Dataset for CDS BCL2L11 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

134 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB6_BCL2L11-01       gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB6_BCL2L11-02       gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB6_BCL2L11-01       gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB6_BCL2L11-02       gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB6_BCL2L11-01       gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB6_BCL2L11-02       gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB6_BCL2L11-01       cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB6_BCL2L11-02       cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB6_BCL2L11-01       ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB6_BCL2L11-02       ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ------acacgcccggcggggggccgggccggcggcgcgcgcaggggaac
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB6_BCL2L11-01       gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB6_BCL2L11-02       gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       -----------------------------atgttcccggcggcggcggcc
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ccgtccgggccacccccgcctttacctgttggagcctgagcgcgccagcc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB6_BCL2L11-01       agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB6_BCL2L11-02       agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccggac
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       gctgcggcgcggcggggcggggcggggcgtcgggcccgcgcggcggggcg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB6_BCL2L11-01       ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB6_BCL2L11-02       ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ggctcgcggcggcgggcgggctgccagtggccggctctgcgctgccccgg
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ggacctggcgggggcggagctcgcggcgattggctgagggcgcggggccg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       -----------------------------------ggcggcgctggtaaa
A0A3Q2U844_BCL2L11      -----------------------------------atggccaagcagccc
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------atgttcccggcggcggcg
A0A3Q2GRS5_BCL2L11      --------------------------------atgttcccggcggcggcg
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      -----------------------------atgttcccggcggctgcgacc
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB6_BCL2L11-01       ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB6_BCL2L11-02       ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       gggctctgaaggcgagtcccaggctttgtctcccgcgcttctttcgtgct
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ccagtctgagcggagctgcagggctgtgcaggtttcacttcgctccgcgc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       -atggggcgggcagggcgcgggccgggagctgcacaatcagtgcaggcgc
U3IW89_BCL2L11-01       cacggggcggggacgggacgggacgggag--gggcgggcagcggcag---
A0A3Q2U844_BCL2L11      cccgaggcgaaggcgccccgcgaccgccg--ggccgggcggctgccgccg
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccc
A0A3Q2GRS5_BCL2L11      gccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccc
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      -------------------------------------atgcccgcgcgtg
A0A2R8M6L7_BCL2L11      cgggccgcgagggccagaggggcagcgcgcggagccgtcggctgcccggc
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB6_BCL2L11-01       agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB6_BCL2L11-02       agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       gagggtcagggagctccgggtcggcgaaggacgcgagcgggacgccgcgg
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       agcctccaggtctgggtcttgcgagagggctccgtcccgcgtcgccgccg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       cgcgccgcgtcccagccttttgtcccgtggcgggggggtccgagcgcgcg
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      ggagaggggccgggcccggccgtcccgctgcggcccggagcccccgccgc
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tgcggagcgcggcggcggcgggcgggcggcaagcggcaggctctgcgctg
A0A3Q2GRS5_BCL2L11      tgcggagcgcggcggcggcgggcgggcggcaagcggcaggctctgcgctg
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tgtgtgcaccagtttcacaagctgttgacattgttactgtcttttgtttg
A0A2R8M6L7_BCL2L11      ggagcgcagcggcgggctggccggaaggcgtgggctctgtgctgcgccgg
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB6_BCL2L11-01       ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB6_BCL2L11-02       ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ggctcgggcccggacgcgacggtcggaagggaaggggcggacaaaaaaag
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ccgccgccgccgccaccggattctcacagtcgccctacgcgccccagccc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gctgcccgattcc--------------------cagctccggccggggcg
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      gctgcccggcgccgcccggcccgcctcgcccggcagccccggcccgttcg
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tcctggcgcctctgagcgcgagtcccgggctttgtctcccccgctgccta
A0A3Q2GRS5_BCL2L11      tcctggcgcctctgagcgcgagtcccgggctttgtctcccccgctgccta
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      gggttacgaagtttagtcccaccctctaccaaacaaaaattatgtcttta
A0A2R8M6L7_BCL2L11      ggactctgaacccgagtcccgggctttgtctcctgcattgtcttcgtggt
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB6_BCL2L11-01       tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB6_BCL2L11-02       tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       accaa---------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       actgcggccagcatcgccacgggctgctcgctttg---------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------atgtttgattcgtccagaccacaa
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gactcggagcgccggggtctggctgaggaattgctcttggagcctgactc
U3IW89_BCL2L11-01       -----------------------------------ccccgagc-gcggtc
A0A3Q2U844_BCL2L11      ccatccgctcgccgctcttc-------------ttcttcgtgcggaggtc
G1MV54_BCL2L11-01       ----------------tttt-------------tgctctgtgc-------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      ---------------atgccgctcagcgtgcggagttacttgtggatttg
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      agtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacg
A0A3Q2GRS5_BCL2L11      agtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacg
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ttattttag-----------------------------------------
A0A2R8M6L7_BCL2L11      gacggtcaggggccgccgggtcggcgaaaggcgcgggtcggacgccgtgg
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB6_BCL2L11-01       gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB6_BCL2L11-02       gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       -------ccccgctcccgccgccacccctttggcgccctttccttggccc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      ---------------------------------------------agaga
A0A3P8XIA2_BCL2L11      aatcggtccaatggcacgaccaccctaattgggagagggaaaatcggaga
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gcttttgttcagacaaagcctttctgcgagttactctttggacgcaggaa
U3IW89_BCL2L11-01       gccgctgct--gtcgcgctcctccagcggctacttct-------------
A0A3Q2U844_BCL2L11      cccgctgct--gccgcgctcctccagcgggtacttct-------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      gctggggtcgccaggagccggcttgggggaccttgctcccattcggagaa
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ccgcggggcccgggcccggacgcgacgctcggaagggaaggggcggataa
A0A3Q2GRS5_BCL2L11      ccgcggggcccgggcccggacgcgacgctcggaagggaaggggcggataa
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ------------------------------------------------aa
A0A2R8M6L7_BCL2L11      tgccccgtcccgggccagaacgctgcgctctgaagggaaggctcggacaa
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB6_BCL2L11-01       ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB6_BCL2L11-02       ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       tcgtcccccccaatgtctgactctgactctcggactgagaaacgcaagaa
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      -----------atgtctgac-------------------------acgtc
B2KKY9_BCL2L11-01       -----------atgtctgac-------------------------acgtc
B8JK68_BCL2L11-01       -----------atgtctgac-------------------------acgtc
A0A3B3QC78_BCL2L11      -----------atgggacaaattctattaacgatcccctgctctgtct--
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      -------------------------------------gcgaacagaacac
A0A3Q3B113_BCL2L11      ---------------------------------atgcgtagtccatcc--
A0A3Q2SZH6_BCL2L11      -----------atg----------------gtgacgctctgttcatccaa
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      -----------atg----------ctcacggtgacgctctgttcatccaa
A0A3B5QAM1_BCL2L11      -----------atg----------c--------actcttta---------
A0A3B5QAM1_BCL2L11      -----------atg----------ctcacggtgacgctctgttcatccaa
A0A3B3VNE0_BCL2L11      -----------atg----------c--------actcttca---------
A0A3B3YII5_BCL2L11      -----------atg----------c--------actcttta---------
A0A3B3YII5_BCL2L11      -----------atg----------c--------actcttta---------
A0A3Q3ESW6_BCL2L11      -----------atgcaccgtccgtc-------------------------
A0A3Q1ICY2_BCL2L11      -----------atggatcc-------------------------------
A0A3B4V919_BCL2L11      -----------atgaaagcccaggctgacggtgccgctctattcatccaa
A0A3B4XZH1_BCL2L11      -----------atgaaagcccaggctgacggtgccgctctattcatccaa
A0A3Q3SYA1_BCL2L11      -----------atg------------------------------------
A0A3Q3K6I5_BCL2L11      -----------atgca---------------------cctatc-------
A0A3P8XIA2_BCL2L11      gtc-----------------------------------------------
A0A3P8XIA2_BCL2L11      gtcgcatccctgtggcggag----------------------caacctcg
A0A3B4BVX1_BCL2L11      ---------------------------------------------atg--
A0A3B4BVX1_BCL2L11      ------------------------------------------cttctg--
M3XHJ5_BCL2L11-01       -----------atgccaacagaggaaagttta----------caatttga
A0A3B1JXK6_BCL2L11      -----------atgtccagaccgtcaaaccgggccacccgcccaccct--
R4G9R5_BCL2L11-01       -----------atg------------------------------------
K7GA86_BCL2L11-01       aaggcgaccaaatggcaaag----------------------caacct--
U3IW89_BCL2L11-01       ---------------------------------------------cct--
A0A3Q2U844_BCL2L11      ---------------------------------------------cct--
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       -----------atggccaag----------------------caacct--
G3W979_BCL2L11-01       -----------atggcaaag----------------------caaccg--
F7CXT2_BCL2L11-02       -----------atggcaaaa----------------------caaccg--
F7CXT2_BCL2L11-01       -----------atggcaaaa----------------------caaccg--
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       -----------atggcaaag----------------------caacct--
G1SSY0_BCL2L11-01       -----------atggccaag----------------------caacct--
G1SSY0_BCL2L11-02       -----------atggccaag----------------------caacct--
A0A1U8BW10_BCL2L11      -----------atggccaag----------------------caacct--
A0A1U8BW10_BCL2L11      -----------atggccaag----------------------caacct--
A0A1U8BW10_BCL2L11      -----------atggccaag----------------------caacct--
O54918_BCL2L11-03       -----------atggccaag----------------------caacct--
O54918_BCL2L11-01       -----------atggccaag----------------------caacct--
O88498_BCL2L11-01       -----------atggccaag----------------------caacct--
A0A3Q1MV27_BCL2L11      -----------atggcaaag----------------------caacct--
A0A3Q1MV27_BCL2L11      aaaaagaccaaatggcaaag----------------------caacct--
L8IVA4_BCL2L11-02       -----------atggcaaag----------------------caacct--
L8IVA4_BCL2L11-01       -----------atggcaaag----------------------caacct--
W5PY58_BCL2L11-01       -----------atggcaaag----------------------caacct--
A0A452FCR6_BCL2L11      -----------atggcaaag----------------------caacct--
A0A452FCR6_BCL2L11      -----------atggcaaag----------------------caacct--
A0A3Q2GRS5_BCL2L11      -----------atggccaaa----------------------caacct--
A0A3Q2GRS5_BCL2L11      -----------atggccaaa----------------------caacct--
A0A3Q2GRS5_BCL2L11      -----------atggccaaa----------------------caacct--
A0A3Q2GRS5_BCL2L11      aaaaagaccaaatggccaaa----------------------caacct--
A0A3Q2GRS5_BCL2L11      aaaaagaccaaatggccaaa----------------------caacct--
J9NWV6_BCL2L11-06       -----------atggcaaag----------------------caacct--
A0A2K6TRU4_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2I3GVB2_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2R9C366_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5CA89_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5Z7V3_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6KJP8_BCL2L11      -----------atggcaaag----------------------caacct--
A0A286XJN2_BCL2L11      -----------atggccaag----------------------caacct--
A0A286XJN2_BCL2L11      -----------atggccaag----------------------caacct--
A0A286XJN2_BCL2L11      -----------atggccaag----------------------caacct--
H0XW23_BCL2L11-01       -----------atggcaaag----------------------caacct--
A0A1U7T0R1_BCL2L11      -----------atggcaaag----------------------caacct--
A0A1U7T0R1_BCL2L11      -----------atggcaaag----------------------caacct--
A0A1U7T0R1_BCL2L11      -----------atggcaaag----------------------caacct--
A0A1U7T0R1_BCL2L11      -----------atggcaaag----------------------caacct--
A0A1U7T0R1_BCL2L11      -----------atggcaaag----------------------caacct--
A0A1U7T0R1_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6GE31_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6GE31_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2R8M6L7_BCL2L11      aaagagaccaaatggcaaag----------------------caacct--
A0A2R8M6L7_BCL2L11      aaagagaccaaatggcaaag----------------------caacct--
H2P5E2_BCL2L11-01       -----------atggcaaag----------------------caacct--
A0A2K5Q1Y0_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2R8M6L7_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6TRU4_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5CA89_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5Q1Y0_BCL2L11      -----------atggcaaag----------------------caacct--
Q6JTU4_BCL2L11-01       -----------atg------------------------------------
A0A2I3SN61_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2I3GVB2_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2R9C366_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2I3SN61_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5HZI5_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6QIL2_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2I2YQ13_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6QIL2_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5HZI5_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2I2YQ13_BCL2L11      -----------atggcaaag----------------------caacct--
A0A096NYC3_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5NU92_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5X1Y3_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6E212_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5Z7V3_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6KJP8_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5X1Y3_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K6E212_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2K5NU92_BCL2L11      -----------atggcaaag----------------------caacct--
A0A096NYC3_BCL2L11      -----------atggcaaag----------------------caacct--
A0A0D9RWE0_BCL2L11      -----------atggcaaag----------------------caacct--
A0A287DFJ0_BCL2L11      -----------atggcaaag----------------------caacct--
A0A287DFJ0_BCL2L11      -----------atggcaaag----------------------caacct--
G3SU55_BCL2L11-01       -----------atggcaaag----------------------caacct--
C1KGB6_BCL2L11-03       aaaaagaccaaatggcaaag----------------------caacct--
C1KGB6_BCL2L11-01       aaaaagaccaaatggcaaag----------------------caacct--
C1KGB6_BCL2L11-02       aaaaagaccaaatggcaaag----------------------caacct--
C1KGB8_BCL2L11-01       -----------atggcaaag----------------------caacct--
A0A250YBV9_BCL2L11      -----------atggcaaag----------------------caacct--
A0A250YBV9_BCL2L11      -----------atggcaaag----------------------caacct--
A0A1S3FFM9_BCL2L11      -----------atggcaaag----------------------caacct--
A0A1S3FFM9_BCL2L11      -----------atggcaaag----------------------caacct--
A0A452U4S4_BCL2L11      -----------atggcaaag----------------------caacct--
U6CTE3_BCL2L11-04       -----------atggcaaag----------------------caacct--
M3YDI3_BCL2L11-01       -----------atggcaaag----------------------caacct--
U6CTE3_BCL2L11-01       -----------atggcaaag----------------------caacct--
U6CTE3_BCL2L11-03       -----------atggcaaag----------------------caacct--
U6CTE3_BCL2L11-02       -----------atggcaaag----------------------caacct--
J9NWV6_BCL2L11-05       -----------atggcaaag----------------------caacct--
J9NWV6_BCL2L11-04       -----------atggcaaag----------------------caacct--
J9NWV6_BCL2L11-02       -----------atggcaaag----------------------caacct--
J9NWV6_BCL2L11-03       -----------atggcaaag----------------------caacct--
G1LDR8_BCL2L11-01       -----------atggcaaag----------------------caacct--
A0A452SBG5_BCL2L11      -----------atggcaaag----------------------caacct--
J9NWV6_BCL2L11-01       aaaaagaccaaatggcaaag----------------------caacct--
A0A2I2UX96_BCL2L11      -----------atggcaaag----------------------caacct--
A0A2I2UX96_BCL2L11      -----------atggcaaag----------------------caacct--
                                                                          

A0A3G3M2M0_BCL2L11      cagagagcaaacgccgggtaatg---------------------------
B2KKY9_BCL2L11-01       cagagagcaaacgctggccaatg---------------------------
B8JK68_BCL2L11-01       cagagagcaaacgctggccaatg---------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      ----------agctccagcgctg---------------------------
A0A3Q1CI15_BCL2L11      ----cctacaaagtccggtcctg---------------------------
A0A3P8RLE2_BCL2L11      ctagtttagtaggacctgaacag---------------------------
A0A3Q3B113_BCL2L11      -agaccgccaaatctgcgcgatg---------------------------
A0A3Q2SZH6_BCL2L11      cagaccgccaaatctgcgcgatg---------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      cagaccgccaaatctgctcgatg---------------------------
A0A3B5QAM1_BCL2L11      -agaccgccaaatctgctcgatg---------------------------
A0A3B5QAM1_BCL2L11      cagaccgccaaatctgctcgatg---------------------------
A0A3B3VNE0_BCL2L11      -agaccgccaaatctgctcgatg---------------------------
A0A3B3YII5_BCL2L11      -agaccgccaaatctgctcgatg---------------------------
A0A3B3YII5_BCL2L11      -agaccgccaaatctgctcgatg---------------------------
A0A3Q3ESW6_BCL2L11      cagaccaccgaaccggttggatg---------------------------
A0A3Q1ICY2_BCL2L11      tagacaaccaaaccgctccgatg---------------------------
A0A3B4V919_BCL2L11      cagaccacaaaaccggtccgatg---------------------------
A0A3B4XZH1_BCL2L11      cagaccacaaaaccggtccgatg---------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      tagaccaccaaaccgctccgatg---------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      agttccaaactgtcagattaccccca------------------------
A0A3B4BVX1_BCL2L11      ---------------------cagaa----------cagtaattactgct
A0A3B4BVX1_BCL2L11      ----------------tccgccagaaaagctcgtttcagtgtttgcccgt
M3XHJ5_BCL2L11-01       caaagaccaaggtacatcagatgtaa------------------------
A0A3B1JXK6_BCL2L11      ----------------tcttaaagga------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       ----------------tctgatctga------------------------
U3IW89_BCL2L11-01       ----------------tc--------------------------------
A0A3Q2U844_BCL2L11      ----------------tc--------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       ----------------tccgacctaa------------------------
G3W979_BCL2L11-01       ----------------tcagatctaa------------------------
F7CXT2_BCL2L11-02       ----------------tcagatctaa------------------------
F7CXT2_BCL2L11-01       ----------------tcagatctaa------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       ----------------tctgatgtaa------------------------
G1SSY0_BCL2L11-01       ----------------tccgatgtaa------------------------
G1SSY0_BCL2L11-02       ----------------tccgatgtaa------------------------
A0A1U8BW10_BCL2L11      ----------------tctgatgtaa------------------------
A0A1U8BW10_BCL2L11      ----------------tctgatgtaa------------------------
A0A1U8BW10_BCL2L11      ----------------tctgatgtaa------------------------
O54918_BCL2L11-03       ----------------tctgatgtaa------------------------
O54918_BCL2L11-01       ----------------tctgatgtaa------------------------
O88498_BCL2L11-01       ----------------tctgatgtaa------------------------
A0A3Q1MV27_BCL2L11      ----------------tccgatgtaa------------------------
A0A3Q1MV27_BCL2L11      ----------------tccgatgtaa------------------------
L8IVA4_BCL2L11-02       ----------------tccgatgtaa------------------------
L8IVA4_BCL2L11-01       ----------------tccgatgtaa------------------------
W5PY58_BCL2L11-01       ----------------tccgatgtaa------------------------
A0A452FCR6_BCL2L11      ----------------tccgatgtaa------------------------
A0A452FCR6_BCL2L11      ----------------tccgatgtaa------------------------
A0A3Q2GRS5_BCL2L11      ----------------tccgatgtaa------------------------
A0A3Q2GRS5_BCL2L11      ----------------tccgatgtaa------------------------
A0A3Q2GRS5_BCL2L11      ----------------tccgatgtaa------------------------
A0A3Q2GRS5_BCL2L11      ----------------tccgatgtaa------------------------
A0A3Q2GRS5_BCL2L11      ----------------tccgatgtaa------------------------
J9NWV6_BCL2L11-06       ----------------tcagatgtaa------------------------
A0A2K6TRU4_BCL2L11      ----------------tccgatgtaa------------------------
A0A2I3GVB2_BCL2L11      ----------------tctgatgtaa------------------------
A0A2R9C366_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K5CA89_BCL2L11      ----------------tccgatgtaa------------------------
