---------------------------------------
G3QCT2_BIK-01          tggagatccccgaaccccgggtcctggg----------------------
A0A2R8ZXD2_BIK-01      tggagatccccgaaccccaggtcctggg----------------------
H2QLU7_BIK-01          tggagatccccgaaccccgggtcctggg----------------------
H0XAE7_BIK-01          tggagatccctgagccgcgggccctggg----------------------
A0A2K6FM79_BIK-01      tggaggtcgctcagcccccggccctggg----------------------
Q925D2_BIK-01          tggagagtcttcactcctggcgcctggg----------------------
O70337_BIK-04          tggagagtcttgactcctggcgcctggg----------------------
O70337_BIK-02          tggagagtcttgactcctggcgcctggg----------------------
O70337_BIK-01          tggagagtcttgactcctggcgcctggg----------------------
A0A3Q2LHE3_BIK-02      tggagcttcctgacccgcagggacagggtaagcctgagatttcatgacct
A0A3Q2LHE3_BIK-01      tggagcttcctgacccgcagggacagggtaagcctgagatttcatgacct
A0A452QUG1_BIK-01      tggagcttcctgaccttcaggaacaggg----------------------
A0A452V3L2_BIK-01      tggagcttcctgaccttcaggaacaggg----------------------
                       **  *                                             

W5QCU2_BIK-01          -------------------tgtcgcccagcctgtggcccgagctggcact
G1TZR9_BIK-01          -------------------gggcccct----------tggagccgcttct
A0A1S3FUQ7_BIK-01      -------------------tgtcccctggccaggtccgcaggcagatgct
H0W025_BIK-01          -------------------tgtccccccgctggacctgcaggtggctgct
I3LVX0_BIK-01          -------------------tgcctcctgcccgggcctgccgggagctgct
A0A2K5QXZ1_BIK-01      -------------------tgtcccgcaaacagg------cagtgctgct
A0A2K6TBD7_BIK-01      -------------------tgtccggcaaacagg------ccgtgctgct
F7FUT7_BIK-02          -------------------tgtcccgcaaacagg------cagtgctgct
A0A2K5CLG5_BIK-01      -------------------tgtcccgcaaacagg------cagtgctgct
F7FUT7_BIK-01          -------------------tgtcccgcaaacagg------cagtgctgct
G1S1X2_BIK-01          -------------------tgtcccgcgaacagatgctgctggtgctgct
A0A2K6MCW0_BIK-01      -------------------tgtcccgcgaacaggtgctgctggcgctgct
A0A2K6QK74_BIK-01      -------------------tgtcccgcgaacaggtgctgctggcgctgct
A0A2K5J4Q7_BIK-01      -------------------tgtcccgcgaacaggtgctgctggcgctgct
A0A0D9QZY8_BIK-01      -------------------tgtcccgcgaacaggtgctgctgg---cgct
A0A2K5VW94_BIK-01      -------------------tgtcccgtgaacaggtgctgctggtgctgct
A0A2K6DBJ4_BIK-01      -------------------tgtcccgtgaacaggtgctgctggtgctgct
A0A2K5LDM6_BIK-01      -------------------tgtcccatgaacagg------------tgct
A0A2K5XSA1_BIK-01      -------------------tgtcccgtgaacagg------------tgct
A0A096NKG5_BIK-01      -------------------tgtcccgtgaacaggtgctgctggcgctgct
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          -------------------tgtcccgcgaacaggtgctgctggcgctgct
A0A2R8ZXD2_BIK-01      -------------------tgtcccgcgaacaggtgctgctggcgctgct
H2QLU7_BIK-01          -------------------tgtcccgcgaacaggtgctgctggcgctgct
H0XAE7_BIK-01          -------------------tgtgccctgccccggcgtgggaacaggtgct
A0A2K6FM79_BIK-01      -------------------tgtgccccgccccggcgtgggagcaggtgct
Q925D2_BIK-01          -------------------tgtcacctgaccaggaccctgggcagctgtt
O70337_BIK-04          -------------------tgtcacctgaccaggaccctgggcagctgtt
O70337_BIK-02          -------------------tgtcacctgaccaggaccctgggcagctgtt
O70337_BIK-01          -------------------tgtcacctgaccaggaccctgggcagctgtt