A0A2K5Z7V3_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K6KJP8_BCL2L11      ----------------tctgatgtaa------------------------
A0A286XJN2_BCL2L11      ----------------tccgatgtaa------------------------
A0A286XJN2_BCL2L11      ----------------tccgatgtaa------------------------
A0A286XJN2_BCL2L11      ----------------tccgatgtaa------------------------
H0XW23_BCL2L11-01       ----------------tcagatgtag------------------------
A0A1U7T0R1_BCL2L11      ----------------tccgttgtaa------------------------
A0A1U7T0R1_BCL2L11      ----------------tccgttgtaa------------------------
A0A1U7T0R1_BCL2L11      ----------------tccgttgtaa------------------------
A0A1U7T0R1_BCL2L11      ----------------tccgttgtaa------------------------
A0A1U7T0R1_BCL2L11      ----------------tccgttgtaa------------------------
A0A1U7T0R1_BCL2L11      ----------------tccgttgtaa------------------------
A0A2K6GE31_BCL2L11      ----------------tccgatgtag------------------------
A0A2K6GE31_BCL2L11      ----------------tccgatgtag------------------------
A0A2R8M6L7_BCL2L11      ----------------tccgatgtaa------------------------
A0A2R8M6L7_BCL2L11      ----------------tccgatgtaa------------------------
H2P5E2_BCL2L11-01       ----------------tctgatgtaa------------------------
A0A2K5Q1Y0_BCL2L11      ----------------tccgatgtaa------------------------
A0A2R8M6L7_BCL2L11      ----------------tccgatgtaa------------------------
A0A2K6TRU4_BCL2L11      ----------------tccgatgtaa------------------------
A0A2K5CA89_BCL2L11      ----------------tccgatgtaa------------------------
A0A2K5Q1Y0_BCL2L11      ----------------tccgatgtaa------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      ----------------tctgatgtaa------------------------
A0A2I3GVB2_BCL2L11      ----------------tctgatgtaa------------------------
A0A2R9C366_BCL2L11      ----------------tctgatgtaa------------------------
A0A2I3SN61_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K5HZI5_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K6QIL2_BCL2L11      ----------------tctgatgtaa------------------------
A0A2I2YQ13_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K6QIL2_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K5HZI5_BCL2L11      ----------------tctgatgtaa------------------------
A0A2I2YQ13_BCL2L11      ----------------tctgatgtaa------------------------
A0A096NYC3_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K5NU92_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K5X1Y3_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K6E212_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K5Z7V3_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K6KJP8_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K5X1Y3_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K6E212_BCL2L11      ----------------tctgatgtaa------------------------
A0A2K5NU92_BCL2L11      ----------------tctgatgtaa------------------------
A0A096NYC3_BCL2L11      ----------------tctgatgtaa------------------------
A0A0D9RWE0_BCL2L11      ----------------tctgatgtaa------------------------
A0A287DFJ0_BCL2L11      ----------------tccgatgtaa------------------------
A0A287DFJ0_BCL2L11      ----------------tccgatgtaa------------------------
G3SU55_BCL2L11-01       ----------------tcagatgtaa------------------------
C1KGB6_BCL2L11-03       ----------------tccgatgtaa------------------------
C1KGB6_BCL2L11-01       ----------------tccgatgtaa------------------------
C1KGB6_BCL2L11-02       ----------------tccgatgtaa------------------------
C1KGB8_BCL2L11-01       ----------------tccgatgtaa------------------------
A0A250YBV9_BCL2L11      ----------------tccgatgcaa------------------------
A0A250YBV9_BCL2L11      ----------------tccgatgcaa------------------------
A0A1S3FFM9_BCL2L11      ----------------tccgatgtaa------------------------
A0A1S3FFM9_BCL2L11      ----------------tccgatgtaa------------------------
A0A452U4S4_BCL2L11      ----------------tcagatgtaa------------------------
U6CTE3_BCL2L11-04       ----------------tcagatgtaa------------------------
M3YDI3_BCL2L11-01       ----------------tcagatgtaa------------------------
U6CTE3_BCL2L11-01       ----------------tcagatgtaa------------------------
U6CTE3_BCL2L11-03       ----------------tcagatgtaa------------------------
U6CTE3_BCL2L11-02       ----------------tcagatgtaa------------------------
J9NWV6_BCL2L11-05       ----------------tcagatgtaa------------------------
J9NWV6_BCL2L11-04       ----------------tcagatgtaa------------------------
J9NWV6_BCL2L11-02       ----------------tcagatgtaa------------------------
J9NWV6_BCL2L11-03       ----------------tcagatgtaa------------------------
G1LDR8_BCL2L11-01       ----------------tcagatgtaa------------------------
A0A452SBG5_BCL2L11      ----------------tcagatgtaa------------------------
J9NWV6_BCL2L11-01       ----------------tcagatgtaa------------------------
A0A2I2UX96_BCL2L11      ----------------tcagatgtaa------------------------
A0A2I2UX96_BCL2L11      ----------------tcagatgtaa------------------------
                                                                          

A0A3G3M2M0_BCL2L11      tcccg---------------------------------------------
B2KKY9_BCL2L11-01       gcccg---------------------------------------------
B8JK68_BCL2L11-01       gcccg---------------------------------------------
A0A3B3QC78_BCL2L11      gttct---------------------------------------------
A0A3Q1ELG4_BCL2L11      cttca---------------------------------------------
A0A3Q1CI15_BCL2L11      acgca---------------------------------------------
A0A3P8RLE2_BCL2L11      aagaa---------------------------------------------
A0A3Q3B113_BCL2L11      gctcg---------------------------------------------
A0A3Q2SZH6_BCL2L11      gctct---------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      gctcg---------------------------------------------
A0A3B5QAM1_BCL2L11      gctcg---------------------------------------------
A0A3B5QAM1_BCL2L11      gctcg---------------------------------------------
A0A3B3VNE0_BCL2L11      gctcg---------------------------------------------
A0A3B3YII5_BCL2L11      gctcg---------------------------------------------
A0A3B3YII5_BCL2L11      gctcg---------------------------------------------
A0A3Q3ESW6_BCL2L11      gctcg---------------------------------------------
A0A3Q1ICY2_BCL2L11      gctcg---------------------------------------------
A0A3B4V919_BCL2L11      gctcg---------------------------------------------
A0A3B4XZH1_BCL2L11      gctcg---------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      gctcg---------------------------------------------
A0A3P8XIA2_BCL2L11      ttcct---------------------------------------------
A0A3P8XIA2_BCL2L11      gtcct---------------------------------------------
A0A3B4BVX1_BCL2L11      gtttt---------------------------------------------
A0A3B4BVX1_BCL2L11      gttcttctccggaggaccgtatacatcaccttcctcattatctgcggtca
M3XHJ5_BCL2L11-01       tttct---------------------------------------------
A0A3B1JXK6_BCL2L11      gcagg---------------------------------------------
R4G9R5_BCL2L11-01       ---ct---------------------------------------------
K7GA86_BCL2L11-01       attca---------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       attct---------------------------------------------
G3W979_BCL2L11-01       attct---------------------------------------------
F7CXT2_BCL2L11-02       attct---------------------------------------------
F7CXT2_BCL2L11-01       attct---------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       gttct---------------------------------------------
G1SSY0_BCL2L11-01       gttct---------------------------------------------
G1SSY0_BCL2L11-02       gttct---------------------------------------------
A0A1U8BW10_BCL2L11      gttct---------------------------------------------
A0A1U8BW10_BCL2L11      gttct---------------------------------------------
A0A1U8BW10_BCL2L11      gttct---------------------------------------------
O54918_BCL2L11-03       gttct---------------------------------------------
O54918_BCL2L11-01       gttct---------------------------------------------
O88498_BCL2L11-01       attct---------------------------------------------
A0A3Q1MV27_BCL2L11      gttct---------------------------------------------
A0A3Q1MV27_BCL2L11      gttct---------------------------------------------
L8IVA4_BCL2L11-02       gttct---------------------------------------------
L8IVA4_BCL2L11-01       gttct---------------------------------------------
W5PY58_BCL2L11-01       gttct---------------------------------------------
A0A452FCR6_BCL2L11      gttct---------------------------------------------
A0A452FCR6_BCL2L11      gttct---------------------------------------------
A0A3Q2GRS5_BCL2L11      gttct---------------------------------------------
A0A3Q2GRS5_BCL2L11      gttct---------------------------------------------
A0A3Q2GRS5_BCL2L11      gttct---------------------------------------------
A0A3Q2GRS5_BCL2L11      gttct---------------------------------------------
A0A3Q2GRS5_BCL2L11      gttct---------------------------------------------
J9NWV6_BCL2L11-06       gttct---------------------------------------------
A0A2K6TRU4_BCL2L11      gttct---------------------------------------------
A0A2I3GVB2_BCL2L11      gttct---------------------------------------------
A0A2R9C366_BCL2L11      gttct---------------------------------------------
A0A2K5CA89_BCL2L11      gttct---------------------------------------------
A0A2K5Z7V3_BCL2L11      gttct---------------------------------------------
A0A2K6KJP8_BCL2L11      gttct---------------------------------------------
A0A286XJN2_BCL2L11      gttgt---------------------------------------------
A0A286XJN2_BCL2L11      gttgt---------------------------------------------
A0A286XJN2_BCL2L11      gttgt---------------------------------------------
H0XW23_BCL2L11-01       gttct---------------------------------------------
A0A1U7T0R1_BCL2L11      gttct---------------------------------------------
A0A1U7T0R1_BCL2L11      gttct---------------------------------------------
A0A1U7T0R1_BCL2L11      gttct---------------------------------------------
A0A1U7T0R1_BCL2L11      gttct---------------------------------------------
A0A1U7T0R1_BCL2L11      gttct---------------------------------------------
A0A1U7T0R1_BCL2L11      gttct---------------------------------------------
A0A2K6GE31_BCL2L11      gttct---------------------------------------------
A0A2K6GE31_BCL2L11      gttct---------------------------------------------
A0A2R8M6L7_BCL2L11      gttct---------------------------------------------
A0A2R8M6L7_BCL2L11      gttct---------------------------------------------
H2P5E2_BCL2L11-01       gttct---------------------------------------------
A0A2K5Q1Y0_BCL2L11      gttct---------------------------------------------
A0A2R8M6L7_BCL2L11      gttct---------------------------------------------
A0A2K6TRU4_BCL2L11      gttct---------------------------------------------
A0A2K5CA89_BCL2L11      gttct---------------------------------------------
A0A2K5Q1Y0_BCL2L11      gttct---------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      gttct---------------------------------------------
A0A2I3GVB2_BCL2L11      gttct---------------------------------------------
A0A2R9C366_BCL2L11      gttct---------------------------------------------
A0A2I3SN61_BCL2L11      gttct---------------------------------------------
A0A2K5HZI5_BCL2L11      gttct---------------------------------------------
A0A2K6QIL2_BCL2L11      gttct---------------------------------------------
A0A2I2YQ13_BCL2L11      gttct---------------------------------------------
A0A2K6QIL2_BCL2L11      gttct---------------------------------------------
A0A2K5HZI5_BCL2L11      gttct---------------------------------------------
A0A2I2YQ13_BCL2L11      gttct---------------------------------------------
A0A096NYC3_BCL2L11      gttct---------------------------------------------
A0A2K5NU92_BCL2L11      gttct---------------------------------------------
A0A2K5X1Y3_BCL2L11      gttct---------------------------------------------
A0A2K6E212_BCL2L11      gttct---------------------------------------------
A0A2K5Z7V3_BCL2L11      gttct---------------------------------------------
A0A2K6KJP8_BCL2L11      gttct---------------------------------------------
A0A2K5X1Y3_BCL2L11      gttct---------------------------------------------
A0A2K6E212_BCL2L11      gttct---------------------------------------------
A0A2K5NU92_BCL2L11      gttct---------------------------------------------
A0A096NYC3_BCL2L11      gttct---------------------------------------------
A0A0D9RWE0_BCL2L11      gttct---------------------------------------------
A0A287DFJ0_BCL2L11      gttct---------------------------------------------
A0A287DFJ0_BCL2L11      gttct---------------------------------------------
G3SU55_BCL2L11-01       gttct---------------------------------------------
C1KGB6_BCL2L11-03       gttct---------------------------------------------
C1KGB6_BCL2L11-01       gttct---------------------------------------------
C1KGB6_BCL2L11-02       gttct---------------------------------------------
C1KGB8_BCL2L11-01       gttct---------------------------------------------
A0A250YBV9_BCL2L11      gttct---------------------------------------------
A0A250YBV9_BCL2L11      gttct---------------------------------------------
A0A1S3FFM9_BCL2L11      gttct---------------------------------------------
A0A1S3FFM9_BCL2L11      gttct---------------------------------------------
A0A452U4S4_BCL2L11      gttct---------------------------------------------
U6CTE3_BCL2L11-04       gttct---------------------------------------------
M3YDI3_BCL2L11-01       gttct---------------------------------------------
U6CTE3_BCL2L11-01       gttct---------------------------------------------
U6CTE3_BCL2L11-03       gttct---------------------------------------------
U6CTE3_BCL2L11-02       gttct---------------------------------------------
J9NWV6_BCL2L11-05       gttct---------------------------------------------
J9NWV6_BCL2L11-04       gttct---------------------------------------------
J9NWV6_BCL2L11-02       gttct---------------------------------------------
J9NWV6_BCL2L11-03       gttct---------------------------------------------
G1LDR8_BCL2L11-01       gttct---------------------------------------------
A0A452SBG5_BCL2L11      gttct---------------------------------------------
J9NWV6_BCL2L11-01       gttct---------------------------------------------
A0A2I2UX96_BCL2L11      gttct---------------------------------------------
A0A2I2UX96_BCL2L11      gttct---------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      ------------------------------gcgtcgcggggaagtggaga
B2KKY9_BCL2L11-01       ------------------------------gcctcgcagggaagcggaga
B8JK68_BCL2L11-01       ------------------------------gcctcgcagggaagcggaga
A0A3B3QC78_BCL2L11      ------------------------------gcagaggacaaa----atca
A0A3Q1ELG4_BCL2L11      ------------------------------cccgcggctccacat-gcag
A0A3Q1CI15_BCL2L11      ------------------------------gcagcg--------c-gctg
A0A3P8RLE2_BCL2L11      ------------------------------gaggaa--------c-ggag
A0A3Q3B113_BCL2L11      ------------------------------accgaa----------gtaa
A0A3Q2SZH6_BCL2L11      ------------------------------accgaa----------gtaa
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      ------------------------------accgaa----------gtaa
A0A3B5QAM1_BCL2L11      ------------------------------accgaa----------gtaa
A0A3B5QAM1_BCL2L11      ------------------------------accgaa----------gtaa
A0A3B3VNE0_BCL2L11      ------------------------------accgaa----------gtaa
A0A3B3YII5_BCL2L11      ------------------------------accgaa----------gtaa
A0A3B3YII5_BCL2L11      ------------------------------accgaa----------gtaa
A0A3Q3ESW6_BCL2L11      ------------------------------cccaca----------gtaa
A0A3Q1ICY2_BCL2L11      ------------------------------acagct----------gtaa
A0A3B4V919_BCL2L11      ------------------------------accgca----------gtaa
A0A3B4XZH1_BCL2L11      ------------------------------accgca----------gtaa
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      ------------------------------accgca----------gtaa
A0A3P8XIA2_BCL2L11      ------------------------------gcgaagggaaccagcagtca
A0A3P8XIA2_BCL2L11      ------------------------------gcgaagggaaccagcagtca
A0A3B4BVX1_BCL2L11      ------------------------------gagcagggggagagt-g-gt
A0A3B4BVX1_BCL2L11      aaccgggccggccgcccagccttcttaaaggagcagggggagagt-g-gt
M3XHJ5_BCL2L11-01       ------------------------------g-------------------
A0A3B1JXK6_BCL2L11      ------------------------------gggaacgcggccaga-gcgg
R4G9R5_BCL2L11-01       ------------------------------g-----------gtc-gt--
K7GA86_BCL2L11-01       ------------------------------g-----------agt-gcga
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       ------------------------------g-----------aat-gtga
G3W979_BCL2L11-01       ------------------------------g-----------agt-gtga
F7CXT2_BCL2L11-02       ------------------------------g-----------agt-gtga
F7CXT2_BCL2L11-01       ------------------------------g-----------agt-gtga
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       ------------------------------g-----------agt-gtga
G1SSY0_BCL2L11-01       ------------------------------g-----------agt-gtga
G1SSY0_BCL2L11-02       ------------------------------g-----------agt-gtga
A0A1U8BW10_BCL2L11      ------------------------------g-----------agt-gtga
A0A1U8BW10_BCL2L11      ------------------------------g-----------agt-gtga
A0A1U8BW10_BCL2L11      ------------------------------g-----------agt-gtga
O54918_BCL2L11-03       ------------------------------g-----------agt-gtga
O54918_BCL2L11-01       ------------------------------g-----------agt-gtga
O88498_BCL2L11-01       ------------------------------g-----------agt-gtga
A0A3Q1MV27_BCL2L11      ------------------------------g-----------agt-gtga
A0A3Q1MV27_BCL2L11      ------------------------------g-----------agt-gtga
L8IVA4_BCL2L11-02       ------------------------------g-----------agt-gtga
L8IVA4_BCL2L11-01       ------------------------------g-----------agt-gtga
W5PY58_BCL2L11-01       ------------------------------g-----------agt-gtga
A0A452FCR6_BCL2L11      ------------------------------g-----------agt-gtga
A0A452FCR6_BCL2L11      ------------------------------g-----------agt-gtga
A0A3Q2GRS5_BCL2L11      ------------------------------g-----------agt-gtga
A0A3Q2GRS5_BCL2L11      ------------------------------g-----------agt-gtga
A0A3Q2GRS5_BCL2L11      ------------------------------g-----------agt-gtga
A0A3Q2GRS5_BCL2L11      ------------------------------g-----------agt-gtga
A0A3Q2GRS5_BCL2L11      ------------------------------g-----------agt-gtga
J9NWV6_BCL2L11-06       ------------------------------g-----------agt-gtga
A0A2K6TRU4_BCL2L11      ------------------------------g-----------agt-gtga
A0A2I3GVB2_BCL2L11      ------------------------------g-----------agt-gtga
A0A2R9C366_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5CA89_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5Z7V3_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6KJP8_BCL2L11      ------------------------------g-----------agt-gtga
A0A286XJN2_BCL2L11      ------------------------------g-----------agt-gtga
A0A286XJN2_BCL2L11      ------------------------------g-----------agt-gtga
A0A286XJN2_BCL2L11      ------------------------------g-----------agt-gtga
H0XW23_BCL2L11-01       ------------------------------g-----------agt-gtga
A0A1U7T0R1_BCL2L11      ------------------------------g-----------agt-gtga
A0A1U7T0R1_BCL2L11      ------------------------------g-----------agt-gtga
A0A1U7T0R1_BCL2L11      ------------------------------g-----------agt-gtga
A0A1U7T0R1_BCL2L11      ------------------------------g-----------agt-gtga
A0A1U7T0R1_BCL2L11      ------------------------------g-----------agt-gtga
A0A1U7T0R1_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6GE31_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6GE31_BCL2L11      ------------------------------g-----------agt-gtga
A0A2R8M6L7_BCL2L11      ------------------------------g-----------agt-gtga
A0A2R8M6L7_BCL2L11      ------------------------------g-----------agt-gtga
H2P5E2_BCL2L11-01       ------------------------------g-----------agt-gtga
A0A2K5Q1Y0_BCL2L11      ------------------------------g-----------agt-gtga
A0A2R8M6L7_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6TRU4_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5CA89_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5Q1Y0_BCL2L11      ------------------------------g-----------agt-gtga
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      ------------------------------g-----------agt-gtga
A0A2I3GVB2_BCL2L11      ------------------------------g-----------agt-gtga
A0A2R9C366_BCL2L11      ------------------------------g-----------agt-gtga
A0A2I3SN61_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5HZI5_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6QIL2_BCL2L11      ------------------------------g-----------agt-gtga
A0A2I2YQ13_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6QIL2_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5HZI5_BCL2L11      ------------------------------g-----------agt-gtga
A0A2I2YQ13_BCL2L11      ------------------------------g-----------agt-gtga
A0A096NYC3_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5NU92_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5X1Y3_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6E212_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5Z7V3_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6KJP8_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5X1Y3_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K6E212_BCL2L11      ------------------------------g-----------agt-gtga
A0A2K5NU92_BCL2L11      ------------------------------g-----------agt-gtga
A0A096NYC3_BCL2L11      ------------------------------g-----------agt-gtga
A0A0D9RWE0_BCL2L11      ------------------------------g-----------agt-gtga
A0A287DFJ0_BCL2L11      ------------------------------g-----------agt-gtga
A0A287DFJ0_BCL2L11      ------------------------------g-----------agt-gtga
G3SU55_BCL2L11-01       ------------------------------g-----------agt-gtga
C1KGB6_BCL2L11-03       ------------------------------g-----------agt-gtga
C1KGB6_BCL2L11-01       ------------------------------g-----------agt-gtga
C1KGB6_BCL2L11-02       ------------------------------g-----------agt-gtga
C1KGB8_BCL2L11-01       ------------------------------g-----------agt-gtga
A0A250YBV9_BCL2L11      ------------------------------g-----------agt-gtga
A0A250YBV9_BCL2L11      ------------------------------g-----------agt-gtga
A0A1S3FFM9_BCL2L11      ------------------------------g-----------agt-gtga
A0A1S3FFM9_BCL2L11      ------------------------------g-----------agt-gtga
A0A452U4S4_BCL2L11      ------------------------------g-----------agt-gtga
U6CTE3_BCL2L11-04       ------------------------------g-----------agt-gtga
M3YDI3_BCL2L11-01       ------------------------------g-----------agt-gtga
U6CTE3_BCL2L11-01       ------------------------------g-----------agt-gtga
U6CTE3_BCL2L11-03       ------------------------------g-----------agt-gtga
U6CTE3_BCL2L11-02       ------------------------------g-----------agt-gtga
J9NWV6_BCL2L11-05       ------------------------------g-----------agt-gtga
J9NWV6_BCL2L11-04       ------------------------------g-----------agt-gtga
J9NWV6_BCL2L11-02       ------------------------------g-----------agt-gtga
J9NWV6_BCL2L11-03       ------------------------------g-----------agt-gtga
G1LDR8_BCL2L11-01       ------------------------------g-----------agt-gtga
A0A452SBG5_BCL2L11      ------------------------------g-----------agt-gtga
J9NWV6_BCL2L11-01       ------------------------------g-----------agt-gtga
A0A2I2UX96_BCL2L11      ------------------------------g-----------agt-gtga
A0A2I2UX96_BCL2L11      ------------------------------g-----------agt-gtga
                                                                          

A0A3G3M2M0_BCL2L11      gagcgccggtgt------------------------cggagctgcgttgc
B2KKY9_BCL2L11-01       gagcaccggtgg------------------------cggagtggtgttgc
B8JK68_BCL2L11-01       gagcaccggtgg------------------------cggagtggtgttgc
A0A3B3QC78_BCL2L11      cacgaatggcggagagtcgcaacccag---------tggcggaacaga--
A0A3Q1ELG4_BCL2L11      acactacagagggcggcgg-----------------agcggatccagaac
A0A3Q1CI15_BCL2L11      ----cttcaccagcggct-------------------ccagatgcaga--
A0A3P8RLE2_BCL2L11      ggaacctcagaggcggcgg-----------------agcagatccagaac
A0A3Q3B113_BCL2L11      aggcaacagagggcagcag-----------------cggaggagctccac
A0A3Q2SZH6_BCL2L11      cgccaccagaggggaccgg-----------------aggagacccagcat
A0A3P9N073_BCL2L11      ----------------------------------------gacccagcat
A0A3B5M375_BCL2L11      cgccagcagaggggaccgg-----------------cggagacccagcat
A0A3B5QAM1_BCL2L11      cgccagcagaggggaccgg-----------------cggagacccagcat
A0A3B5QAM1_BCL2L11      cgccagcagaggggaccgg-----------------cggagacccagcat
A0A3B3VNE0_BCL2L11      cgccagcagaggggaccgg-----------------cggagacccagcat
A0A3B3YII5_BCL2L11      cgccagcagaggggaccgg-----------------cggagacccagcat
A0A3B3YII5_BCL2L11      cgccagcagaggggaccgg-----------------cggagacccagcat
A0A3Q3ESW6_BCL2L11      cggaatcacacgggaccag-----------------aggagatccacca-
A0A3Q1ICY2_BCL2L11      cggccacaggggagagcgg-----------------aggagacccaccac
A0A3B4V919_BCL2L11      cggcaagaggggagagcga-----------------aggggatccaccac
A0A3B4XZH1_BCL2L11      cggcaagaggggagagcga-----------------aggggatccaccac
A0A3Q3SYA1_BCL2L11      --gcaacagaggagagc--------------------ggagatccacca-
A0A3Q3K6I5_BCL2L11      cagcaacagaggagagc--------------------ggagatccaccat
A0A3P8XIA2_BCL2L11      cggggaggaataatgat----gccga----------cgaatag-------
A0A3P8XIA2_BCL2L11      cggggaggaataatgat----gccga----------cgaatag-------
A0A3B4BVX1_BCL2L11      cagagcagcggagcagcctcctcccgggccg-----ccgagcagtgcgag
A0A3B4BVX1_BCL2L11      cagagcagcggagcagcctcctcccgggccg-----ccgagcagtgcgag
M3XHJ5_BCL2L11-01       -----aatgtggacatttgcatccca----------cccaaagaccagat
A0A3B1JXK6_BCL2L11      cgggggcggcggaacattgtcccgag----------ccgagcagtgcgag
R4G9R5_BCL2L11-01       ---tggaagcagccagccacagctttgcttgcttcccaaacagctaaat-
K7GA86_BCL2L11-01       cggagaaggtggacagtttcagtcaa----------ttgaaaggccaagt
U3IW89_BCL2L11-01       ----------------------------------------gaggccgagc
A0A3Q2U844_BCL2L11      ----------------------------------------gaggccgagc
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       cagcgaaggcggacgactggagcccg----------cagaggggccggct
G3W979_BCL2L11-01       ccgtgaaggtggacaattgcagccta----------cagaaaggcctact
F7CXT2_BCL2L11-02       cagagaaggtggacaattgcagccta----------cagaaaggcctact
F7CXT2_BCL2L11-01       cagagaaggtggacaattgcagccta----------cagaaaggcctact
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       ccgagaaggtagacaattgcagcctg----------cggagag-------
G1SSY0_BCL2L11-01       cagagaaggtggacagttgcagcctg----------cggagag-------
G1SSY0_BCL2L11-02       cagagaaggtggacagttgcagcctg----------cggagag-------
A0A1U8BW10_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A1U8BW10_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A1U8BW10_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
O54918_BCL2L11-03       cagagaaggtggacaattgcagcctg----------ctgagag-------
O54918_BCL2L11-01       cagagaaggtggacaattgcagcctg----------ctgagag-------
O88498_BCL2L11-01       cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A3Q1MV27_BCL2L11      cagagaaggtggacaattgcagcctg----------ccgagag-------
A0A3Q1MV27_BCL2L11      cagagaaggtggacaattgcagcctg----------ccgagag-------
L8IVA4_BCL2L11-02       cagagaaggtggacaattgcagcctg----------ccgagag-------
L8IVA4_BCL2L11-01       cagagaaggtggacaattgcagcctg----------ccgagag-------
W5PY58_BCL2L11-01       cagagaaggtggacaattgcagcctg----------ccgagag-------
A0A452FCR6_BCL2L11      cagagaaggtggacaattgcagcctg----------ccgagag-------
A0A452FCR6_BCL2L11      cagagaaggtggacaattgcagcctg----------ccgagag-------
A0A3Q2GRS5_BCL2L11      cagagaaggcggacaattgcagcctg----------cggagag-------
A0A3Q2GRS5_BCL2L11      cagagaaggcggacaattgcagcctg----------cggagag-------
A0A3Q2GRS5_BCL2L11      cagagaaggcggacaattgcagcctg----------cggagag-------
A0A3Q2GRS5_BCL2L11      cagagaaggcggacaattgcagcctg----------cggagag-------
A0A3Q2GRS5_BCL2L11      cagagaaggcggacaattgcagcctg----------cggagag-------
J9NWV6_BCL2L11-06       cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A2K6TRU4_BCL2L11      ccgagaaggtagacagttgcagcctg----------cggagag-------
A0A2I3GVB2_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2R9C366_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5CA89_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5Z7V3_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K6KJP8_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A286XJN2_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A286XJN2_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A286XJN2_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
H0XW23_BCL2L11-01       ccgagaaggtggacaattgcaacctg----------cggagag-------
A0A1U7T0R1_BCL2L11      ccgagaagggggacaattgcagcctg----------ccgagag-------
A0A1U7T0R1_BCL2L11      ccgagaagggggacaattgcagcctg----------ccgagag-------
A0A1U7T0R1_BCL2L11      ccgagaagggggacaattgcagcctg----------ccgagag-------
A0A1U7T0R1_BCL2L11      ccgagaagggggacaattgcagcctg----------ccgagag-------
A0A1U7T0R1_BCL2L11      ccgagaagggggacaattgcagcctg----------ccgagag-------
A0A1U7T0R1_BCL2L11      ccgagaagggggacaattgcagcctg----------ccgagag-------
A0A2K6GE31_BCL2L11      ccgagaaggtggacagttgcaatctg----------tggagag-------
A0A2K6GE31_BCL2L11      ccgagaaggtggacagttgcaatctg----------tggagag-------
A0A2R8M6L7_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2R8M6L7_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
H2P5E2_BCL2L11-01       ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5Q1Y0_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2R8M6L7_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K6TRU4_BCL2L11      ccgagaaggtagacagttgcagcctg----------cggagag-------
A0A2K5CA89_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5Q1Y0_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
Q6JTU4_BCL2L11-01       ------aggcaggctg----aacctg----------cagatat-------
A0A2I3SN61_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2I3GVB2_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2R9C366_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2I3SN61_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5HZI5_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K6QIL2_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2I2YQ13_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K6QIL2_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5HZI5_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2I2YQ13_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A096NYC3_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5NU92_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5X1Y3_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K6E212_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5Z7V3_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K6KJP8_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5X1Y3_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K6E212_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A2K5NU92_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A096NYC3_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A0D9RWE0_BCL2L11      ccgagaaggtagacaattgcagcctg----------cggagag-------
A0A287DFJ0_BCL2L11      cagagaaggtggacaattgcagcctg----------cagagag-------
A0A287DFJ0_BCL2L11      cagagaaggtggacaattgcagcctg----------cagagag-------
G3SU55_BCL2L11-01       cagagaaggtggacagttacagcctg----------cggagaggcccccg
C1KGB6_BCL2L11-03       cagagaaggtggacagttgcagcctg----------cggaaag-------
C1KGB6_BCL2L11-01       cagagaaggtggacagttgcagcctg----------cggaaag-------
C1KGB6_BCL2L11-02       cagagaaggtggacagttgcagcctg----------cggaaag-------
C1KGB8_BCL2L11-01       cagagaaggtggacagttgcagcctg----------cggaaag-------
A0A250YBV9_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A250YBV9_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A1S3FFM9_BCL2L11      ccgagaaggtggacagttgcagcctg----------ctgagag-------
A0A1S3FFM9_BCL2L11      ccgagaaggtggacagttgcagcctg----------ctgagag-------
A0A452U4S4_BCL2L11      cagagaaggtggacaactgcagcctg----------ctgagag-------
U6CTE3_BCL2L11-04       ccgagaaggtggacaattgcagcctg----------ttgagag-------
M3YDI3_BCL2L11-01       ccgagaaggtggacaattgcagcctg----------ttgagag-------
U6CTE3_BCL2L11-01       ccgagaaggtggacaattgcagcctg----------ttgagag-------
U6CTE3_BCL2L11-03       ccgagaaggtggacaattgcagcctg----------ttgagag-------
U6CTE3_BCL2L11-02       ccgagaaggtggacaattgcagcctg----------ttgagag-------
J9NWV6_BCL2L11-05       cagagaaggtggacaattgcagcctg----------ctgagag-------
J9NWV6_BCL2L11-04       cagagaaggtggacaattgcagcctg----------ctgagag-------
J9NWV6_BCL2L11-02       cagagaaggtggacaattgcagcctg----------ctgagag-------
J9NWV6_BCL2L11-03       cagagaaggtggacaattgcagcctg----------ctgagag-------
G1LDR8_BCL2L11-01       cagagaaggtggacaactgcagcctg----------ctgagag-------
A0A452SBG5_BCL2L11      cagagaaggtggacaactgcagcctg----------ctgagag-------
J9NWV6_BCL2L11-01       cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A2I2UX96_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
A0A2I2UX96_BCL2L11      cagagaaggtggacaattgcagcctg----------ctgagag-------
                                                                          

A0A3G3M2M0_BCL2L11      gcccc-------------------------------------------gg
B2KKY9_BCL2L11-01       ccgcc-------------------------------------------gg
B8JK68_BCL2L11-01       ccgcc-------------------------------------------gg
A0A3B3QC78_BCL2L11      ------------------ctccgatccaagccggtccgagaaccgccaag
A0A3Q1ELG4_BCL2L11      ccgtcggtgcagctggagtctcggcgaaaacatc-------------ccg
A0A3Q1CI15_BCL2L11      -----gactcagagaggctaccgccaaatccgtc-------------cca
A0A3P8RLE2_BCL2L11      ccgtcggtgcagctggggtctcggcgaaaacatc-------------ccg
A0A3Q3B113_BCL2L11      ------------------cgtccgccggcgccgc-------------tcg
A0A3Q2SZH6_BCL2L11      ------------------cctcagcgcgaacacc-------------acg
A0A3P9N073_BCL2L11      ------------------cgtcagcgcgaacacc-------------acg
A0A3B5M375_BCL2L11      ------------------cctcagcgcgaacacc-------------acg
A0A3B5QAM1_BCL2L11      ------------------cctcagcgcgaacacc-------------acg
A0A3B5QAM1_BCL2L11      ------------------cctcagcgcgaacacc-------------acg
A0A3B3VNE0_BCL2L11      ------------------cgtcagcgcgaacacc-------------acg
A0A3B3YII5_BCL2L11      ------------------cgtcagcgcgaacacc-------------acg
A0A3B3YII5_BCL2L11      ------------------cgtcagcgcgaacacc-------------acg
A0A3Q3ESW6_BCL2L11      --------------------------caaacctc-------------ccg
A0A3Q1ICY2_BCL2L11      ccgtcggtgccgctggagtctcaacgccaacctc-------------ccg
A0A3B4V919_BCL2L11      tcgtcggtgccgctggagccccagcgcaaaaccc-------------cag
A0A3B4XZH1_BCL2L11      tcgtcggtgccgctggagccccggcgcaaaaccc-------------cag
A0A3Q3SYA1_BCL2L11      --gccggtgatcccagagtctcggcgcaaacctc-------------ccg
A0A3Q3K6I5_BCL2L11      ctgtcggtgccgctggaacctcggcgcaaagctc-------------ccg
A0A3P8XIA2_BCL2L11      ---tct------------gcttggtttccagtcg-------------agg
A0A3P8XIA2_BCL2L11      ---tct------------gcttggtttccagtcg-------------agg
A0A3B4BVX1_BCL2L11      cagcct----------------gagcccggcgag-------------ggg
A0A3B4BVX1_BCL2L11      cagcct----------------gagcccggcgag-------------ggg
M3XHJ5_BCL2L11-01       caacca------------ccgtttgtaaagcaag-------------agg
A0A3B1JXK6_BCL2L11      cagcctgagcccggcga-tggcgacccggttagg--------------gg
R4G9R5_BCL2L11-01       --gtcc------------tctctgccaatgcttt--------------tg
K7GA86_BCL2L11-01       cagcct------------cagcatcttagacctg--------------gg
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       cagccc------------ccgcagctccgacccg--------------gg
G3W979_BCL2L11-01       caacct---------------caactcagaccag--------------gg
F7CXT2_BCL2L11-02       cagcct------------caacaactcagaccag--------------gg
F7CXT2_BCL2L11-01       cagcct------------caacaactcagaccag--------------gg
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --gcct------------ccccagctcagacctg--------------gg
G1SSY0_BCL2L11-01       --gccg------------ccccagctcaggcctg--------------gg
G1SSY0_BCL2L11-02       --gccg------------ccccagctcaggcctg--------------gg
A0A1U8BW10_BCL2L11      --gcct------------ccccagctcaggcctg--------------gg
A0A1U8BW10_BCL2L11      --gcct------------ccccagctcaggcctg--------------gg
A0A1U8BW10_BCL2L11      --gcct------------ccccagctcaggcctg--------------gg
O54918_BCL2L11-03       --gcct------------ccccagctcaggcctg--------------gg
O54918_BCL2L11-01       --gcct------------ccccagctcaggcctg--------------gg
O88498_BCL2L11-01       --gcct------------ccccagctcaggcctg--------------gg
A0A3Q1MV27_BCL2L11      --gcct------------cctcagctcagacctg--------------gg
A0A3Q1MV27_BCL2L11      --gcct------------cctcagctcagacctg--------------gg
L8IVA4_BCL2L11-02       --gcct------------cctcagctcagaccgg--------------gg
L8IVA4_BCL2L11-01       --gcct------------cctcagctcagaccgg--------------gg
W5PY58_BCL2L11-01       --gcct------------cctcagctcagaccag--------------gg
A0A452FCR6_BCL2L11      --gcct------------cctcagctcagaccag--------------gg
A0A452FCR6_BCL2L11      --gcct------------cctcagctcagaccag--------------gg
A0A3Q2GRS5_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
A0A3Q2GRS5_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
A0A3Q2GRS5_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
A0A3Q2GRS5_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
A0A3Q2GRS5_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
J9NWV6_BCL2L11-06       --gcct------------cctcagctcaggcctg--------------gg
A0A2K6TRU4_BCL2L11      --acct------------ccccagctcagacctg--------------gg
A0A2I3GVB2_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2R9C366_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K5CA89_BCL2L11      --acct------------ccccagctcagacctg--------------gg
A0A2K5Z7V3_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K6KJP8_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A286XJN2_BCL2L11      --gcca------------tcccagctcagggctg--------------gg
A0A286XJN2_BCL2L11      --gcca------------tcccagctcagggctg--------------gg
A0A286XJN2_BCL2L11      --gcca------------tcccagctcagggctg--------------gg
H0XW23_BCL2L11-01       --acct------------ccccagctcaggcctg--------------gg
A0A1U7T0R1_BCL2L11      --gcct------------ccccaactcaggcctg--------------gg
A0A1U7T0R1_BCL2L11      --gcct------------ccccaactcaggcctg--------------gg
A0A1U7T0R1_BCL2L11      --gcct------------ccccaactcaggcctg--------------gg
A0A1U7T0R1_BCL2L11      --gcct------------ccccaactcaggcctg--------------gg
A0A1U7T0R1_BCL2L11      --gcct------------ccccaactcaggcctg--------------gg
A0A1U7T0R1_BCL2L11      --gcct------------ccccaactcaggcctg--------------gg
A0A2K6GE31_BCL2L11      --acct------------ccccagctcaggcctg--------------gg
A0A2K6GE31_BCL2L11      --acct------------ccccagctcaggcctg--------------gg
A0A2R8M6L7_BCL2L11      --acct------------ccccagctcagacctg--------------gg
A0A2R8M6L7_BCL2L11      --acct------------ccccagctcagacctg--------------gg
H2P5E2_BCL2L11-01       --gcct------------ccccagctcagacctg--------------gg
A0A2K5Q1Y0_BCL2L11      --acct------------ccccagctcagacctg--------------gg
A0A2R8M6L7_BCL2L11      --acct------------ccccagctcagacctg--------------gg
A0A2K6TRU4_BCL2L11      --acct------------ccccagctcagacctg--------------gg
A0A2K5CA89_BCL2L11      --acct------------ccccagctcagacctg--------------gg
A0A2K5Q1Y0_BCL2L11      --acct------------ccccagctcagacctg--------------gg
Q6JTU4_BCL2L11-01       --gc-------------------gcccaga--------------------
A0A2I3SN61_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2I3GVB2_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2R9C366_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2I3SN61_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K5HZI5_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K6QIL2_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2I2YQ13_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K6QIL2_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K5HZI5_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2I2YQ13_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A096NYC3_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K5NU92_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K5X1Y3_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K6E212_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K5Z7V3_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K6KJP8_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K5X1Y3_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K6E212_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A2K5NU92_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A096NYC3_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A0D9RWE0_BCL2L11      --gcct------------ccccagctcagacctg--------------gg
A0A287DFJ0_BCL2L11      --gcct------------ccccagctcaggccgg--------------gg
A0A287DFJ0_BCL2L11      --gcct------------ccccagctcaggccgg--------------gg
G3SU55_BCL2L11-01       cagcct------------cctcagctcaggcctg--------------gg
C1KGB6_BCL2L11-03       --gcct------------cctcagctcaggcctg--------------gg
C1KGB6_BCL2L11-01       --gcct------------cctcagctcaggcctg--------------gg
C1KGB6_BCL2L11-02       --gcct------------cctcagctcaggcctg--------------gg
C1KGB8_BCL2L11-01       --gcct------------cctcagctcaggcctg--------------gg
A0A250YBV9_BCL2L11      --gcct------------ccccagctcaggcctg--------------gg
A0A250YBV9_BCL2L11      --gcct------------ccccagctcaggcctg--------------gg
A0A1S3FFM9_BCL2L11      --gcct------------ccccagctcaggcctg--------------gg
A0A1S3FFM9_BCL2L11      --gcct------------ccccagctcaggcctg--------------gg
A0A452U4S4_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
U6CTE3_BCL2L11-04       --gcct------------cctcagctcaggcctg--------------gg
M3YDI3_BCL2L11-01       --gcct------------cctcagctcaggcctg--------------gg
U6CTE3_BCL2L11-01       --gcct------------cctcagctcaggcctg--------------gg
U6CTE3_BCL2L11-03       --gcct------------cctcagctcaggcctg--------------gg
U6CTE3_BCL2L11-02       --gcct------------cctcagctcaggcctg--------------gg
J9NWV6_BCL2L11-05       --gcct------------cctcagctcaggcctg--------------gg
J9NWV6_BCL2L11-04       --gcct------------cctcagctcaggcctg--------------gg
J9NWV6_BCL2L11-02       --gcct------------cctcagctcaggcctg--------------gg
J9NWV6_BCL2L11-03       --gcct------------cctcagctcaggcctg--------------gg
G1LDR8_BCL2L11-01       --gcct------------cctcagctcaggcctg--------------gg
A0A452SBG5_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
J9NWV6_BCL2L11-01       --gcct------------cctcagctcaggcctg--------------gg
A0A2I2UX96_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
A0A2I2UX96_BCL2L11      --gcct------------cctcagctcaggcctg--------------gg
                                                                          

A0A3G3M2M0_BCL2L11      gcactttgacttccctcagccgagcgatggggacccgttaaggggaggga
B2KKY9_BCL2L11-01       gcactttgatttccctcagccgggcgaaggggacccgttaaggggaggga
B8JK68_BCL2L11-01       gcactttgatttccctcagccgggcgaaggggacccgttaaggggaggga
A0A3B3QC78_BCL2L11      gtccctggtcaactgcaagcgaccccgcg---------------------
A0A3Q1ELG4_BCL2L11      ttcg----------------------------------------------
A0A3Q1CI15_BCL2L11      t-------------------------------------------------