A0A3Q2LHE3_BIK-02      tgactcaccttcctgcatgtgtagccctctggagccgtggagcagctgcc
A0A3Q2LHE3_BIK-01      tgactcaccttcctgcatgtgtagccctctggagccgtggagcagctgcc
A0A452QUG1_BIK-01      -------------------tg----tccccccacccggggcgcag-----
A0A452V3L2_BIK-01      ----------gcctggatttggagccttccctgcccgccacccagc----
                                                                         

W5QCU2_BIK-01          gtccctgc----------tggtggtggcgatgctca--------------
G1TZR9_BIK-01          gcctgtccggtttgccactgtccccaccccagcctgatcct---------
A0A1S3FUQ7_BIK-01      gc---------------ccgcag-tgctgctgctct--------------
H0W025_BIK-01          gcctgtgc----tgctgttgctgctgctgctgctg---------------
I3LVX0_BIK-01          gcccgtgc----tgctgctgctgggcctgttgctga--------------
A0A2K5QXZ1_BIK-01      ggcattcc----tggcgctgctgctggcgacgttca--------------
A0A2K6TBD7_BIK-01      ggcgctcc----tggcgctgctgctggcgatgttca--------------
F7FUT7_BIK-02          agcactcc----tggcgctgctgctggcgatgttca--------------
A0A2K5CLG5_BIK-01      ggcactcc----tggcgctgctgctggcgatgttca--------------
F7FUT7_BIK-01          agcactcc----tggcgctgctgctggcgatgttca--------------
G1S1X2_BIK-01          ggtgctgc----tgctgctgctgctgccgctgctca--------------
A0A2K6MCW0_BIK-01      gctgctgc----tggc---------ggcgctgctca--------------
A0A2K6QK74_BIK-01      gctgctgc----tggc---------ggcgctgctca--------------
A0A2K5J4Q7_BIK-01      gctgctgc----tggcactgctgctggcgctgctca--------------
A0A0D9QZY8_BIK-01      gctgctgc----tggcactgctgctggcgctgctca--------------
A0A2K5VW94_BIK-01      gctgctgc----tggcactgctgctggcgctgctca--------------
A0A2K6DBJ4_BIK-01      gctgctgc----tggcactgctgctggcgctgctca--------------
A0A2K5LDM6_BIK-01      gctgctgc----tggcactgctgctggcgctgctca--------------
A0A2K5XSA1_BIK-01      gctgctgc----tggcactgctgctggcgctgctca--------------
A0A096NKG5_BIK-01      gctgctgc----tggcactgctgctggcgctgctca--------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          gctgctgc----tggcgctgctgctgccgctgctca--------------
A0A2R8ZXD2_BIK-01      gctgctgc----tggcgctgctgctgccgctgctca--------------
H2QLU7_BIK-01          gctgctgc----tggcgctgctgctgccgctgctca--------------
H0XAE7_BIK-01          gttgctgc----tgttgttgctggtgctgctgctgg--------------
A0A2K6FM79_BIK-01      gctgctgc----tgctggtgc---tgctgctgctgg--------------
Q925D2_BIK-01          tcccatgg----tgctgctggtcttcttgctgctgg--------------
O70337_BIK-04          tccgatgg----tgctgctggtcttcttgctgctgg--------------
O70337_BIK-02          tccgatgg----tgctgctggtcttcttgctgctgg--------------
O70337_BIK-01          tccgatgg----tgctgctggtcttcttgctgctgg--------------
A0A3Q2LHE3_BIK-02      ccgtaggg----cacagcctcgctggttgccacagtccc-caccaatccc
A0A3Q2LHE3_BIK-01      ccgtaggg----cacagcctcgctggttgccacagtccc-caccaatccc
A0A452QUG1_BIK-01      ------gc----tggtgctgtccctgctgctgctg-----ctggggctgc
A0A452V3L2_BIK-01      ------cc----cagagccgatccagcagatgcagtgactcaccacctcc
                                                                         

W5QCU2_BIK-01          --------------gctggggg----------------------------
G1TZR9_BIK-01          --------------gcaggcctctgggtcggtgcccaggctagctgggtg
A0A1S3FUQ7_BIK-01      --------------gcggagccctg-------------------------
H0W025_BIK-01          ----------------gggaccctg-------------------------
I3LVX0_BIK-01          --------------gcagggccctg-------------------------