A0A3P8RLE2_BCL2L11      tttg----------------------------------------------
A0A3Q3B113_BCL2L11      aggctcggcgcacgc------gacccgtccggtccgcggcagagcgccg-
A0A3Q2SZH6_BCL2L11      tttgtccaagcacagggaggggagctgcgcg--cagccgccgggcgccgt
A0A3P9N073_BCL2L11      ttcctcgaagcacacagagcggagctgcgcg--ccgcaggcgggcgcctc
A0A3B5M375_BCL2L11      ttcctcgaagcacacagagcggagccgcgcg--ccgcaggcgggcgcctc
A0A3B5QAM1_BCL2L11      ttcctcgaagcacacagagcggagccgcgcg--ccgcaggcgggcgcctc
A0A3B5QAM1_BCL2L11      ttcctcgaagcacacagagcggagccgcgcg--ccgcaggcgggcgcctc
A0A3B3VNE0_BCL2L11      ttcctcgaagcacacagagcggagctgcgcg--ccgcagacgggcgcctc
A0A3B3YII5_BCL2L11      ttcctcgaagcacacagagcggagctgcgcg--ccgcaggcgggcgcctc
A0A3B3YII5_BCL2L11      ttcctcgaagcacacagagcggagctgcgcg--ccgcaggcgggcgcctc
A0A3Q3ESW6_BCL2L11      ttcagacaacagcggggggcgaaacttt--------------ggccgcac
A0A3Q1ICY2_BCL2L11      ttcgaacgacggcggggagcggaggttt--------------ggccgccc
A0A3B4V919_BCL2L11      ttcgaaagacagcggcgagcggagcctt--------------ggccacct
A0A3B4XZH1_BCL2L11      ttcgaaagacagcggcgagcgga---------------------------
A0A3Q3SYA1_BCL2L11      ttcgaacggcggcaccgaccagagct------------------------
A0A3Q3K6I5_BCL2L11      ttcgaacggcggcagcgagcggagcttt--------------ggccaccc
A0A3P8XIA2_BCL2L11      tcgcctctttt--------cagaacaaca---------------------
A0A3P8XIA2_BCL2L11      tcgcctctttt--------cagaacaaca---------------------
A0A3B4BVX1_BCL2L11      gacccggt-----taggggagggattaca---------------------
A0A3B4BVX1_BCL2L11      gacccggt-----taggggagggattaca---------------------
M3XHJ5_BCL2L11-01       gctgctactgcattatcagcccactttca-----------aaagtgatcg
A0A3B1JXK6_BCL2L11      accccctgcgctgcacaa--------------------------------
R4G9R5_BCL2L11-01       ctatttcttgctttttataccgtgatgtg---------------------
K7GA86_BCL2L11-01       gcccctacctctatacaaacacagtacca---------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       gcacctacctctatccgaacccagtatca---------------------
G3W979_BCL2L11-01       gcccctacctctatacaaacacaatatcaaggtaattc------------
F7CXT2_BCL2L11-02       gcccctacctctatacaaacacagtatcaaggtaattc------------
F7CXT2_BCL2L11-01       gcccctacctctatacaaacacagtatca---------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       gcccctacctccctacagacagagccaca---------------------
G1SSY0_BCL2L11-01       gcccccacctccctgcagtcggagccgca---------------------
G1SSY0_BCL2L11-02       gcccccacctccctgcagtcggagccgca------------aggtaatcc
A0A1U8BW10_BCL2L11      gcccctacctccctacagacagaacagca---------------------
A0A1U8BW10_BCL2L11      gcccctacctccctacagacagaacagca---------------------
A0A1U8BW10_BCL2L11      gcccctacctccctacagacagaacagca------------aggtaatcc
O54918_BCL2L11-03       gcccctacctccctacagacagaaccgca---------------------
O54918_BCL2L11-01       gcccctacctccctacagacagaaccgca------------aggtaatcc
O88498_BCL2L11-01       gcccctacctccctacagacagaatcgca------------aggtaatcc
A0A3Q1MV27_BCL2L11      gcccccacctctttacagacagagcggca---------------------
A0A3Q1MV27_BCL2L11      gcccccacctctttacagacagagcggca---------------------
L8IVA4_BCL2L11-02       gcccccacctctttacagacagagcggca------------aggtaatcc
L8IVA4_BCL2L11-01       gcccccacctctttacagacagagcggca---------------------
W5PY58_BCL2L11-01       gcccccacctctttacagacagagcggca------------aggtaatcc
A0A452FCR6_BCL2L11      gcccccacctctttacagacagagcggca------------aggtaatcc
A0A452FCR6_BCL2L11      gcccccacctctttacagacagagcggca---------------------
A0A3Q2GRS5_BCL2L11      gcccccacctctctacagatagagcagca---------------------
A0A3Q2GRS5_BCL2L11      gcccccacctctctacagatagagcagca---------------------
A0A3Q2GRS5_BCL2L11      gcccccacctctctacagatagagcagca------------aggtaatcc
A0A3Q2GRS5_BCL2L11      gcccccacctctctacagatagagcagca---------------------
A0A3Q2GRS5_BCL2L11      gcccccacctctctacagatagagcagca------------aggtaatcc
J9NWV6_BCL2L11-06       gcccctacctctctacagacagaacagca---------------------
A0A2K6TRU4_BCL2L11      gcccctacctccctacagacagagccaca---------------------
A0A2I3GVB2_BCL2L11      gcccctacctccctacagacagagccaca---------------------
A0A2R9C366_BCL2L11      gcccctacctccctacagacagagccaca---------------------
A0A2K5CA89_BCL2L11      gcccctacctccctacagacagagccaca---------------------
A0A2K5Z7V3_BCL2L11      gcccctacctccctacagacagagccaca---------------------
A0A2K6KJP8_BCL2L11      gcccctacctccctacagacagaaccaca---------------------
A0A286XJN2_BCL2L11      gccccaacctccctacagacggagcccca------------aggtaatcc
A0A286XJN2_BCL2L11      gccccaacctccctacagacggagcccca------------aggtaatcc
A0A286XJN2_BCL2L11      gccccaacctccctacagacggagcccca---------------------
H0XW23_BCL2L11-01       gcccctacctctctacatacagagccccaaggtaatcccgaaggcaatcc
A0A1U7T0R1_BCL2L11      gcccctacctccctacagacagagccgcaag-------------------
A0A1U7T0R1_BCL2L11      gcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcc
A0A1U7T0R1_BCL2L11      gcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcc
A0A1U7T0R1_BCL2L11      gcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcc
A0A1U7T0R1_BCL2L11      gcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcc
A0A1U7T0R1_BCL2L11      gcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcc
A0A2K6GE31_BCL2L11      gcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcg
A0A2K6GE31_BCL2L11      gcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcg
A0A2R8M6L7_BCL2L11      gcccctacctccctacagacagagccaca---------------------
A0A2R8M6L7_BCL2L11      gcccctacctccctacagacagagccaca---------------------
H2P5E2_BCL2L11-01       gcccctacctccctacagacagagccaca---------------------
A0A2K5Q1Y0_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2R8M6L7_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K6TRU4_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K5CA89_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K5Q1Y0_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcctgaaggcaatca
A0A2I3GVB2_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcctgaaggcaatca
A0A2R9C366_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcctgaaggcaatca
A0A2I3SN61_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcctgaaggcaatca
A0A2K5HZI5_BCL2L11      gcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatca
A0A2K6QIL2_BCL2L11      gcccctacctccctacagacagaaccacaaggtaatcccgaagacaatca
A0A2I2YQ13_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcctgaaggcaatca
A0A2K6QIL2_BCL2L11      gcccctacctccctacagacagaaccacaaggtaatcccgaagacaatca
A0A2K5HZI5_BCL2L11      gcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatca
A0A2I2YQ13_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcctgaaggcaatca
A0A096NYC3_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K5NU92_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K5X1Y3_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K6E212_BCL2L11      gcccctacctccctacagacagagccaca---------------------
A0A2K5Z7V3_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K6KJP8_BCL2L11      gcccctacctccctacagacagaaccacaaggtaatcccgaagacaatca
A0A2K5X1Y3_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K6E212_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A2K5NU92_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A096NYC3_BCL2L11      gcccctacctccctacagacagagccacaaggtaatcccgaaggcaatca
A0A0D9RWE0_BCL2L11      gcccctacctccctacagacagagccaca---------------------
A0A287DFJ0_BCL2L11      gcccctacctcccttcagacagagcctca---------------------
A0A287DFJ0_BCL2L11      gcccctacctcccttcagacagagcctca------------aggtaatcc
G3SU55_BCL2L11-01       gcccctacctctctgctcacggagcctca------------aggtaatcc
C1KGB6_BCL2L11-03       gcccccacctctctacaaacagagcggca------------aggtaatcc
C1KGB6_BCL2L11-01       gcccccacctctctacaaacagagcggca------------aggtaatcc
C1KGB6_BCL2L11-02       gcccccacctctctacaaacagagcggca---------------------
C1KGB8_BCL2L11-01       gcccccacctctctacagacagagcggca---------------------
A0A250YBV9_BCL2L11      gctcctacctccctacagacagagccgccaggtaatcctgaaggcagtcc
A0A250YBV9_BCL2L11      gctcctacctccctacagacagagccgc----------------------
A0A1S3FFM9_BCL2L11      gcccctacctccctacagacagagcagca---------------------
A0A1S3FFM9_BCL2L11      gcccctacctccctacagacagagcagcaaggtaatcccgaaggcagtcc
A0A452U4S4_BCL2L11      gcccctacctctctacagacagagcagca---------------------
U6CTE3_BCL2L11-04       gcccctacctctctacagacagagcagca---------------------
M3YDI3_BCL2L11-01       gcccctacctctctacagacagagcagca---------------------
U6CTE3_BCL2L11-01       gcccctacctctctacagacagagcagca------------aggtaatcc
U6CTE3_BCL2L11-03       gcccctacctctctacagacagagcagca---------------------
U6CTE3_BCL2L11-02       gcccctacctctctacagacagagcagca------------aggtaatcc
J9NWV6_BCL2L11-05       gcccctacctctctacagacagaacagca---------------------
J9NWV6_BCL2L11-04       gcccctacctctctacagacagaacagca------------aggtaatcc
J9NWV6_BCL2L11-02       gcccctacctctctacagacagaacagca------------aggtaatcc
J9NWV6_BCL2L11-03       gcccctacctctctacagacagaacagca------------aggtaatcc
G1LDR8_BCL2L11-01       gcccctacctctctacagacagagcagca------------aggtaatcc
A0A452SBG5_BCL2L11      gcccctacctctctacagacagagcagca---------------------
J9NWV6_BCL2L11-01       gcccctacctctctacagacagaacagca---------------------
A0A2I2UX96_BCL2L11      gcccctacctctctacagacagagcagca------------aggtaatcc
A0A2I2UX96_BCL2L11      gcccctacctctctacagacagagcagca---------------------
                                                                          

A0A3G3M2M0_BCL2L11      ttgccatgtcgaatagtca-------------------------------
B2KKY9_BCL2L11-01       tatccatgtcgaata---a-------------------------------
B8JK68_BCL2L11-01       tatccatgtcgaata---a-------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      -aactccaccggagga----------------------------------
A0A3Q1CI15_BCL2L11      -------------ggc----------------------------------
A0A3P8RLE2_BCL2L11      -aactccaccggagga----------------------------------
A0A3Q3B113_BCL2L11      -agcgccgcgggagga----------------------------------
A0A3Q2SZH6_BCL2L11      taccgccgccggaggaggaggagg---------------------ggagc
A0A3P9N073_BCL2L11      cacagccgggggaggaggaggagg------------aggaagaggggagc
A0A3B5M375_BCL2L11      cacagccgggggaggaggaggaggagaaggagaaggacgaagaggggagc
A0A3B5QAM1_BCL2L11      cacagccgggggaggaggaggaggagagggaggaggacgaagaggggagc
A0A3B5QAM1_BCL2L11      cacagccgggggaggaggaggaggagagggaggaggacgaagaggggagc
A0A3B3VNE0_BCL2L11      cacagccgggggaggaggaggagg---aggagggggaggaggaggggagc
A0A3B3YII5_BCL2L11      cacagccgggggaggaggaggagg---gggaggaggaggaagaggggagc
A0A3B3YII5_BCL2L11      cacagccgggggaggaggaggagg---gggaggaggaggaagaggggagc
A0A3Q3ESW6_BCL2L11      cgattccacgggaggagga-------------------------------
A0A3Q1ICY2_BCL2L11      tgactccagtggaggagga-------------------------------
A0A3B4V919_BCL2L11      cggctccaccggagaagga-------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      cggctcggccggaggagga-------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       cactggtgaggtggagagacagatctttactcagcaccctgatgggagga
A0A3B1JXK6_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       ---aggtgaag----gggacagctgctcacctagcagccctcagggaccg
F7CXT2_BCL2L11-02       ---aggtgaag----gggacagctgctcacccagcagtcctcagggaccg
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       ggaaggc----------gaccgctgtgcgcacggcagccctcagggcccg
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      tgacggtgaag----gggaccgctgcccccacggcagcccgcagggcccg
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       cgacggcgaag----gggaccgctgcccccacggcagccctcagggcccg
O88498_BCL2L11-01       cgacggcgaag----gggaccgctgcccccacggcagccctcagggcccg
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       tgaaggagaag----gggaccgctgcccccaaggcagcccacagggcccg
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       tgaaggagaag----gggaccgctgcccccaaggcagcccgcagggcccg
A0A452FCR6_BCL2L11      tgaaggagaag----gggaccgctgcccccaaggcagcccgcagggcccg
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      cggaggcgaag----gggaccgctgcccccaaggcagccctctgggcccg
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      cggaggcgaag----gggaccgctgcccccaaggcagccctctgggcccg
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      tgaaggcgcag----gggaccgctccccccacggcagccctcagggcccg
A0A286XJN2_BCL2L11      tgaaggcgcag----gggaccgctccccccacggcagccctcagggcccg
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       ggaagtcgaag----gggaccgctgcccccaaggcagccctcagggccca
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      cggaggcgaag----gggaccgctgcccccacggcagccctcagggccca
A0A1U7T0R1_BCL2L11      cggaggcgaag----gggaccgctgcccccacggcagccctcagggccca
A0A1U7T0R1_BCL2L11      cggaggcgaag----gggaccgctgcccccacggcagccctcagggccca
A0A1U7T0R1_BCL2L11      cggaggcgaag----gggaccgctgcccccacggcagccctcagggccca
A0A1U7T0R1_BCL2L11      cggaggcgaag----gggaccgctgcccccacggcagccctcagggccca
A0A2K6GE31_BCL2L11      ggaaggcgaag----gggaccgctgctcccacggcagccctcagggcccg
A0A2K6GE31_BCL2L11      ggaaggcgaag----gggaccgctgctcccacggcagccctcagggcccg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2R8M6L7_BCL2L11      cggaggtgaag----gggacagctgcctccacggcagccctcagggcccg
A0A2K6TRU4_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K5CA89_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K5Q1Y0_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2I3GVB2_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2R9C366_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2I3SN61_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K5HZI5_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K6QIL2_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2I2YQ13_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K6QIL2_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K5HZI5_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2I2YQ13_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A096NYC3_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K5NU92_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K5X1Y3_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K6KJP8_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K5X1Y3_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K6E212_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A2K5NU92_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A096NYC3_BCL2L11      cggaggtgaag----gggacagctgcccccacggcagccctcagggcccg
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      cgaaggcgaag----gggaccgctgcccccacggcagcccacagggcccg
G3SU55_BCL2L11-01       tgacggtgaag----gggacagctgcccccagggcagcccacagggcccg
C1KGB6_BCL2L11-03       ggaaggagaag----gggaccgctgcccccaaggcagcccccagggccca
C1KGB6_BCL2L11-01       ggaaggagaag----gggaccgctgcccccaaggcagcccccagggccca
C1KGB6_BCL2L11-02       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      cgcaggcgaag----gggatcgctgtccccacggcagccctcagggcccg
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      cgaaggcgaag----gggaccgctgcccccaaggcagccctcagggcccg
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       tgaaggcgaag----gggaccgctgcccccaaggcagccctcagggccca
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       tgaaggcgaag----gggaccgctgcccccaaggcagccctcagggccca
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       tgaaggcgaag----gggaccgctgcccccaaggcagccctcagggcccg
J9NWV6_BCL2L11-02       tgaaggcgaag----gggaccgctgcccccaaggcagccctcagggcccg
J9NWV6_BCL2L11-03       tgaaggcgaag----gggaccgctgcccccaaggcagccctcagggcccg
G1LDR8_BCL2L11-01       tgaaggcgaag----gggaccgctgcccccaaggcagccctcagggcccg
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      tgaaggcgaag----gggaccgctgcccccaaggcagccctcagggcccg
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      -------------ccagtcgaggt--------------------------
B2KKY9_BCL2L11-01       -------------ccagtcgaggt--------------------------
B8JK68_BCL2L11-01       -------------ccagtcgaggt--------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --gagccggactccccgtcctggtccaga---------------------
A0A3Q1CI15_BCL2L11      --tcgccggactccccgtcctggtccagagc---------------gcag
A0A3P8RLE2_BCL2L11      --gagccggactccccgtcctggtccagagc---------------gcag
A0A3Q3B113_BCL2L11      --gagcccgagtcgccggcctgct------------cctccaaccccccc
A0A3Q2SZH6_BCL2L11      cggactcggactcgccgccccgct------------ccataag---cccg
A0A3P9N073_BCL2L11      cggactcggactcgccgccgtgca------------ccgtgag---cccg
A0A3B5M375_BCL2L11      cggactcggactcgccgccttgct------------ccgtgag---cccg
A0A3B5QAM1_BCL2L11      cggactcggactcgccgccttgct------------ccgtgag---cccg
A0A3B5QAM1_BCL2L11      cggactcggactcgccgccttgct------------ccgtgag---cccg
A0A3B3VNE0_BCL2L11      cggacgcggattcgccgccgtgct------------ccgtgag---cccg
A0A3B3YII5_BCL2L11      cggattcggactcgccgccgtgct------------ccgtgag---cccg
A0A3B3YII5_BCL2L11      cggattcggactcgccgccgtgct------------ccgtgag---cccg
A0A3Q3ESW6_BCL2L11      --gagccggactcaccgtcccggtgcagattcaaaccagtctcccctgtg
A0A3Q1ICY2_BCL2L11      --gagcctgaatcgcagtcccggtgcagaaccaaaagtagctcgtcttcc
A0A3B4V919_BCL2L11      --gagccagactcgccgccccggtgcagaaccatagccacctctcctgtc
A0A3B4XZH1_BCL2L11      ----------------------------aaccatagccacctctcctggc
A0A3Q3SYA1_BCL2L11      ------ccgtctcgccgtcccgaggcagaaccagatccattgcccatctc
A0A3Q3K6I5_BCL2L11      --gagccggtctcgccttcccggtgcagaaccaaagccatcgctcctctc
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      ------atgcctaatagccttctg-----------------ggttaccag
A0A3B4BVX1_BCL2L11      ------atgcctaatagccttctg-----------------ggttaccag
M3XHJ5_BCL2L11-01       cttctgttgccccccagcccctgt-----------------ccttttgtc
A0A3B1JXK6_BCL2L11      --------------tagccttctc-----------------ggttaccag
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       tttgcaccacccactagccctagc-----------------ccgtttgct
F7CXT2_BCL2L11-02       tttgcaccacccactagccctagt-----------------ccatttgct
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       ctggccccatcggccagccctggc-----------------cctttcgct
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      ctggccccaccggccagccctggc-----------------ccttctgct
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       ctggccccaccggccagccctggc-----------------ccttttgct
O88498_BCL2L11-01       ctggccccaccggccagccctggt-----------------ccttttgct
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       ctggccccaccggccagccctggc-----------------cctttcgct
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       ctggccccaccggccagccccggc-----------------cctttcgct
A0A452FCR6_BCL2L11      ctggccccaccggccagccccggc-----------------cctttcgct
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      ctggccccaccggccagtcctggc-----------------ccttttgct
A0A286XJN2_BCL2L11      ctggccccaccggccagtcctggc-----------------ccttttgct
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       ctggccccaccggccagccctggt-----------------ccttttgct
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A1U7T0R1_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A1U7T0R1_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A1U7T0R1_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A1U7T0R1_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K6GE31_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K6GE31_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2R8M6L7_BCL2L11      ctggccccaccggccagccccggc-----------------ccttttgct
A0A2K6TRU4_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K5CA89_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K5Q1Y0_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2I3GVB2_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2R9C366_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2I3SN61_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K5HZI5_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K6QIL2_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2I2YQ13_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K6QIL2_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K5HZI5_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2I2YQ13_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A096NYC3_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K5NU92_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K5X1Y3_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K6KJP8_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K5X1Y3_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K6E212_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A2K5NU92_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A096NYC3_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
G3SU55_BCL2L11-01       caggccccaccagccagccccggc-----------------ccttttgct
C1KGB6_BCL2L11-03       ctggccccaccgaccagccctggc-----------------ccctttgct
C1KGB6_BCL2L11-01       ctggccccaccgaccagccctggc-----------------ccctttgct
C1KGB6_BCL2L11-02       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      ctggccccaccggccagccctggc-----------------ccttttgct
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       ctggccccacctgccagccccggc-----------------ccttttgct
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       ctggccccacctgccagccccggc-----------------ccttttgct
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       ctggccccaccagccagccccggc-----------------ccttttgct
J9NWV6_BCL2L11-02       ctggccccaccagccagccccggc-----------------ccttttgct
J9NWV6_BCL2L11-03       ctggccccaccagccagccccggc-----------------ccttttgct
G1LDR8_BCL2L11-01       ctggccccaccagccagcccaggc-----------------ccttttgct
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      ctggccccaccagccagccccggg-----------------ccttttgct
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      -------------------------caccgatgtcccgaaccttctccag
B2KKY9_BCL2L11-01       -------------------------caccgatgaaccggactttctccag
B8JK68_BCL2L11-01       -------------------------caccgatgaaccggactttctccag
A0A3B3QC78_BCL2L11      --------------------------------atttagtacgctgtccgc
A0A3Q1ELG4_BCL2L11      gccagcctaggcgtgtttcagaccaggtcgatatttcacctccctcgccg
A0A3Q1CI15_BCL2L11      gccagcctaggcgtgtttcagaccaggtcgatttttcacctccctcgccg
A0A3P8RLE2_BCL2L11      gccagcctaggcgtgtttcagaccaggtcgatttttcacctccctcgccg
A0A3Q3B113_BCL2L11      gctggcttagacgtgtttcggagcaggtcgatatttcgcttcccccggcg
A0A3Q2SZH6_BCL2L11      aacagtttagacgtctttcaaagaaggtcgatttttcgca----------
A0A3P9N073_BCL2L11      gccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccg
A0A3B5M375_BCL2L11      gccagtttagacgtctttcgaagcaggtcgatatttcgccctacccgccg
A0A3B5QAM1_BCL2L11      gccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccg
A0A3B5QAM1_BCL2L11      gccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccg
A0A3B3VNE0_BCL2L11      gccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccg
A0A3B3YII5_BCL2L11      gccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccg
A0A3B3YII5_BCL2L11      gccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccg
A0A3Q3ESW6_BCL2L11      gacagcctcggcgtgttccagaagagatctatatttcaccttcctcgccg
A0A3Q1ICY2_BCL2L11      gacggcctaggcgtgttt------aggtcagtattccgcctcccccggcg
A0A3B4V919_BCL2L11      aaca----------------------------------cttctctcgtcg
A0A3B4XZH1_BCL2L11      aacagcctaggcgtgtttcaaaagaggtctatattcagctaccctcgtcg
A0A3Q3SYA1_BCL2L11      gacagcctaagcgtgtttcacacgaggtcaatattccagcttcctcgccg
A0A3Q3K6I5_BCL2L11      gacagcctaagcgtgtttcacacaaggtctatattccacctccctcgccg
A0A3P8XIA2_BCL2L11      ---------------------------------------------tccac
A0A3P8XIA2_BCL2L11      ---------------------------------------------tccac
A0A3B4BVX1_BCL2L11      tcgcgttcgcctctcttc------------------cgaacactatccag
A0A3B4BVX1_BCL2L11      tcgcgttcgcctctcttc------------------cgaacactatccag
M3XHJ5_BCL2L11-01       actaggtccccgtttttcatcttcatgaggcggtccttagttttatccac
A0A3B1JXK6_BCL2L11      acccggtcgccgctgttccgaact------------------ctctccag
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       accagatccccacttttcatctttgtaagaagatccccactgctgcctcg
F7CXT2_BCL2L11-02       accagatccccacttttcatctttttaagaagatctccactgctgcctcg
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       accaggtccccgctcttcatctttgtccgaagatcctccctgctgtctcg
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      accagatccccacttttcatctttgtgagaagatcttctctgctgtcccg
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       accagatccccacttttcatctttgtgagaagatcttctctgctgtcccg
O88498_BCL2L11-01       accagatccccacttttcatctttgtgagaagatcttctctgctgtcccg
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       accagatccccgctcttcatcttcgtgagaagatcctccttgctgtctcg
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       accagatccccgctcttcatcttcgtgagaagatcctccttgctgtctcg
A0A452FCR6_BCL2L11      accagatccccgctcttcatcttcgtgagaagatcctccttgctgtctcg
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      accagatccccgtttttcatctttgtgagaagatcttccctgctgtctcg
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      accagatccccgtttttcatctttgtgagaagatcttccctgctgtctcg
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      accagatccccgctattcatctttgtgagaagatcttccctgctgtctcg
A0A286XJN2_BCL2L11      accagatccccgctattcatctttgtgagaagatcttccctgctgtctcg
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       accagatccccgcttttcatctttgtaagaagatcctccctgctgtctcg
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
A0A1U7T0R1_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
A0A1U7T0R1_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
A0A1U7T0R1_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
A0A1U7T0R1_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
A0A2K6GE31_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
A0A2K6GE31_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccgtgctgtctcg
A0A2R8M6L7_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccgtgctgtctcg
A0A2K6TRU4_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccgtgctgtctcg
A0A2K5CA89_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccgtgctgtctcg
A0A2K5Q1Y0_BCL2L11      accagatccccgcttttcatctttgtgagaagatcctccgtgctgtctcg
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2I3GVB2_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2R9C366_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2I3SN61_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K5HZI5_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K6QIL2_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2I2YQ13_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K6QIL2_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K5HZI5_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2I2YQ13_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A096NYC3_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K5NU92_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K5X1Y3_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K6KJP8_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K5X1Y3_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K6E212_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A2K5NU92_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A096NYC3_BCL2L11      accagatccccgcttttcatctttatgagaagatcctccctgctgtctcg
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      accagatccccgcttttcatctttgtgagaagatcttccctgctgtctcg
G3SU55_BCL2L11-01       accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
C1KGB6_BCL2L11-03       accagatccccgcttttcatcttcgtgagaagatcctccctgctgtctcg
C1KGB6_BCL2L11-01       accagatccccgcttttcatcttcgtgagaagatcctccctgctgtctcg
C1KGB6_BCL2L11-02       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      accagatccccgcttttcatctttgtgagaagatcttccctgctgtctcg
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      accagatccccgcttttcatctttgtgagaagatcttccctgctgtctcg
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
J9NWV6_BCL2L11-02       accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
J9NWV6_BCL2L11-03       accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
G1LDR8_BCL2L11-01       accagatccccgcttttcatctttgtgagaagatcctccctgctgtctcg
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      accagatccccgtttttcatctttgtcagaagatcctccctgctgtctcg
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      gtcctctagtggctatttttccgtcgacag---cgattctgtgccgggtt
B2KKY9_BCL2L11-01       gtcctctagtggctatttttccgtcgacag---cgattctgtgccaggtt
B8JK68_BCL2L11-01       gtcctctagtggctatttttccgtcgacag---cgattctgtgccaggtt
A0A3B3QC78_BCL2L11      atcgtcaagcggatatcattcactcgacat------ttcccttccaaact
A0A3Q1ELG4_BCL2L11      ctcctccagtggttatttctccgccgatggttccgactcggtgccgagct
A0A3Q1CI15_BCL2L11      ctcctccagtggctatttctccgccgatggtgccgactcggtgccgagct
A0A3P8RLE2_BCL2L11      ctcctccagtggctatttctccgccgatggtgccgactcggtgccgagct
A0A3Q3B113_BCL2L11      ctcgtccagcggctacttctctttcgaggg---cgactcgctgccgagct
A0A3Q2SZH6_BCL2L11      --aatccagcggatacttctcctttgactg---cgagtcgctgccgagca
A0A3P9N073_BCL2L11      ctcgtccagcggatacttctcctttgactg---cgactcgctgccgagct
A0A3B5M375_BCL2L11      ctcatccagcggatacttctcctttgactg---cgactcgctgccgagct
A0A3B5QAM1_BCL2L11      ctcgtccagcggatacttctcctttgactg---cgactcgctgccgagct
A0A3B5QAM1_BCL2L11      ctcgtccagcggatacttctcctttgactg---cgactcgctgccgagct
A0A3B3VNE0_BCL2L11      ctcgtccagcggatacttctcctttgactg---cgactcgctgccgagct
A0A3B3YII5_BCL2L11      ctcgtccagcggatacttctcctttgactg---cgactcgctgccgagct
A0A3B3YII5_BCL2L11      ctcgtccagcggatacttctcctttgactg---cgactcgctgccgagct
A0A3Q3ESW6_BCL2L11      cgcctcgagtggatacttctcctacgacgg---agactcgctgccgagct
A0A3Q1ICY2_BCL2L11      ctcctctagtggatatttctcctacgacag---tgactcgcagccgagct
A0A3B4V919_BCL2L11      ctcgtccagtggatatttctccttcgacag---cgactcgctaccgagct
A0A3B4XZH1_BCL2L11      ctcgtccagtggatatttctccttcgacag---cgactcgctaccgacct
A0A3Q3SYA1_BCL2L11      ctcctctagtggatatttctcctccgacgg---cgactcgctgccgagtt
A0A3Q3K6I5_BCL2L11      gtcctccagtggatatttctccaacgacag---cgactctgtgccgagct
A0A3P8XIA2_BCL2L11      gtcctccagtggatatttttcgttcgactg---cgactctattccaagct
A0A3P8XIA2_BCL2L11      gtcctccagtggatatttttcgttcgactg---cgactctattccaagct
A0A3B4BVX1_BCL2L11      gtcctcaagcggatacttttcgtttgagag---cgagc------ccagct
A0A3B4BVX1_BCL2L11      gtcctcaagcggatacttttcgtttgagag---cgagc------ccagct
M3XHJ5_BCL2L11-01       atcttccagtggatattttacttttgactc---tgatatagttcatagcc
A0A3B1JXK6_BCL2L11      gtcctcgagtggatatttctcgttcgacag---cgagc------ccagct
R4G9R5_BCL2L11-01       --------------------------ccgt---ggaga------agaaca
K7GA86_BCL2L11-01       ---------------------------------agaca------ggagcc
U3IW89_BCL2L11-01       --------------------------------------------gcagcc
A0A3Q2U844_BCL2L11      --------------------------------------------gcagcc
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       ---------------------------------agaca------ggagcc
G3W979_BCL2L11-01       atcttctagtgggtatttctcttttgacac---agaca------ggagtc
F7CXT2_BCL2L11-02       atcttccagtgggtatttctcttttgacac---agaca------ggagtc
F7CXT2_BCL2L11-01       ---------------------------------agaca------ggagtc
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       ------------agtctcactctgtcaccc---aggct------ggagt-
G1SSY0_BCL2L11-01       ---------------------------------agaca------ggagcc
G1SSY0_BCL2L11-02       atcgtccagtgggtatttctcttttgacac---agaca------ggagcc
A0A1U8BW10_BCL2L11      ---------------------------------agaca------ggagtc
A0A1U8BW10_BCL2L11      ---------------------------------agaca------ggagtc
A0A1U8BW10_BCL2L11      gtcctccagtgggtatttctcttttgacac---agaca------ggagtc
O54918_BCL2L11-03       ---------------------------------agaca------ggagcc
O54918_BCL2L11-01       gtcctccagtgggtatttctcttttgacac---agaca------ggagcc
O88498_BCL2L11-01       gtcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A3Q1MV27_BCL2L11      ---------------------------------agaca------ggagcc
A0A3Q1MV27_BCL2L11      ---------------------------------agaca------ggagcc
L8IVA4_BCL2L11-02       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
L8IVA4_BCL2L11-01       ---------------------------------agaca------ggagcc
W5PY58_BCL2L11-01       gtcctccagcgggtatttctcttttgacac---agaca------ggagcc
A0A452FCR6_BCL2L11      gtcctccagcgggtatttctcttttgacac---agaca------ggagcc
A0A452FCR6_BCL2L11      ---------------------------------agaca------ggagcc
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------------------agaca------ggagcc
A0A3Q2GRS5_BCL2L11      ctcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A3Q2GRS5_BCL2L11      ---------------------------------agaca------ggagcc
A0A3Q2GRS5_BCL2L11      ctcctccagtgggtatttctcttttgacac---agaca------ggagcc
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      ---------------------------------agaca------ggagcc
A0A2I3GVB2_BCL2L11      ---------------------------------agaca------ggagcc
A0A2R9C366_BCL2L11      ---------------------------------agaca------ggagcc
A0A2K5CA89_BCL2L11      ---------------------------------agaca------ggagcc
A0A2K5Z7V3_BCL2L11      ---------------------------------agaca------ggagcc
A0A2K6KJP8_BCL2L11      ---------------------------------agaca------ggagcc
A0A286XJN2_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A286XJN2_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A286XJN2_BCL2L11      ---------------------------------agaca------ggagcc
H0XW23_BCL2L11-01       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A1U7T0R1_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A1U7T0R1_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A1U7T0R1_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A1U7T0R1_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K6GE31_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K6GE31_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2R8M6L7_BCL2L11      ---------------------------------agaca------ggagcc
A0A2R8M6L7_BCL2L11      ---------------------------------agaca------ggagcc
H2P5E2_BCL2L11-01       ---------------------------------agaca------ggagcc
A0A2K5Q1Y0_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2R8M6L7_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K6TRU4_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K5CA89_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K5Q1Y0_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
Q6JTU4_BCL2L11-01       -------------------------gatat---ggat-------------
A0A2I3SN61_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2I3GVB2_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2R9C366_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2I3SN61_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K5HZI5_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K6QIL2_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2I2YQ13_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K6QIL2_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K5HZI5_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2I2YQ13_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A096NYC3_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K5NU92_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K5X1Y3_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K6E212_BCL2L11      ---------------------------------agaca------ggagcc
A0A2K5Z7V3_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K6KJP8_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K5X1Y3_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K6E212_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2K5NU92_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A096NYC3_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A0D9RWE0_BCL2L11      ---------------------------------agaca------ggagcc
A0A287DFJ0_BCL2L11      ---------------------------------agaca------ggagcc
A0A287DFJ0_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
G3SU55_BCL2L11-01       atcctccagcgggtatttctcttttgacac---agaca------ggagcc
C1KGB6_BCL2L11-03       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
C1KGB6_BCL2L11-01       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
C1KGB6_BCL2L11-02       ---------------------------------agaca------ggagcc
C1KGB8_BCL2L11-01       ---------------------------------a----------------
A0A250YBV9_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A250YBV9_BCL2L11      -----------------------------c---agaca------ggagcc
A0A1S3FFM9_BCL2L11      ---------------------------------agaca------ggagcc
A0A1S3FFM9_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A452U4S4_BCL2L11      ---------------------------------agaca------ggagcc
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ---------------------------------agaca------ggagcc
U6CTE3_BCL2L11-01       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
U6CTE3_BCL2L11-03       ---------------------------------agaca------ggagcc
U6CTE3_BCL2L11-02       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
J9NWV6_BCL2L11-05       ---------------------------------agaca------ggagcc
J9NWV6_BCL2L11-04       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
J9NWV6_BCL2L11-02       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
J9NWV6_BCL2L11-03       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
G1LDR8_BCL2L11-01       atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A452SBG5_BCL2L11      ---------------------------------agaca------ggagcc
J9NWV6_BCL2L11-01       ---------------------------------agaca------ggagcc
A0A2I2UX96_BCL2L11      atcctccagtgggtatttctcttttgacac---agaca------ggagcc
A0A2I2UX96_BCL2L11      ---------------------------------agaca------ggagcc
                                                                          

A0A3G3M2M0_BCL2L11      ctccgcta-------------------ttgcccaatatttccgaagcgca
B2KKY9_BCL2L11-01       cccctcta-------------------atgcccaatatttccgaagcgca
B8JK68_BCL2L11-01       cccctcta-------------------atgcccaatatttccgaagcgca
A0A3B3QC78_BCL2L11      ctcccttt------------atgactcataacaagtcgacacagaccccc
A0A3Q1ELG4_BCL2L11      ccccgctctcaccgaagcggctgacggctgacaaaaccacgcaaactccg
A0A3Q1CI15_BCL2L11      ccccgctctcaccgaagcgactgacggctgacaaagccacgcagactccg
A0A3P8RLE2_BCL2L11      ccccgctctcaccgaagcgactgacggctgacaaagccacgcagactccg
A0A3Q3B113_BCL2L11      ctccgctctcgccgaagccagtgacggcggagaaagccacgcagacgccc
A0A3Q2SZH6_BCL2L11      ctccgctctctccgcacccactgacggctgacaaagccacgcagactgcc
A0A3P9N073_BCL2L11      ccccgctctctccgcacccagtgacggctgacaaaaccacgcagaccccc
A0A3B5M375_BCL2L11      ccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccc
A0A3B5QAM1_BCL2L11      ccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccc
A0A3B5QAM1_BCL2L11      ccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccc
A0A3B3VNE0_BCL2L11      ccccgctctctccgcacccagtgacggctgataaagccacgcagaccccc
A0A3B3YII5_BCL2L11      ccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccc
A0A3B3YII5_BCL2L11      ccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccc
A0A3Q3ESW6_BCL2L11      ctccgctctccccgaggccgctgacggctgacaaagccacgcagactccc
A0A3Q1ICY2_BCL2L11      ccccgctctcacctaggccagtgacgtttgacagagccacgcagactccg
A0A3B4V919_BCL2L11      ccccgctctccccgaggccagccacggttgaacgaaccacgcagaccccg
A0A3B4XZH1_BCL2L11      ccccgctctccccgaggccagccacggctgaacgaaccacgcagaccccg
A0A3Q3SYA1_BCL2L11      cccctctctccccgaggccggtgacagctgacaaagccacgcagactccg
A0A3Q3K6I5_BCL2L11      ccccgctctccccgaggccagtgacggctgacaaagtcacgcagactccg
A0A3P8XIA2_BCL2L11      cgccacta------------ctaagaaataacaagtcgacacagactccg
A0A3P8XIA2_BCL2L11      cgccacta------------ctaagaaataacaagtcgacacagactccg
A0A3B4BVX1_BCL2L11      ctccgctc------------ctgacct------------------ctcct
A0A3B4BVX1_BCL2L11      ctccgctc------------gtgacgcacagcgcgtccacgcagaccccc
M3XHJ5_BCL2L11-01       ctgcacct------------gtaagtgtccacaaggctacacagactcca
A0A3B1JXK6_BCL2L11      ccccgctc------------ctgatgcacagcgcgtccactcagaccccg
R4G9R5_BCL2L11-01       gggaggag------------atggtgtgaggcagaa--------------
K7GA86_BCL2L11-01       ctgtgcct------------atgagttgcgacaagtcgacgcagactcca
U3IW89_BCL2L11-01       ccgcgccc------------atgagctgcgacaaggccacgcagaccccc
A0A3Q2U844_BCL2L11      ccgcgccc------------atgagctgcgataaggccacgcagaccccc
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       ctccgcct------------gtgagttgcgataaatcgacccagaccccc
G3W979_BCL2L11-01       cagcgcct------------atgagttgtgataaatctacacaaactcca
F7CXT2_BCL2L11-02       cagcgcct------------atgagttgtgataaatctacacaaactcca
F7CXT2_BCL2L11-01       cagcgcct------------atgagttgtgataaatctacacaaactcca
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --gcactg------------gtgcgatct--tggctcactgcaacctcca
G1SSY0_BCL2L11-01       cggcaccc------------atgagctgtgacaaatcaacacaaacccca
G1SSY0_BCL2L11-02       cggcaccc------------atgagctgtgacaaatcaacacaaacccca
A0A1U8BW10_BCL2L11      cggcaccc------------atgagttgtgacaagtcaacacaaacccca
A0A1U8BW10_BCL2L11      cggcaccc------------atgagttgtgacaagtcaacacaaacccca
A0A1U8BW10_BCL2L11      cggcaccc------------atgagttgtgacaagtcaacacaaacccca
O54918_BCL2L11-03       cggcaccc------------atgagttgtgacaagtcaacacaaacccca
O54918_BCL2L11-01       cggcaccc------------atgagttgtgacaagtcaacacaaacccca
O88498_BCL2L11-01       cggcaccc------------atgagttgtgacaagtcaacacaaacccca
A0A3Q1MV27_BCL2L11      cggcaccc------------atgagttgtgacaaatccacacagacccca
A0A3Q1MV27_BCL2L11      cggcaccc------------atgagttgtgacaaatccacacagacccca
L8IVA4_BCL2L11-02       cggcaccc------------atgagttgtgacaaatccacacagacccca
L8IVA4_BCL2L11-01       cggcaccc------------atgagttgtgacaaatccacacagacccca
W5PY58_BCL2L11-01       cggcaccc------------atgagttgtgacaaatccacacagacccca
A0A452FCR6_BCL2L11      cggcaccc------------atgagttgtgacaaatccacacagacccca
A0A452FCR6_BCL2L11      cggcaccc------------atgagttgtgacaaatccacacagacccca
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacgcca
A0A3Q2GRS5_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacgcca
A0A3Q2GRS5_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacgcca
A0A3Q2GRS5_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacgcca
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2I3GVB2_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2R9C366_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5CA89_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5Z7V3_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6KJP8_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A286XJN2_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A286XJN2_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A286XJN2_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
H0XW23_BCL2L11-01       cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A1U7T0R1_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A1U7T0R1_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A1U7T0R1_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A1U7T0R1_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6GE31_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6GE31_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2R8M6L7_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2R8M6L7_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
H2P5E2_BCL2L11-01       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5Q1Y0_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2R8M6L7_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6TRU4_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5CA89_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5Q1Y0_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
Q6JTU4_BCL2L11-01       ---cgccc------------aagagttgcggcgtatc-------------