A0A2K5QXZ1_BIK-01      --------------gcgggggtctg-------------------------
A0A2K6TBD7_BIK-01      --------------gcgggggtctg-------------------------
F7FUT7_BIK-02          --------------gtgggggtctg-------------------------
A0A2K5CLG5_BIK-01      --------------gcgggggtctg-------------------------
F7FUT7_BIK-01          --------------gtgggggtctg-------------------------
G1S1X2_BIK-01          --------------gcgggggcctg-------------------------
A0A2K6MCW0_BIK-01      --------------gcgggggcctg-------------------------
A0A2K6QK74_BIK-01      --------------gcgggggcctg-------------------------
A0A2K5J4Q7_BIK-01      --------------gcgggggcctg-------------------------
A0A0D9QZY8_BIK-01      --------------gcgggggcctg-------------------------
A0A2K5VW94_BIK-01      --------------gcgggggcctg-------------------------
A0A2K6DBJ4_BIK-01      --------------gcgggggcctg-------------------------
A0A2K5LDM6_BIK-01      --------------gcgggggcctg-------------------------
A0A2K5XSA1_BIK-01      --------------gcgggggcctg-------------------------
A0A096NKG5_BIK-01      --------------gcgggggcctg-------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------gtgggggcctg-------------------------
A0A2R8ZXD2_BIK-01      --------------gcgggggcctg-------------------------
H2QLU7_BIK-01          --------------gcgggggcctg-------------------------
H0XAE7_BIK-01          --------------cagggggcctg-------------------------
A0A2K6FM79_BIK-01      --------------gcgggggcctg-------------------------
Q925D2_BIK-01          --------------gtggggcctgg-------------------------
O70337_BIK-04          --------------gtggggcctgg-------------------------
O70337_BIK-02          --------------gtggggcctgg-------------------------
O70337_BIK-01          --------------gtggggcctgg-------------------------
A0A3Q2LHE3_BIK-02      tattgtcttcttttgcctgcttcac-------------------------
A0A3Q2LHE3_BIK-01      tattgtcttcttttgcctgcttcac-------------------------
A0A452QUG1_BIK-01      tgcta---------ggctgg--ggg-------------------------
A0A452V3L2_BIK-01      ggccg---------ggctggtcagg-------------------------
                                                                         

W5QCU2_BIK-01          ------------------------tgccgcttc-----------------
G1TZR9_BIK-01          gacataagcctgagaccagtcggctgccacccggagcagcact-------
A0A1S3FUQ7_BIK-01      --------------------cagctgctgctcc-----------------
H0W025_BIK-01          --------------------cgcctgctgctgc-----------------
I3LVX0_BIK-01          --------------------tacctgcggctcc-----------------
A0A2K5QXZ1_BIK-01      --------------------cacctgctgctca-----------------
A0A2K6TBD7_BIK-01      --------------------cgcctgctgctca-----------------
F7FUT7_BIK-02          --------------------cacctgctgctca-----------------
A0A2K5CLG5_BIK-01      --------------------cacctgctgctca-----------------
F7FUT7_BIK-01          --------------------cacctgctgctca-----------------
G1S1X2_BIK-01          --------------------tacctgctg---a-----------------
A0A2K6MCW0_BIK-01      --------------------cacctgctgctca-----------------
A0A2K6QK74_BIK-01      --------------------cacctgctgctca-----------------
A0A2K5J4Q7_BIK-01      --------------------cacctgctgctca-----------------
A0A0D9QZY8_BIK-01      --------------------cacctgctgctca-----------------