A0A2I3SN61_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2I3GVB2_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2R9C366_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2I3SN61_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5HZI5_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6QIL2_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2I2YQ13_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6QIL2_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5HZI5_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2I2YQ13_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A096NYC3_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5NU92_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5X1Y3_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6E212_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5Z7V3_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6KJP8_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5X1Y3_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K6E212_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2K5NU92_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A096NYC3_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A0D9RWE0_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A287DFJ0_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A287DFJ0_BCL2L11      cagcaccc------------atgagttgtgacaaatcaacacaaacccca
G3SU55_BCL2L11-01       cagcaccc------------atgagttgtgacaaatcaacacaaacccca
C1KGB6_BCL2L11-03       cagcaccc------------atgagttgtgacaaatcaacacaaacccca
C1KGB6_BCL2L11-01       cagcaccc------------atgagttgtgacaaatcaacacaaacccca
C1KGB6_BCL2L11-02       cagcaccc------------atgagttgtgacaaatcaacacaaacccca
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A250YBV9_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A1S3FFM9_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A1S3FFM9_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A452U4S4_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
U6CTE3_BCL2L11-01       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
U6CTE3_BCL2L11-03       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
U6CTE3_BCL2L11-02       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
J9NWV6_BCL2L11-05       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
J9NWV6_BCL2L11-04       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
J9NWV6_BCL2L11-02       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
J9NWV6_BCL2L11-03       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
G1LDR8_BCL2L11-01       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A452SBG5_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
J9NWV6_BCL2L11-01       cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2I2UX96_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
A0A2I2UX96_BCL2L11      cggcaccc------------atgagttgtgacaaatcaacacaaacccca
                                                                          

A0A3G3M2M0_BCL2L11      ag----acgaccaaaatgatgaggtatggtttgccgaacc-tagc-----
B2KKY9_BCL2L11-01       ag----acggacaaaatgatgaggtatggttatcagaaca-tagc-----
B8JK68_BCL2L11-01       ag----acggacaaaatgatgaggtatggttatcagaaca-tagc-----
A0A3B3QC78_BCL2L11      agtccgtctaatca---------------tcttgtttgcatttat---tt
A0A3Q1ELG4_BCL2L11      agcccgagcggccaggtgatcagacacgcactggagcgca-tggccggtg
A0A3Q1CI15_BCL2L11      agcccgagcggccaggtgatcaaacacgcgctggagcgca-tgaccgatg
A0A3P8RLE2_BCL2L11      agcccgagcggccaggtgatcaaacacgcgctggagcgca-tgaccgatg
A0A3Q3B113_BCL2L11      agccccaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3Q2SZH6_BCL2L11      agccccaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3P9N073_BCL2L11      agccccaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3B5M375_BCL2L11      agcctcaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3B5QAM1_BCL2L11      agcctcaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3B5QAM1_BCL2L11      agcctcaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3B3VNE0_BCL2L11      agccccaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3B3YII5_BCL2L11      agccccaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3B3YII5_BCL2L11      agccccaccggccaggtgatgaaccacgccctgcagcgaa-tggc---tg
A0A3Q3ESW6_BCL2L11      agccccagtggccaggtgatgcaacacgctctgcagcgca-tgac---tg
A0A3Q1ICY2_BCL2L11      agccccaccggccaggtgatgaaccacgccctgcagcgct-tggc---cg
A0A3B4V919_BCL2L11      agccccaccagccaggtgatgaaacacgccttgcagcgca-tggc---gg
A0A3B4XZH1_BCL2L11      agccccaccagccaggtgatgaaacacgccttgcagcgca-tggc---gg
A0A3Q3SYA1_BCL2L11      agcctcacgagccaggtgatgaaccacgccctgcagcgcc-tggc---tg
A0A3Q3K6I5_BCL2L11      agtcccagcagccaggtgatgaaccacgccctgcagtgca-tggc---tg
A0A3P8XIA2_BCL2L11      agcccatctagtcaag-------------ttattact-ca-c--------
A0A3P8XIA2_BCL2L11      agcccatctagtcaag-------------ttattact-ca-c--------
A0A3B4BVX1_BCL2L11      tctctgtctg--------------tgtgttccaca---------------
A0A3B4BVX1_BCL2L11      agcccgtctagtcaagtaatcactcacgccctgcagcgca-ttgc---tg
M3XHJ5_BCL2L11-01       agccc-----atcaag----------------ccaactca-tcgt---ac
A0A3B1JXK6_BCL2L11      agtccatctagccaagtcataattcacgcccttcagcgca-tttc---cg
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       agtcccccttgtcaag-------------cctttaat-ca-ttat---ct
U3IW89_BCL2L11-01       agcccgccctgccagg-------------ccgtcagc-ca-ctac---ct
A0A3Q2U844_BCL2L11      agcccgccgtgccagg-------------ccgtcagc-ca-ctac---ct
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       agtccccactgtcaag-------------ccttcaat-ca-ttat---ct
G3W979_BCL2L11-01       agccctccttgtcaag-------------ccttcaat-ca-ttat---ct
F7CXT2_BCL2L11-02       agccctccttgtcaag-------------ccttcaat-ca-ttat---ct
F7CXT2_BCL2L11-01       agccctccttgtcaag-------------ccttcaat-ca-ttat---ct
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       actc-------ccaag---------------ttcaag-c-----------
G1SSY0_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
G1SSY0_BCL2L11-02       agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A1U8BW10_BCL2L11      agtcctccttgccaag-------------ccttcaac-ca-ttat---ct
A0A1U8BW10_BCL2L11      agtcctccttgccaag-------------ccttcaac-ca-ttat---ct
A0A1U8BW10_BCL2L11      agtcctccttgccaag-------------ccttcaac-ca-ttat---ct
O54918_BCL2L11-03       agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
O54918_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
O88498_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A3Q1MV27_BCL2L11      agccctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A3Q1MV27_BCL2L11      agccctccttgccagg-------------ccttcaac-ca-ttat---ct
L8IVA4_BCL2L11-02       agccctccttgccagg-------------ccttcaac-ca-ttat---ct
L8IVA4_BCL2L11-01       agccctccttgccagg-------------ccttcaac-ca-ttat---ct
W5PY58_BCL2L11-01       agccctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A452FCR6_BCL2L11      agccctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A452FCR6_BCL2L11      agccctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      agtcctccttgccaag-------------ccttcaac-ca-ctat---ct
A0A3Q2GRS5_BCL2L11      agtcctccttgccaag-------------ccttcaac-ca-ctat---ct
A0A3Q2GRS5_BCL2L11      agtcctccttgccaag-------------ccttcaac-ca-ctat---ct
A0A3Q2GRS5_BCL2L11      agtcctccttgccaag-------------ccttcaac-ca-ctat---ct
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2I3GVB2_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2R9C366_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5CA89_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5Z7V3_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K6KJP8_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A286XJN2_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A286XJN2_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A286XJN2_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
H0XW23_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      agtcctccctgccagg-------------ccttcaac-ca-ctat---ct
A0A1U7T0R1_BCL2L11      agtcctccctgccagg-------------ccttcaac-ca-ctat---ct
A0A1U7T0R1_BCL2L11      agtcctccctgccagg-------------ccttcaac-ca-ctat---ct
A0A1U7T0R1_BCL2L11      agtcctccctgccagg-------------ccttcaac-ca-ctat---ct
A0A1U7T0R1_BCL2L11      agtcctccctgccagg-------------ccttcaac-ca-ctat---ct
A0A2K6GE31_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A2K6GE31_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A2R8M6L7_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2R8M6L7_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
H2P5E2_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5Q1Y0_BCL2L11      agtcctacttgccagg-------------ccttcaac-ca-ctat---ct
A0A2R8M6L7_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K6TRU4_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5CA89_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5Q1Y0_BCL2L11      agtcctacttgccagg-------------ccttcaac-ca-ctat---ct
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2I3GVB2_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2R9C366_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2I3SN61_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5HZI5_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K6QIL2_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2I2YQ13_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K6QIL2_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5HZI5_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2I2YQ13_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A096NYC3_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5NU92_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5X1Y3_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K6E212_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5Z7V3_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K6KJP8_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5X1Y3_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K6E212_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A2K5NU92_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A096NYC3_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A0D9RWE0_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ctat---ct
A0A287DFJ0_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A287DFJ0_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
G3SU55_BCL2L11-01       agtcctccttgccagg-------------ccatcaac-ca-ttac---ct
C1KGB6_BCL2L11-03       agtcctccttgccaag-------------ccttcaac-ca-ttat---ct
C1KGB6_BCL2L11-01       agtcctccttgccaag-------------ccttcaac-ca-ttat---ct
C1KGB6_BCL2L11-02       agtcctccttgccaag-------------ccttcaac-ca-ttat---ct
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A250YBV9_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A1S3FFM9_BCL2L11      agtcctccctgccagg-------------ccttcaac-ca-ttat---ct
A0A1S3FFM9_BCL2L11      agtcctccctgccagg-------------ccttcaac-ca-ttat---ct
A0A452U4S4_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
U6CTE3_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
U6CTE3_BCL2L11-03       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
U6CTE3_BCL2L11-02       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
J9NWV6_BCL2L11-05       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
J9NWV6_BCL2L11-04       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
J9NWV6_BCL2L11-02       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
J9NWV6_BCL2L11-03       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
G1LDR8_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A452SBG5_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
J9NWV6_BCL2L11-01       agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A2I2UX96_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
A0A2I2UX96_BCL2L11      agtcctccttgccagg-------------ccttcaac-ca-ttat---ct
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      gagctcagta----------------------------------------
A0A3Q1ELG4_BCL2L11      aggcgcacagaggagg----------------------------------
A0A3Q1CI15_BCL2L11      aggcgcacggaggagg----------------------------------
A0A3P8RLE2_BCL2L11      aggcgcacggaggagg----------------------------------
A0A3Q3B113_BCL2L11      tggagcagggaggagg----------------------------------
A0A3Q2SZH6_BCL2L11      cggagcacggtggaca----------------------------------
A0A3P9N073_BCL2L11      tggagcacgaaat-------------------------------------
A0A3B5M375_BCL2L11      tggagcacggtgg-------------------------------------
A0A3B5QAM1_BCL2L11      tggagcacggtgg-------------------------------------
A0A3B5QAM1_BCL2L11      tggagcacggtgg-------------------------------------
A0A3B3VNE0_BCL2L11      tggagcacggtgg-------------------------------------
A0A3B3YII5_BCL2L11      tggagcacggtgg-------------------------------------
A0A3B3YII5_BCL2L11      tggagcacggtgg-------------------------------------
A0A3Q3ESW6_BCL2L11      aggcgcacggaggagg----------------------------------
A0A3Q1ICY2_BCL2L11      aggcgaacggctcaga----------------------------------
A0A3B4V919_BCL2L11      aggcgcacggcggagg----------------------------------
A0A3B4XZH1_BCL2L11      aggcgcacggcggagg----------------------------------
A0A3Q3SYA1_BCL2L11      aagcgcacggcggagg----------------------------------
A0A3Q3K6I5_BCL2L11      aggcgcacggcggtcg----------------------------------
A0A3P8XIA2_BCL2L11      ----gcaatgaggc------------------------------------
A0A3P8XIA2_BCL2L11      ----gcaatgaggcgcttgtctaagccacaagacacctggcgaggttatg
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      aggcgcgagg----------------------------------------
M3XHJ5_BCL2L11-01       acgtacagca----------------------------------------
A0A3B1JXK6_BCL2L11      aggcgcgagg----------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       aagtgcaatgggta-------------------------------agcaa
U3IW89_BCL2L11-01       gagcgccatg----------------------------------------
A0A3Q2U844_BCL2L11      gagcgccatg----------------------------------------
G1MV54_BCL2L11-01       ---------a----------------------------------------
F7FTC8_BCL2L11-01       aagtgcaatg----------------------------------------
G3W979_BCL2L11-01       aagtgcaatggata-------------------------------ca---
F7CXT2_BCL2L11-02       aagtgcaatgggta-------------------------------agcaa
F7CXT2_BCL2L11-01       aagtgcaatg----------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       ---------g----------------------------------------
G1SSY0_BCL2L11-01       cagtgcaatg----------------------------------------
G1SSY0_BCL2L11-02       cagtgcaatg----------------------------------------
A0A1U8BW10_BCL2L11      cagtgcaatg----------------------------------------
A0A1U8BW10_BCL2L11      cagtgcaatg----------------------------------------
A0A1U8BW10_BCL2L11      cagtgcaatg----------------------------------------
O54918_BCL2L11-03       cagtgcaatg----------------------------------------
O54918_BCL2L11-01       cagtgcaatg----------------------------------------
O88498_BCL2L11-01       cagtgcaatg----------------------------------------
A0A3Q1MV27_BCL2L11      cagtgcaatg----------------------------------------
A0A3Q1MV27_BCL2L11      cagtgcaatg----------------------------------------
L8IVA4_BCL2L11-02       cagtgcaatg----------------------------------------
L8IVA4_BCL2L11-01       cagtgcaatg----------------------------------------
W5PY58_BCL2L11-01       cagtgcaatg----------------------------------------
A0A452FCR6_BCL2L11      cagtgcaatg----------------------------------------
A0A452FCR6_BCL2L11      cagtgcaatg----------------------------------------
A0A3Q2GRS5_BCL2L11      ---------a----------------------------------------
A0A3Q2GRS5_BCL2L11      cagtgcaatg----------------------------------------
A0A3Q2GRS5_BCL2L11      cagtgcaatg----------------------------------------
A0A3Q2GRS5_BCL2L11      cagtgcaatg----------------------------------------
A0A3Q2GRS5_BCL2L11      cagtgcaatg----------------------------------------
J9NWV6_BCL2L11-06       ---------a----------------------------------------
A0A2K6TRU4_BCL2L11      cagtgcaatg----------------------------------------
A0A2I3GVB2_BCL2L11      cagtgcaatg----------------------------------------
A0A2R9C366_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5CA89_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5Z7V3_BCL2L11      cagtgcaatg----------------------------------------
A0A2K6KJP8_BCL2L11      cagtgcaatg----------------------------------------
A0A286XJN2_BCL2L11      cagtgcaatg----------------------------------------
A0A286XJN2_BCL2L11      cagtgcaatg----------------------------------------
A0A286XJN2_BCL2L11      cagtgcaatg----------------------------------------
H0XW23_BCL2L11-01       cagtgcaatg----------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      cagtgcaatg----------------------------------------
A0A1U7T0R1_BCL2L11      cagtgcaatg----------------------------------------
A0A1U7T0R1_BCL2L11      cagtgcaatg----------------------------------------
A0A1U7T0R1_BCL2L11      cagtgcaatg----------------------------------------
A0A1U7T0R1_BCL2L11      cagtgcaat-----------------------------------------
A0A2K6GE31_BCL2L11      cagtgcaatg----------------------------------------
A0A2K6GE31_BCL2L11      cagtgcaatg----------------------------------------
A0A2R8M6L7_BCL2L11      cagtgcaatg----------------------------------------
A0A2R8M6L7_BCL2L11      cagtgcaatg----------------------------------------
H2P5E2_BCL2L11-01       cagtgcaatg----------------------------------------
A0A2K5Q1Y0_BCL2L11      cagtgcaatg----------------------------------------
A0A2R8M6L7_BCL2L11      cagtgcaatg----------------------------------------
A0A2K6TRU4_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5CA89_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5Q1Y0_BCL2L11      cagtgcaatg----------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      cagtgcaatg----------------------------------------
A0A2I3GVB2_BCL2L11      cagtgcaatg----------------------------------------
A0A2R9C366_BCL2L11      cagtgcaatg----------------------------------------
A0A2I3SN61_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5HZI5_BCL2L11      cagtgcaatg----------------------------------------
A0A2K6QIL2_BCL2L11      cagtgcaatg----------------------------------------
A0A2I2YQ13_BCL2L11      cagtgcaatg----------------------------------------
A0A2K6QIL2_BCL2L11      cagtgcaat-----------------------------------------
A0A2K5HZI5_BCL2L11      cagtgcaat-----------------------------------------
A0A2I2YQ13_BCL2L11      cagtgcaat-----------------------------------------
A0A096NYC3_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5NU92_BCL2L11      cagtgcaat-----------------------------------------
A0A2K5X1Y3_BCL2L11      cagtgcaat-----------------------------------------
A0A2K6E212_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5Z7V3_BCL2L11      cagtgcaatg----------------------------------------
A0A2K6KJP8_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5X1Y3_BCL2L11      cagtgcaatg----------------------------------------
A0A2K6E212_BCL2L11      cagtgcaatg----------------------------------------
A0A2K5NU92_BCL2L11      cagtgcaatg----------------------------------------
A0A096NYC3_BCL2L11      cagtgcaatg----------------------------------------
A0A0D9RWE0_BCL2L11      cagtgcaatg----------------------------------------
A0A287DFJ0_BCL2L11      gagtgcaatg----------------------------------------
A0A287DFJ0_BCL2L11      gagtgcaatg----------------------------------------
G3SU55_BCL2L11-01       cagtgcaatg----------------------------------------
C1KGB6_BCL2L11-03       cagtgcgatg----------------------------------------
C1KGB6_BCL2L11-01       cagtgcgatg----------------------------------------
C1KGB6_BCL2L11-02       cagtgcgatg----------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      cagtgcaatg----------------------------------------
A0A250YBV9_BCL2L11      cagtgcaatg----------------------------------------
A0A1S3FFM9_BCL2L11      cagcgcaatg----------------------------------------
A0A1S3FFM9_BCL2L11      cagcgcaatg----------------------------------------
A0A452U4S4_BCL2L11      cagtgcaatg----------------------------------------
U6CTE3_BCL2L11-04       ---------a----------------------------------------
M3YDI3_BCL2L11-01       cagtgcaatg----------------------------------------
U6CTE3_BCL2L11-01       cagtgcaatg----------------------------------------
U6CTE3_BCL2L11-03       cagtgcaatg----------------------------------------
U6CTE3_BCL2L11-02       cagtgcaatg----------------------------------------
J9NWV6_BCL2L11-05       cagtgcaatg----------------------------------------
J9NWV6_BCL2L11-04       cagtgcaatg----------------------------------------
J9NWV6_BCL2L11-02       cagtgcaat-----------------------------------------
J9NWV6_BCL2L11-03       cagtgcaatg----------------------------------------
G1LDR8_BCL2L11-01       cagtgcaatg----------------------------------------
A0A452SBG5_BCL2L11      cagtgcaatg----------------------------------------
J9NWV6_BCL2L11-01       cagtgcaatg----------------------------------------
A0A2I2UX96_BCL2L11      cagtgcaatg----------------------------------------
A0A2I2UX96_BCL2L11      cagtgcaatg----------------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      --------------------------caccagcacgtgcagatggcagca
B2KKY9_BCL2L11-01       --------------------------caccagcacttgcagatggcagca
B8JK68_BCL2L11-01       --------------------------caccagcacttgcagatggcagca
A0A3B3QC78_BCL2L11      --------------------------------acgcggacgctgtcgatg
A0A3Q1ELG4_BCL2L11      --------------------------accggagacgcagcggcagcagca
A0A3Q1CI15_BCL2L11      --------------------------accgggaac------gcagcagca
A0A3P8RLE2_BCL2L11      --------------------------accgggaac------gcagcagca
A0A3Q3B113_BCL2L11      --------------------------accggggac---gcaccggctgca
A0A3Q2SZH6_BCL2L11      --------------------------gccagcaagaatactggggctgca
A0A3P9N073_BCL2L11      --------------------------------------tcccaagctcaa
A0A3B5M375_BCL2L11      --------------------------------------actcgggctgca
A0A3B5QAM1_BCL2L11      --------------------------------------actcggcctgca
A0A3B5QAM1_BCL2L11      --------------------------------------actcggcctgca
A0A3B3VNE0_BCL2L11      --------------------------------------actcgggctgca
A0A3B3YII5_BCL2L11      --------------------------------------actcgggctgca
A0A3B3YII5_BCL2L11      --------------------------------------actcgggctgca
A0A3Q3ESW6_BCL2L11      --------------------------accggggac---gcagcagcagta
A0A3Q1ICY2_BCL2L11      --------------------------cctgaggac---gcatcagcagca
A0A3B4V919_BCL2L11      --------------------------agcgaggat---gcagcagcagca
A0A3B4XZH1_BCL2L11      --------------------------agcgaggatgcagcagcagcagca
A0A3Q3SYA1_BCL2L11      --------------------------agctggagc---gcaccggcagca
A0A3Q3K6I5_BCL2L11      --------------------------accggggac---gcaccggcaaga
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      aagcgtggcccaccccccaccacccctatagaccacggccaccaccaata
A0A3B4BVX1_BCL2L11      ------------------gaattatggcccctctataaccaccatccgcc
A0A3B4BVX1_BCL2L11      --gaacgctcagactttcgaattatggcccctctataaccaccatccgcc
M3XHJ5_BCL2L11-01       ----ttgct-----------------------------------------
A0A3B1JXK6_BCL2L11      --cgacgctcagagtttcgagttatgtccaggacctaaccactgtccacc
R4G9R5_BCL2L11-01       ------act-----------------tccagatggcagtcacggccaatt
K7GA86_BCL2L11-01       gatcatgct-----------------tccaggtgggagtccccctcaata
U3IW89_BCL2L11-01       ------gct-----------------tccaggtggcggtctcactcgcta
A0A3Q2U844_BCL2L11      ------gct-----------------tccaggtggcgatctcactcgctt
G1MV54_BCL2L11-01       ------gct-----------------tccaggtggcgatctcactcactt
F7FTC8_BCL2L11-01       ------gct-----------------tccattagacagcctcagtctgtt
G3W979_BCL2L11-01       ------gct-----------------tccatgaggcagtctcagtcaata
F7CXT2_BCL2L11-02       gatcatgct-----------------tccatgaggcagtctcaatcaata
F7CXT2_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaatcaata
G1PDJ5_BCL2L11-01       --------------------------tccatgcagcagtctcaggcccta
O43521_BCL2L11-20       ------gtt-----------------ctcctgcctcagcct---------
G1SSY0_BCL2L11-01       ------ggt-----------------aagcaaagcctgggtaagacgaag
G1SSY0_BCL2L11-02       ------gct-----------------tccatgaggcagtctcaggctgaa
A0A1U8BW10_BCL2L11      ------ga------------------tctgtgtgagaatcttaag-----
A0A1U8BW10_BCL2L11      ------gct-----------------tccataaggcagtctcaggaggaa
A0A1U8BW10_BCL2L11      ------gct-----------------tccataaggcagtctcaggaggaa
O54918_BCL2L11-03       ------gat--------------------------cagt-----------
O54918_BCL2L11-01       ------gct-----------------tccatacgacagtctcaggaggaa
O88498_BCL2L11-01       ------gct-----------------tccataaggcagtctcaggaggaa
A0A3Q1MV27_BCL2L11      ------gct-----------------tccatgaggcagtctcaggctgta
A0A3Q1MV27_BCL2L11      ------gct-----------------tccatgaggcagtctcaggctgta
L8IVA4_BCL2L11-02       ------gct-----------------tccatgaggcagtctcaggctgta
L8IVA4_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaggctgta
W5PY58_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaggctgta
A0A452FCR6_BCL2L11      ------gct-----------------tccatgaggcagtctcaggctgta
A0A452FCR6_BCL2L11      ------gct-----------------tccatgaggcagtctcaggctgta
A0A3Q2GRS5_BCL2L11      ------gct-----------------tccatgaggcagtcgcaggcggtc
A0A3Q2GRS5_BCL2L11      ------gtt-----------------------------------------
A0A3Q2GRS5_BCL2L11      ------gct-----------------tccatgaggcagtcgcaggcggtc
A0A3Q2GRS5_BCL2L11      ------gct-----------------tccatgaggcagtcgcaggcggtc
A0A3Q2GRS5_BCL2L11      ------gct-----------------tccatgaggcagtcgcaggcggtc
J9NWV6_BCL2L11-06       ------gct-----------------tccatgaggcagtctcaggctgta
A0A2K6TRU4_BCL2L11      ------gat-----------------gaggccactg-----------gat
A0A2I3GVB2_BCL2L11      ------gat-----------------gaggccgctg-----------gat
A0A2R9C366_BCL2L11      ------gat-----------------gactccgctg-----------gat
A0A2K5CA89_BCL2L11      --------------------------------------------ggtgat
A0A2K5Z7V3_BCL2L11      ------gta-----------------gtcattctagaggatataggtgat
A0A2K6KJP8_BCL2L11      ------gta-----------------gtcatcctagaggatataggtgat
A0A286XJN2_BCL2L11      ------gct-----------------tccatgaggcagtctcaggctgga
A0A286XJN2_BCL2L11      ------gct-----------------tccatgaggcagtctcaggctgga
A0A286XJN2_BCL2L11      ------gct-----------------tccatgaggcagtctcaggctgga
H0XW23_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaggccgaa
A0A1U7T0R1_BCL2L11      -------ag-----------------tccatgaggcagtctcaggctgaa
A0A1U7T0R1_BCL2L11      ------g-------------------------------------------
A0A1U7T0R1_BCL2L11      ------gag-----------------tccatgaggcagtctcaggctgaa
A0A1U7T0R1_BCL2L11      ------gag-----------------tccatgaggcagtctcaggctgaa
A0A1U7T0R1_BCL2L11      ------gag-----------------tccatgaggcagtctcaggctgaa
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ------gtt-----------------------------------------
A0A2K6GE31_BCL2L11      ------gct-----------------tccatgaggcaatttcaggctgaa
A0A2R8M6L7_BCL2L11      ------gct-----------------tccatgaggcaatctcaggctgaa
A0A2R8M6L7_BCL2L11      ------gct-----------------tccatgaggcaatctcaggctgaa
H2P5E2_BCL2L11-01       ------gct-----------------tccatgaggca------ggctgaa
A0A2K5Q1Y0_BCL2L11      ------gtt-----------------------------------------
A0A2R8M6L7_BCL2L11      ------gct-----------------tccatgaggcaatctcaggctgaa
A0A2K6TRU4_BCL2L11      ------gct----------------------------------gactgg-
A0A2K5CA89_BCL2L11      ------gct-----------------tccatgaggcaatctcaggctgaa
A0A2K5Q1Y0_BCL2L11      ------gct-----------------tccatgaggcaatctcaggctgaa
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      ------gct-----------------tccatgaggca------ggctgaa
A0A2I3GVB2_BCL2L11      ------gct----------------------------------------a
A0A2R9C366_BCL2L11      ------gct----------------------------------------a
A0A2I3SN61_BCL2L11      ------gct----------------------------------------a
A0A2K5HZI5_BCL2L11      ------gct----------------------------------------a
A0A2K6QIL2_BCL2L11      ------gtt-----------------------------------------
A0A2I2YQ13_BCL2L11      ------gtt-----------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A2K5Z7V3_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A2K6KJP8_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A2K5X1Y3_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A2K6E212_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A2K5NU92_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A096NYC3_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A0D9RWE0_BCL2L11      ------gct-----------------tccaggaggca------ggctgaa
A0A287DFJ0_BCL2L11      ------gct-----------------tccatgcgggagtctcaggcagaa
A0A287DFJ0_BCL2L11      ------gct-----------------tccatgcgggagtctcaggcagaa
G3SU55_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaggctcta
C1KGB6_BCL2L11-03       ------gct-----------------tccatgaggcagtctcaggctgaa
C1KGB6_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaggctgaa
C1KGB6_BCL2L11-02       ------gct-----------------tccatgaggcagtctcaggctgaa
C1KGB8_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaggctgaa
A0A250YBV9_BCL2L11      ------gct-----------------tccatgaggcagtctcaggtggaa
A0A250YBV9_BCL2L11      ------gct-----------------tccatgaggcagtctcaggtggaa
A0A1S3FFM9_BCL2L11      ------gct-----------------tccatgaggcagtctcaggaagag
A0A1S3FFM9_BCL2L11      ------gct-----------------tccatgaggcagtctcaggaagag
A0A452U4S4_BCL2L11      ------gat-----------------ctttgga-----------------
U6CTE3_BCL2L11-04       ------gct-----------------tccaggaggcagtctcaggctgta
M3YDI3_BCL2L11-01       ------gct-----------------tccaggaggcagtctcaggctgta
U6CTE3_BCL2L11-01       ------gct-----------------tccaggaggcagtctcaggctgta
U6CTE3_BCL2L11-03       ------gct-----------------tccaggaggcagtctcaggctgta
U6CTE3_BCL2L11-02       ------gct-----------------tccaggaggcagtctcaggctgta
J9NWV6_BCL2L11-05       ------gtt-----------------------------------------
J9NWV6_BCL2L11-04       ------gct-----------------tccatgaggcagtctcaggctgta
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       ------gct-----------------tccatgaggcagtctcaggctgta
G1LDR8_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaggctgta
A0A452SBG5_BCL2L11      ------gct-----------------tccatgaggcagtctcaggatgta
J9NWV6_BCL2L11-01       ------gct-----------------tccatgaggcagtctcaggctgta
A0A2I2UX96_BCL2L11      ------gct-----------------tccatgaggcagcctcaggctgta
A0A2I2UX96_BCL2L11      ------gct-----------------tccatgaggcagcctcaggctgta
                                                                          

A0A3G3M2M0_BCL2L11      cct------------------------------------------gtggg
B2KKY9_BCL2L11-01       cca------------------------------------------gtcgc
B8JK68_BCL2L11-01       cca------------------------------------------gtcgc
A0A3B3QC78_BCL2L11      ctg---------------------------------------------cc
A0A3Q1ELG4_BCL2L11      cggtgagct----------------------gaatgactgcaggagctgc
A0A3Q1CI15_BCL2L11      cggtgagct----------------------cag--------------gc
A0A3P8RLE2_BCL2L11      cggtgagct----------------------cag--------------gc
A0A3Q3B113_BCL2L11      cggaagctctcccaacccctctggcacgcaggcacg--aaacgcagcagg
A0A3Q2SZH6_BCL2L11      cggacactcctttagc-------gcgcggcaggg----aaacgcagcacg
A0A3P9N073_BCL2L11      tgtgaa-------------------aggaaaagaggaaaaagggggaaga
A0A3B5M375_BCL2L11      gg------------------------------------------------
A0A3B5QAM1_BCL2L11      cgggcagtctcccaac--------cactatagcactattaacgcggcacg
A0A3B5QAM1_BCL2L11      cgggcagtctcccaac--------cactatagcactattaacgcggcacg
A0A3B3VNE0_BCL2L11      cgggcactctcccaac--------cactatagcactattaacgcggcgcg
A0A3B3YII5_BCL2L11      cgggcactctcccaac--------cactatagcactattaacgcggcgcg
A0A3B3YII5_BCL2L11      cgggcactctcccaac--------cactatagcactattaacgcggcgcg
A0A3Q3ESW6_BCL2L11      cgggcactctcccagcctcactagccggcgacaacg--gactgcagcagg
A0A3Q1ICY2_BCL2L11      cggaagcgatctcagctcctctagcacgcagcaaca--aaacgcagcagg
A0A3B4V919_BCL2L11      cg---------------------gtgagc---------------------
A0A3B4XZH1_BCL2L11      cg---------------------gtgagcacaggca--ctttgcatcagg
A0A3Q3SYA1_BCL2L11      tg------------------------------------------------
A0A3Q3K6I5_BCL2L11      tgcaagctcgcccagcccctctagcgcacggcagca--gaacgcaataag
A0A3P8XIA2_BCL2L11      -cg---------------------------------------------gg
A0A3P8XIA2_BCL2L11      gcg---------------------------------------------gg
A0A3B4BVX1_BCL2L11      ccacggagc-----------------------------agcgcctgcggg
A0A3B4BVX1_BCL2L11      ccacggagc-----------------------------agcgcctgcggg
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      ccacagagc-----------------------------agcggctgcggg
R4G9R5_BCL2L11-01       cct---------------------------------------------ga
K7GA86_BCL2L11-01       cgt---------------------------------------------ga
U3IW89_BCL2L11-01       gca---------------------------------------------ga
A0A3Q2U844_BCL2L11      gca---------------------------------------------ga
G1MV54_BCL2L11-01       gca---------------------------------------------ga
F7FTC8_BCL2L11-01       cct---------------------------------------------ga
G3W979_BCL2L11-01       cct---------------------------------------------gc
F7CXT2_BCL2L11-02       cct---------------------------------------------gc
F7CXT2_BCL2L11-01       cct---------------------------------------------gc
G1PDJ5_BCL2L11-01       cct---------------------------------------------gt
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       cca---------------------------------------------gc
G1SSY0_BCL2L11-02       cct---------------------------------------------gc
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      cct---------------------------------------------gc
A0A1U8BW10_BCL2L11      cct---------------------------------------------gc
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       cct---------------------------------------------ga
O88498_BCL2L11-01       cct---------------------------------------------ga
A0A3Q1MV27_BCL2L11      cct---------------------------------------------gc
A0A3Q1MV27_BCL2L11      cct---------------------------------------------gc
L8IVA4_BCL2L11-02       cct---------------------------------------------gc
L8IVA4_BCL2L11-01       cct---------------------------------------------gc
W5PY58_BCL2L11-01       cct---------------------------------------------gc
A0A452FCR6_BCL2L11      cct---------------------------------------------gc
A0A452FCR6_BCL2L11      cct---------------------------------------------gc
A0A3Q2GRS5_BCL2L11      cct---------------------------------------------gc
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      cct---------------------------------------------gc
A0A3Q2GRS5_BCL2L11      cct---------------------------------------------gc
A0A3Q2GRS5_BCL2L11      cct---------------------------------------------gc
J9NWV6_BCL2L11-06       cct---------------------------------------------gc
A0A2K6TRU4_BCL2L11      cct---------------------------------------------cc
A0A2I3GVB2_BCL2L11      cct---------------------------------------------cc
A0A2R9C366_BCL2L11      cct---------------------------------------------cc
A0A2K5CA89_BCL2L11      att---------------------------------------------tc
A0A2K5Z7V3_BCL2L11      agt---------------------------------------------tc
A0A2K6KJP8_BCL2L11      act---------------------------------------------tc
A0A286XJN2_BCL2L11      cct---------------------------------------------cc
A0A286XJN2_BCL2L11      cct---------------------------------------------cc
A0A286XJN2_BCL2L11      cct---------------------------------------------cc
H0XW23_BCL2L11-01       cct---------------------------------------------gc
A0A1U7T0R1_BCL2L11      cct---------------------------------------------cc
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      cct---------------------------------------------cc
A0A1U7T0R1_BCL2L11      cct---------------------------------------------cc
A0A1U7T0R1_BCL2L11      cct---------------------------------------------cc
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      cct---------------------------------------------gc
A0A2R8M6L7_BCL2L11      cct---------------------------------------------gc
A0A2R8M6L7_BCL2L11      cct---------------------------------------------gc
H2P5E2_BCL2L11-01       cct---------------------------------------------gc
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      cct---------------------------------------------gc
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      cct---------------------------------------------gc
A0A2K5Q1Y0_BCL2L11      cct---------------------------------------------gc
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      cct---------------------------------------------gc
A0A2I3GVB2_BCL2L11      act---------------------------------------------g-
A0A2R9C366_BCL2L11      act---------------------------------------------g-
A0A2I3SN61_BCL2L11      act---------------------------------------------g-
A0A2K5HZI5_BCL2L11      act---------------------------------------------g-
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      cct---------------------------------------------gc
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      cct---------------------------------------------gc
A0A2K5Z7V3_BCL2L11      cct---------------------------------------------gc
A0A2K6KJP8_BCL2L11      cct---------------------------------------------gc
A0A2K5X1Y3_BCL2L11      cct---------------------------------------------gc
A0A2K6E212_BCL2L11      cct---------------------------------------------gc
A0A2K5NU92_BCL2L11      cct---------------------------------------------gc
A0A096NYC3_BCL2L11      cct---------------------------------------------gc
A0A0D9RWE0_BCL2L11      cct---------------------------------------------gc
A0A287DFJ0_BCL2L11      cct---------------------------------------------gc
A0A287DFJ0_BCL2L11      cct---------------------------------------------gc
G3SU55_BCL2L11-01       cct---------------------------------------------gc
C1KGB6_BCL2L11-03       ccc---------------------------------------------gc
C1KGB6_BCL2L11-01       ccc---------------------------------------------gc
C1KGB6_BCL2L11-02       ccc---------------------------------------------gc
C1KGB8_BCL2L11-01       ccc---------------------------------------------gc
A0A250YBV9_BCL2L11      ccc---------------------------------------------at
A0A250YBV9_BCL2L11      ccc---------------------------------------------at
A0A1S3FFM9_BCL2L11      cct---------------------------------------------gc
A0A1S3FFM9_BCL2L11      cct---------------------------------------------gc
A0A452U4S4_BCL2L11      -cc---------------------------------------------gt
U6CTE3_BCL2L11-04       cct---------------------------------------------gc
M3YDI3_BCL2L11-01       cct---------------------------------------------gc
U6CTE3_BCL2L11-01       cct---------------------------------------------gc
U6CTE3_BCL2L11-03       cct---------------------------------------------gc
U6CTE3_BCL2L11-02       cct---------------------------------------------gc
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       cct---------------------------------------------gc
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       cct---------------------------------------------gc
G1LDR8_BCL2L11-01       cct---------------------------------------------gc
A0A452SBG5_BCL2L11      cct---------------------------------------------gc
J9NWV6_BCL2L11-01       cct---------------------------------------------gc
A0A2I2UX96_BCL2L11      ccc---------------------------------------------gc
A0A2I2UX96_BCL2L11      ccc---------------------------------------------gc
                                                                          

A0A3G3M2M0_BCL2L11      agccatggggcc--------------------ggagatttcg----gtcg
B2KKY9_BCL2L11-01       agccctgccgcc--------------------ggagatggtg----gtcg
B8JK68_BCL2L11-01       agccctgccgcc--------------------ggagatggtg----gtcg
A0A3B3QC78_BCL2L11      ggacatgcggcc--------------------agagatgctg----gtcg
A0A3Q1ELG4_BCL2L11      ggaca-----aa--------------------------------------
A0A3Q1CI15_BCL2L11      tgacatacacga--------------------------------------
A0A3P8RLE2_BCL2L11      tgacatacacga--------------------------------------
A0A3Q3B113_BCL2L11      ggacatggaggc--------------------agagtca-------ttcg
A0A3Q2SZH6_BCL2L11      ggatatgcagcc--------------------ggaacgt-------tttg
A0A3P9N073_BCL2L11      ggaggggcattcgtcattataccaaaaagagaaacaaaccaacccatttt
A0A3B5M375_BCL2L11      ---------gtg--------------------agcaaac-------ttca
A0A3B5QAM1_BCL2L11      ggatatgcagtc--------------------agaaacc-------tatg
A0A3B5QAM1_BCL2L11      ggatatgcagtc--------------------agaaacc-------tatg
A0A3B3VNE0_BCL2L11      ggatatgcagtc--------------------agaaacc-------tttg
A0A3B3YII5_BCL2L11      ggatatgcagtc--------------------agaaaac-------tttg
A0A3B3YII5_BCL2L11      ggatatgcagtc--------------------agaaaac-------tttg
A0A3Q3ESW6_BCL2L11      ggacatgcaggc--------------------ggaggct-------attg
A0A3Q1ICY2_BCL2L11      ggatatgcaggc--------------------agtggaa-------gtcg
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      ggacatgcaggc--------------------ggaggca-------gtcg
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      ggacatgcaggc--------------------ggaggca-------gttg
A0A3P8XIA2_BCL2L11      ggacatgcggcc--------------------ggaaatactg----atcg
A0A3P8XIA2_BCL2L11      ggacatgcggcc--------------------ggaaatactg----atcg
A0A3B4BVX1_BCL2L11      ggacatgcgacc--------------------ggagtcgtac----gtgg
A0A3B4BVX1_BCL2L11      ggacatgcgacc--------------------ggagtcgtac----gtgg
M3XHJ5_BCL2L11-01       -----------------------------------------------tag
A0A3B1JXK6_BCL2L11      ggacatgcaagc--------------------gcattggtac----atcg
R4G9R5_BCL2L11-01       agatatgcagcc--------------------agaaatatgg----attg
K7GA86_BCL2L11-01       agacatgcagcc--------------------agaaatatgg----attg
U3IW89_BCL2L11-01       agaaatacagcc--------------------agaaatatgg----attg
A0A3Q2U844_BCL2L11      agaaatacaacc--------------------agaaatatgg----attg
G1MV54_BCL2L11-01       agaaatacaacc--------------------agaaatatgg----attg
F7FTC8_BCL2L11-01       agatatgcggcc--------------------ggaaatatgg----attg
G3W979_BCL2L11-01       agatatgcgacc--------------------agaaatttgg----attg
F7CXT2_BCL2L11-02       agatatgcggcc--------------------agaaatttgg----attg
F7CXT2_BCL2L11-01       agatatgcggcc--------------------agaaatttgg----attg
G1PDJ5_BCL2L11-01       agacatgcgtcc--------------------ggagatgtgg----atcg
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       atacgggtgtc-------------------------------------tg
G1SSY0_BCL2L11-02       agacacgcgtcc--------------------ggagacctgg----atcg
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      agatatccgccc--------------------ggagatatgg----attg
A0A1U8BW10_BCL2L11      agatatccgccc--------------------ggagatatgg----attg
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       agatctgcgccc--------------------ggagatacgg----attg
O88498_BCL2L11-01       agatctgcgccc--------------------agagatacgg----atcg
A0A3Q1MV27_BCL2L11      agatacacgccc--------------------agagatatgg----attg
A0A3Q1MV27_BCL2L11      agatacacgccc--------------------agagatatgg----attg
L8IVA4_BCL2L11-02       agatacacgccc--------------------agagatatgg----attg
L8IVA4_BCL2L11-01       agatacacgccc--------------------agagatatgg----attg
W5PY58_BCL2L11-01       agatacacgccc--------------------agagatatgg----attg
A0A452FCR6_BCL2L11      agatacacgccc--------------------agagatatgg----attg
A0A452FCR6_BCL2L11      agatacacgccc--------------------agagatatgg----attg
A0A3Q2GRS5_BCL2L11      agacatgcgccc--------------------ggaggtatgg----atcg
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      agacatgcgccc--------------------ggaggtatgg----atcg
A0A3Q2GRS5_BCL2L11      agacatgcgccc--------------------ggaggtatgg----atcg
A0A3Q2GRS5_BCL2L11      agacatgcgccc--------------------ggaggtatgg----atcg
J9NWV6_BCL2L11-06       agatatgcgccc--------------------ggagatatgg----attg
A0A2K6TRU4_BCL2L11      c-------------------------------------------------
A0A2I3GVB2_BCL2L11      c-------------------------------------------------
A0A2R9C366_BCL2L11      c-------------------------------------------------
A0A2K5CA89_BCL2L11      a-------------------------------------------------
A0A2K5Z7V3_BCL2L11      a-------------------------------------------------