A0A2K5VW94_BIK-01      --------------------cacctgctgctca-----------------
A0A2K6DBJ4_BIK-01      --------------------cacctgctgctca-----------------
A0A2K5LDM6_BIK-01      --------------------cacctgctgctca-----------------
A0A2K5XSA1_BIK-01      --------------------cacctgctgctca-----------------
A0A096NKG5_BIK-01      --------------------cacctgctgctca-----------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------cacctgctgctca-----------------
A0A2R8ZXD2_BIK-01      --------------------cacctgctgctca-----------------
H2QLU7_BIK-01          --------------------cacctgctgctca-----------------
H0XAE7_BIK-01          --------------------cacctgctgctca-----------------
A0A2K6FM79_BIK-01      --------------------cacctgctgctca-----------------
Q925D2_BIK-01          --------------------catttgcagcttc-----------------
O70337_BIK-04          --------------------tatttgcagcttc-----------------
O70337_BIK-02          --------------------tatttgcagcttc-----------------
O70337_BIK-01          --------------------tatttgcagcttc-----------------
A0A3Q2LHE3_BIK-02      --------------------ccattcctcctcctgcctgttccctgggcc
A0A3Q2LHE3_BIK-01      --------------------ccattcctcctcctgcctgttccctgggcc
A0A452QUG1_BIK-01      --------------------ttccgcctcctcc-----------------
A0A452V3L2_BIK-01      --------------------tcctgcccactcccagctgccccgtccggc
                                                                         

W5QCU2_BIK-01          ----------------------------
G1TZR9_BIK-01          -----------------------gctga
A0A1S3FUQ7_BIK-01      -----------------------agtga
H0W025_BIK-01          -----------------------agtga
I3LVX0_BIK-01          -----------------------agtga
A0A2K5QXZ1_BIK-01      -----------------------agtga
A0A2K6TBD7_BIK-01      -----------------------agtga
F7FUT7_BIK-02          -----------------------agtga
A0A2K5CLG5_BIK-01      -----------------------agtga
F7FUT7_BIK-01          -----------------------agtga
G1S1X2_BIK-01          -----------------------attga
A0A2K6MCW0_BIK-01      -----------------------agtga
A0A2K6QK74_BIK-01      -----------------------agtga
A0A2K5J4Q7_BIK-01      -----------------------agtga
A0A0D9QZY8_BIK-01      -----------------------agtga
A0A2K5VW94_BIK-01      -----------------------agtga
A0A2K6DBJ4_BIK-01      -----------------------agtga
A0A2K5LDM6_BIK-01      -----------------------agtga
A0A2K5XSA1_BIK-01      -----------------------agtga
A0A096NKG5_BIK-01      -----------------------agtga
H2P4N6_BIK-01          ------------------------gtaa
G3QCT2_BIK-01          -----------------------agtga
A0A2R8ZXD2_BIK-01      -----------------------agtga
H2QLU7_BIK-01          -----------------------agtga
H0XAE7_BIK-01          -----------------------agtga
A0A2K6FM79_BIK-01      -----------------------agtga
Q925D2_BIK-01          -----------------------agtga
O70337_BIK-04          -----------------------agtga
O70337_BIK-02          -----------------------agtga
O70337_BIK-01          -----------------------agtga
A0A3Q2LHE3_BIK-02      tttgggtttgagatggctggcttactga
A0A3Q2LHE3_BIK-01      tttgggtttgagatggctggcttactga
A0A452QUG1_BIK-01      -----------------------agtga
A0A452V3L2_BIK-01      cctca----------------cgactga
                                                   

© 1998-2020Legal notice