A0A2K6KJP8_BCL2L11      a-------------------------------------------------
A0A286XJN2_BCL2L11      gcatttgcgccc--------------------agagatatgg----atcg
A0A286XJN2_BCL2L11      gcatttgcgccc--------------------agagatatgg----atcg
A0A286XJN2_BCL2L11      gcatttgcgccc--------------------agagatatgg----atcg
H0XW23_BCL2L11-01       agatttgcgccc--------------------ggagatgtgg----atcg
A0A1U7T0R1_BCL2L11      agatatgcgccc--------------------ggagatatgg----atcg
A0A1U7T0R1_BCL2L11      ----------tt--------------------agagaaatag----a---
A0A1U7T0R1_BCL2L11      agatatgcgccc--------------------ggagatatgg----atcg
A0A1U7T0R1_BCL2L11      agatatgcgccc--------------------ggagatatgg----atcg
A0A1U7T0R1_BCL2L11      agatatgcgccc--------------------ggagatatgg----atcg
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------agagaaatag----a---
A0A2K6GE31_BCL2L11      agatatgcgccc--------------------ggagatatgg----atcg
A0A2R8M6L7_BCL2L11      aggtatgcgccc--------------------ggagatatgg----atcg
A0A2R8M6L7_BCL2L11      aggtatgcgccc--------------------ggagatatgg----atcg
H2P5E2_BCL2L11-01       agatatgcgccc--------------------ggagatatgg----atcg
A0A2K5Q1Y0_BCL2L11      --------------------------------agagaaatag----a---
A0A2R8M6L7_BCL2L11      aggtatgcgccc--------------------ggagatatgg----atcg
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      aggtatgcgccc--------------------ggagatatgg----atcg
A0A2K5Q1Y0_BCL2L11      aggtatgcgccc--------------------ggagatatgg----atcg
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      agatatgcgacc--------------------ggagatatgg----atcg
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------agagaaatag----a---
A0A2I2YQ13_BCL2L11      --------------------------------agagaaatag----a---
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A2K5Z7V3_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A2K6KJP8_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A2K5X1Y3_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A2K6E212_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A2K5NU92_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A096NYC3_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A0D9RWE0_BCL2L11      agatatgcgccc--------------------ggagatacgg----atcg
A0A287DFJ0_BCL2L11      agacatgcgccc--------------------ggagatctgg----atcg
A0A287DFJ0_BCL2L11      agacatgcgccc--------------------ggagatctgg----atcg
G3SU55_BCL2L11-01       agacctgcgccc--------------------ggagatctgg----attg
C1KGB6_BCL2L11-03       agatatgcgccc--------------------ggagatatgg----attg
C1KGB6_BCL2L11-01       agatatgcgccc--------------------ggagatatgg----attg
C1KGB6_BCL2L11-02       agatatgcgccc--------------------ggagatatgg----attg
C1KGB8_BCL2L11-01       agatatgcgccc--------------------ggagatatgg----attg
A0A250YBV9_BCL2L11      ggacatgcgccc--------------------agagatttgg----atcg
A0A250YBV9_BCL2L11      ggacatgcgccc--------------------agagatttgg----atcg
A0A1S3FFM9_BCL2L11      agatttgcgccc--------------------agagatatgg----atcg
A0A1S3FFM9_BCL2L11      agatttgcgccc--------------------agagatatgg----atcg
A0A452U4S4_BCL2L11      ggagagacatct--------------------ggaaac------------
U6CTE3_BCL2L11-04       agatatgcgccc--------------------ggagatgtgg----attg
M3YDI3_BCL2L11-01       agatatgcgccc--------------------ggagatgtgg----attg
U6CTE3_BCL2L11-01       agatatgcgccc--------------------ggagatgtgg----attg
U6CTE3_BCL2L11-03       agatatgcgccc--------------------ggagatgtgg----attg
U6CTE3_BCL2L11-02       agatatgcgccc--------------------ggagatgtgg----attg
J9NWV6_BCL2L11-05       --------------------------------agagcaatag--------
J9NWV6_BCL2L11-04       agatatgcgccc--------------------ggagatatgg----attg
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       agatatgcgccc--------------------ggagatatgg----attg
G1LDR8_BCL2L11-01       cgatatgcgccc--------------------ggagatatgg----attg
A0A452SBG5_BCL2L11      cgatatgcgccc--------------------ggagatttgg----attg
J9NWV6_BCL2L11-01       agatatgcgccc--------------------ggagatatgg----attg
A0A2I2UX96_BCL2L11      agatatgcgccc--------------------ggagatatgg----attg
A0A2I2UX96_BCL2L11      agatatgcgccc--------------------ggagatatgg----attg
                                                                          

A0A3G3M2M0_BCL2L11      ctc----gggagct---gcggcgcattggagacgagttcaaccgcttgta
B2KKY9_BCL2L11-01       ctc----gtgaact---gcgacgcataggcgatgagttcaatcgcctcta
B8JK68_BCL2L11-01       ctc----gtgaact---gcgacgcataggcgatgagttcaatcgcctcta
A0A3B3QC78_BCL2L11      cac----gagagct---gcggcgcatcggtgacaagttcaatgatatct-
A0A3Q1ELG4_BCL2L11      -------ggaaaac---cagtttgacat----tctctgcagtagtttttg
A0A3Q1CI15_BCL2L11      -------gggaaat---cagttgcacattcaatctctgcaatagtttttg
A0A3P8RLE2_BCL2L11      -------gggaaat---cagttgcacattcaatctctgcaatagtttttg
A0A3Q3B113_BCL2L11      gac----gtcatct---ccggaccattggggatgagtacaataggctttt
A0A3Q2SZH6_BCL2L11      gtc----gtcaact---ccgggctattggcgatgaatacaacaatcacct
A0A3P9N073_BCL2L11      gtcttgtgtcctcc---cagtgcaactgatgatt----cagcagttttct
A0A3B5M375_BCL2L11      gtc---------ct---ccctcct-----------------cccccttct
A0A3B5QAM1_BCL2L11      gtc----gtcaact---ccgtgctattggagatgagtacaacaacctcct
A0A3B5QAM1_BCL2L11      gtc----gtcaact---ccgtgctattggagatgagtacaacaacctcct
A0A3B3VNE0_BCL2L11      gtc----gtcaact---ccgtgctattggagatgactacaacaaccacct
A0A3B3YII5_BCL2L11      gtc----gtcaact---ccgtgctattggagatgactacaacaaccacct
A0A3B3YII5_BCL2L11      gtc----gtcaact---ccgtgctattggagatgactacaacaaccacct
A0A3Q3ESW6_BCL2L11      gac----gagatct---ccaacgcattggcgacgactataatagactact
A0A3Q1ICY2_BCL2L11      gac----gagagct---ccgacgcattggagacgacttcaataaccacct
A0A3B4V919_BCL2L11      --t----aaaa------cctgcgcttctaaaacacactaagatgacttct
A0A3B4XZH1_BCL2L11      gac----aagagct---ccgacgcatcggagacgactttaatagacttct
A0A3Q3SYA1_BCL2L11      -------gtgagc---------------------------acaaacacct
A0A3Q3K6I5_BCL2L11      gac----gagagct---ccgacgcatcggagatgactataataaccacct
A0A3P8XIA2_BCL2L11      gtc----aggagct---tcagcgcattggagatgagtttaacaacctgtt
A0A3P8XIA2_BCL2L11      gtc----aggagct---tcagcgcattggagatgagtttaacaacctgtt
A0A3B4BVX1_BCL2L11      cgc----aagagct---gcggcgcatcggcgatgagtttaacgagcttta
A0A3B4BVX1_BCL2L11      cgc----aagagct---gcggcgcatcggcgatgagtttaacgagcttta
M3XHJ5_BCL2L11-01       cgc----aaagaga---acagcatcccgaa--------------------
A0A3B1JXK6_BCL2L11      cgc----aagagtt---gcgacgcattggggatgaattcaacgatctgt-
R4G9R5_BCL2L11-01       cac----aggaatt---acggcgcatcggagatgaattcaatgcttccca
K7GA86_BCL2L11-01       cac----aggagct---gcggcgaattggagatgagtttaatgcctctta
U3IW89_BCL2L11-01       cac----aggagct---gcggcgcattggagatgaattcaatgcctccta
A0A3Q2U844_BCL2L11      cac----aggagct---gcggcgcatcggggatgaattcaatgcctccta
G1MV54_BCL2L11-01       cac----aggagct---gcggcgcatcggggatgaattcaatgcctccta
F7FTC8_BCL2L11-01       ccc----aggagtt---acggcgaattggagatgagtttaacgcttccta
G3W979_BCL2L11-01       cac----aagaatt---gcgacgtattggagatgaatttaatgcttc---
F7CXT2_BCL2L11-02       cac----aagaatt---gcgccgtattggagatgaatttaatgcttccta
F7CXT2_BCL2L11-01       cac----aagaatt---gcgccgtattggagatgaatttaatgcttccta
G1PDJ5_BCL2L11-01       ctc----aggagct---gcggcggatcggggacgagttcaacaactccta
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       cat----agctgtgtgtgtggcgtccacgttacgtgtattttacttttc-
G1SSY0_BCL2L11-02       cgc----aggagtt---gcggcggatcggagacgagttcaacgcgtatt-
A0A1U8BW10_BCL2L11      --c----acgag------tggcagattcatggtga--tcaa---------
A0A1U8BW10_BCL2L11      cac----aggagct---tcggcggattggagacgagttcaacgaatctt-
A0A1U8BW10_BCL2L11      cac----aggagct---tcggcggattggagacgagttcaacgaatctt-
O54918_BCL2L11-03       ------------------tggagaatcttaaccaagtggcacaaaatat-
O54918_BCL2L11-01       cac----aggagct---gcggcggatcggagacgagttcaacgaaactt-
O88498_BCL2L11-01       cac----aggagct---gcggcggatcggagacgagttcaatgagactt-
A0A3Q1MV27_BCL2L11      ccc----aagagct---acggcgtatcggagacgagtttaatgcatatt-
A0A3Q1MV27_BCL2L11      ccc----aagagct---acggcgtatcggagacgagtttaatgcatatt-
L8IVA4_BCL2L11-02       ccc----aagagct---acggcgtatcggagacgagtttaatgcatatt-
L8IVA4_BCL2L11-01       ccc----aagagct---acggcgtatcggagacgagtttaatgcatatt-
W5PY58_BCL2L11-01       ctc----aagagct---acggcgtatcggagacgagtttaatgcgtatt-
A0A452FCR6_BCL2L11      ccc----aagagct---acggcgtatcggagacgagtttaatgcgtatt-
A0A452FCR6_BCL2L11      ccc----aagagct---acggcgtatcggagacgagtttaatgcgtatt-
A0A3Q2GRS5_BCL2L11      ctc----aagagct---gcggagaattggagacgaatttaatgcctctt-
A0A3Q2GRS5_BCL2L11      --------agagca---atagagga-------------------------
A0A3Q2GRS5_BCL2L11      ctc----aagagct---gcggagaattggagacgaatttaatgcctctt-
A0A3Q2GRS5_BCL2L11      ctc----aagagct---gcggagaattggagacgaatttaatgcctctt-
A0A3Q2GRS5_BCL2L11      ctc----aagagct---gcggagaattggagacgaatttaatgcctctt-
J9NWV6_BCL2L11-06       cac----aagagtt---gcggcgtattggagacgaatttaatgcatatt-
A0A2K6TRU4_BCL2L11      ------------tt------gcccttcgtagggaggttcagtgccc----
A0A2I3GVB2_BCL2L11      ------------tc------------------gaagttcagtggcc----
A0A2R9C366_BCL2L11      ------------tcagaattgcccttcatagggaagttcagtggcc----
A0A2K5CA89_BCL2L11      ------------tt------gtggtttagatttatatttaccttctttg-
A0A2K5Z7V3_BCL2L11      ------------tt---------gtttggatttatatttactggcttag-
A0A2K6KJP8_BCL2L11      ------------tt------gtggtttggatttatatttactggcttag-
A0A286XJN2_BCL2L11      cac----aggaatt---gcgtcgcatcggagatgagtttaatgcctcgt-
A0A286XJN2_BCL2L11      cac----aggaatt---gcgtcgcatcggagatgagtttaatgcctcgt-
A0A286XJN2_BCL2L11      cac----aggaatt---gcgtcgcatcggagatgagtttaatgcctcgt-
H0XW23_BCL2L11-01       ccc----aagagtt---gcggcgtattggagacgagtttaacgcttact-
A0A1U7T0R1_BCL2L11      cac----aggagtt---gcggcgtatcggagacgagtttaacgcttatt-
A0A1U7T0R1_BCL2L11      -------ggaagtt---gtcgtgtag------------------------
A0A1U7T0R1_BCL2L11      cac----aggagtt---gcggcgtatcggagacgagtttaacgcttatt-
A0A1U7T0R1_BCL2L11      cac----aggagtt---gcggcgtatcggagacgagtttaacgcttatt-
A0A1U7T0R1_BCL2L11      cac----aggagtt---gcggcgtatcggagacgagtttaacgcttatt-
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      -------ggaagtt---gtcgtgtag------------------------
A0A2K6GE31_BCL2L11      cgc----aggagtt---gcggcgtattggagatgagtttaacgcttatt-
A0A2R8M6L7_BCL2L11      ccc----aagagtt---gcggcgtatcggagacgagtttaacgcttatt-
A0A2R8M6L7_BCL2L11      ccc----aagagtt---gcggcgtatcggagacgagtttaacgcttatt-
H2P5E2_BCL2L11-01       ccc----aagagtt---gcggcgtatcggagacgagtttaacgcttact-
A0A2K5Q1Y0_BCL2L11      -------ggaagtt---gtcgtgtag------------------------
A0A2R8M6L7_BCL2L11      ccc----aagagtt---gcggcgtatcggagacgagtttaacgcttatt-
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      ccc----aagagtt---gcggcgtatcggagacgagtttaacgcttatt-
A0A2K5Q1Y0_BCL2L11      ccc----aagagtt---gcggcgtatcggagacgagtttaacgcttatt-
Q6JTU4_BCL2L11-01       ---------------------------ggagacgagtttaacgcttact-
A0A2I3SN61_BCL2L11      ccc----aagagtt---gcggcgtatcggagacgagtttaacgcttact-
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A2K5Z7V3_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A2K6KJP8_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A2K5X1Y3_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A2K6E212_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A2K5NU92_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A096NYC3_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A0D9RWE0_BCL2L11      ccc----aagagtt---gcggcgaatcggagacgagtttaacgcttact-
A0A287DFJ0_BCL2L11      cgc----aggagct---gcggcgaatcggagatgagtttaacctgtatt-
A0A287DFJ0_BCL2L11      cgc----aggagct---gcggcgaatcggagatgagtttaacctgtatt-
G3SU55_BCL2L11-01       cgc----gagagct---acggcgcattggagacgaattcaatgcctact-
C1KGB6_BCL2L11-03       cgc----aggagtt---acggcgtattggagacgaatttaatgcatatt-
C1KGB6_BCL2L11-01       cgc----aggagtt---acggcgtattggagacgaatttaatgcatatt-
C1KGB6_BCL2L11-02       cgc----aggagtt---acggcgtattggagacgaatttaatgcatatt-
C1KGB8_BCL2L11-01       cgc----aggagtt---acggcgtattggagacgaatttaatgcatatt-
A0A250YBV9_BCL2L11      cac----aagagtt---gcgacgtatcggagacgaattcaatgcatatt-
A0A250YBV9_BCL2L11      cac----aagagtt---gcgacgtatcggagacgaattcaatgcatatt-
A0A1S3FFM9_BCL2L11      ccc----aggaatt---gcggcgtattggagacgagtttgatgcctatt-
A0A1S3FFM9_BCL2L11      ccc----aggaatt---gcggcgtattggagacgagtttgatgcctatt-
A0A452U4S4_BCL2L11      ---------------------cgcactg----------------------
U6CTE3_BCL2L11-04       cgc----aggagtt---gcggcgtattggagacgagtttaatgcatatt-
M3YDI3_BCL2L11-01       cgc----aggagtt---gcggcgtattggagacgagtttaatgcgtatt-
U6CTE3_BCL2L11-01       cgc----aggagtt---gcggcgtattggagacgagtttaatgcatatt-
U6CTE3_BCL2L11-03       cgc----aggagtt---gcggcgtattggagacgagtttaatgcatatt-
U6CTE3_BCL2L11-02       cgc----aggagtt---gcggcgtattggagacgagtttaatgcatatt-
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       cac----aagagtt---gcggcgtattggagacgaatttaatgcatatt-
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       cac----aagagtt---gcggcgtattggagacgaatttaatgcatatt-
G1LDR8_BCL2L11-01       cgc----aagagtt---gcggcgtattggagacgaatttaatgcatatt-
A0A452SBG5_BCL2L11      cgc----aagagtt---gcggcgtattggagacgaatttaatgcatatt-
J9NWV6_BCL2L11-01       cac----aagagtt---gcggcgtattggagacgaatttaatgcatatt-
A0A2I2UX96_BCL2L11      cac----aagagtt---gcggcgtatcggagacgaatttaatgcatatt-
A0A2I2UX96_BCL2L11      cac----aagagtt---gcggcgtatcggagacgaatttaatgcatatt-
                                                                          

A0A3G3M2M0_BCL2L11      ctgtcaaggggccggtgcaggt----------------------------
B2KKY9_BCL2L11-01       ctgt---gaggccggagcagga----------------------------
B8JK68_BCL2L11-01       ctgt---gaggccggagcagga----------------------------
A0A3B3QC78_BCL2L11      ----------acataaatggggtgagtatcctactctgtcctcactgtcc
A0A3Q1ELG4_BCL2L11      ctc-----------------------------------------------
A0A3Q1CI15_BCL2L11      --c-----------------------------------------------
A0A3P8RLE2_BCL2L11      --c-----------------------------------------------
A0A3Q3B113_BCL2L11      actt-----ttaaggaggatgg----------------------------
A0A3Q2SZH6_BCL2L11      cat-----------gagaatgg----------------------------
A0A3P9N073_BCL2L11      cat-----------------------------------------------
A0A3B5M375_BCL2L11      ga------------------------------------------------
A0A3B5QAM1_BCL2L11      gatg-----ggaaggaggatgg----------------------------
A0A3B5QAM1_BCL2L11      gatg-----ggaaggaggatgg----------------------------
A0A3B3VNE0_BCL2L11      gatg-----gtaaggaggatgg----------------------------
A0A3B3YII5_BCL2L11      gat-----------gaggatgg----------------------------
A0A3B3YII5_BCL2L11      gat-----------gaggatgg----------------------------
A0A3Q3ESW6_BCL2L11      gct--------atggagaatgg----------------------------
A0A3Q1ICY2_BCL2L11      cct-----------ggaggtgg----------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      tct-----------ggagttgg----------------------------
A0A3P8XIA2_BCL2L11      c---------atacatggggtg----------------------------
A0A3P8XIA2_BCL2L11      c---------atacat-gggcg----------------------------
A0A3B4BVX1_BCL2L11      t---------tttcacggggtg----------------------------
A0A3B4BVX1_BCL2L11      t---------tttcacggggtg----------------------------
M3XHJ5_BCL2L11-01       ----------actcatggtaag--------------------aacccttt
A0A3B1JXK6_BCL2L11      ----------acttccgagggg----------------------------
R4G9R5_BCL2L11-01       ct--------gtccaagaaggg-----------------------gtttc
K7GA86_BCL2L11-01       ct--------gcccaagaaggg-----------------------gtttc
U3IW89_BCL2L11-01       tt--------gtccaagaagggtaattttcttatttttactttccatttc
A0A3Q2U844_BCL2L11      tt--------gtccaagaaggg-----------------------gtttc
G1MV54_BCL2L11-01       tt--------gtccaagaaggg-----------------------gtttc
F7FTC8_BCL2L11-01       tt--------gtccaagaaggg-----------------------gtctc
G3W979_BCL2L11-01       tt--------atccaagaaggg-----------------------gtttt
F7CXT2_BCL2L11-02       tt--------atccaagaaggg-----------------------ggttt
F7CXT2_BCL2L11-01       tt--------atccaagaagg-----------------------------
G1PDJ5_BCL2L11-01       ccgc-----aacccacggaggg-----------------------acttt
O43521_BCL2L11-20       -----------cccaagtag------------------------------
G1SSY0_BCL2L11-01       ----------ctgaaaggtaga-----------------------ggttt
G1SSY0_BCL2L11-02       ----------acccacgcaggg-----------------------ttttt
A0A1U8BW10_BCL2L11      --------------------ag-----------------------t----
A0A1U8BW10_BCL2L11      ----------acagaaggaggg-----------------------t----
A0A1U8BW10_BCL2L11      ----------acagaaggaggg-----------------------t----
O54918_BCL2L11-03       ----------ccacggtga-------------------------------
O54918_BCL2L11-01       ----------acacaaggaggg-----------------------tgttt
O88498_BCL2L11-01       ----------acacgaggaggg-----------------------cgttt
A0A3Q1MV27_BCL2L11      ----------acccaagaaggg-----------------------tcttc
A0A3Q1MV27_BCL2L11      ----------acccaagaaggg-----------------------tcttc
L8IVA4_BCL2L11-02       ----------acccaagaaggg-----------------------tcttc
L8IVA4_BCL2L11-01       ----------acccaagaaggg-----------------------tcttc
W5PY58_BCL2L11-01       ----------atccaagaaggg-----------------------tcttc
A0A452FCR6_BCL2L11      ----------acccaagaaggg-----------------------tcttc
A0A452FCR6_BCL2L11      ----------acccaagaaggg-----------------------tcttc
A0A3Q2GRS5_BCL2L11      ----------acccacggaggc-----------------------tggca
A0A3Q2GRS5_BCL2L11      --------------------gg-----------------------ttgtc
A0A3Q2GRS5_BCL2L11      ----------acccacggaggt-----------------------t----
A0A3Q2GRS5_BCL2L11      ----------acccacggaggg-----------------------tcgtt
A0A3Q2GRS5_BCL2L11      ----------acccacggaggg-----------------------tcgtt
J9NWV6_BCL2L11-06       ----------acccaaggaggg-----------------------taatg
A0A2K6TRU4_BCL2L11      ----------acttgagtg-------------------------------
A0A2I3GVB2_BCL2L11      ----------attcgagtg-------------------------------
A0A2R9C366_BCL2L11      ----------actcaagtg-------------------------------
A0A2K5CA89_BCL2L11      ----------atttgtatg-------------------------------
A0A2K5Z7V3_BCL2L11      ----------atttgtatg-------------------------------
A0A2K6KJP8_BCL2L11      ----------atttgtatgtgg-----------------------tttgg
A0A286XJN2_BCL2L11      ----------acccaaggcggg-----------------------tgttc
A0A286XJN2_BCL2L11      ----------acccaaggcggg-----------------------tgttc
A0A286XJN2_BCL2L11      ----------acccaaggcggg-----------------------tgttc
H0XW23_BCL2L11-01       ----------acccaacgaggg-----------------------tattt
A0A1U7T0R1_BCL2L11      ----------atccgaggagg-----------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      ----------atccgaggagga-----------------------tgccc
A0A1U7T0R1_BCL2L11      ----------atccgaggagg-----------------------------
A0A1U7T0R1_BCL2L11      ----------atccgaggaggg----------------------------
A0A1U7T0R1_BCL2L11      -------------------ggg----------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ----------acccaaggaggg-----------------------tattt
A0A2R8M6L7_BCL2L11      ----------atccaaggaggg-----------------------tattt
A0A2R8M6L7_BCL2L11      ----------atccaaggaggg-----------------------tattt
H2P5E2_BCL2L11-01       ----------atgcaaggaggg-----------------------tattt
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ----------atccaaggaggt-----------------------tagag
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      ----------atccaaggagga-----------------------tatct
A0A2K5Q1Y0_BCL2L11      ----------atccaaggagga-----------------------tatct
Q6JTU4_BCL2L11-01       ----------atgcaaggaggt-----------------------tagag
A0A2I3SN61_BCL2L11      ----------atgcaaggaggt-----------------------tagag
A0A2I3GVB2_BCL2L11      -------------------------------------------------g
A0A2R9C366_BCL2L11      -------------------------------------------------g
A0A2I3SN61_BCL2L11      -------------------------------------------------g
A0A2K5HZI5_BCL2L11      -------------------------------------------------g
A0A2K6QIL2_BCL2L11      -------------------gga-----------------------agttg
A0A2I2YQ13_BCL2L11      -------------------gga-----------------------agttg
A0A2K6QIL2_BCL2L11      -------------------ggg-----------------------tattt
A0A2K5HZI5_BCL2L11      -------------------ggg-----------------------tgttt
A0A2I2YQ13_BCL2L11      -------------------ggg-----------------------tattt
A0A096NYC3_BCL2L11      ----------atgcaaggaggg-----------------------tattt
A0A2K5NU92_BCL2L11      -------------------ggg-----------------------tattt
A0A2K5X1Y3_BCL2L11      -------------------ggg-----------------------tattt
A0A2K6E212_BCL2L11      ----------atgcaaggaggg-----------------------tattt
A0A2K5Z7V3_BCL2L11      ----------atgcaaggaggg-----------------------tattt
A0A2K6KJP8_BCL2L11      ----------atgcaaggaggt-----------------------tagag
A0A2K5X1Y3_BCL2L11      ----------atgcaaggagga-----------------------tgtcg
A0A2K6E212_BCL2L11      ----------atgcaaggagga-----------------------tgtcg
A0A2K5NU92_BCL2L11      ----------atgcaaggaggt-----------------------tagag
A0A096NYC3_BCL2L11      ----------atgcaaggaggt-----------------------tagag
A0A0D9RWE0_BCL2L11      ----------atgcaaggaggt-----------------------tagag
A0A287DFJ0_BCL2L11      ----------acccacggaggg-----------------------tattt
A0A287DFJ0_BCL2L11      ----------acccacggaggg-----------------------tattt
G3SU55_BCL2L11-01       ----------acccaaggaggg-----------------------ctttt
C1KGB6_BCL2L11-03       ----------acccaaggagg----------------------------t
C1KGB6_BCL2L11-01       ----------acccaaggaggg-----------------------tcttt
C1KGB6_BCL2L11-02       ----------acccaaggaggg-----------------------taatg
C1KGB8_BCL2L11-01       ----------acccaaggaggg-----------------------taatg
A0A250YBV9_BCL2L11      ----------acccaaggaggg-----------------------tattt
A0A250YBV9_BCL2L11      ----------acccaaggaggg-----------------------tattt
A0A1S3FFM9_BCL2L11      ----------atccaaggaggg-----------------------tattt
A0A1S3FFM9_BCL2L11      ----------atccaaggaggg-----------------------tattt
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       ----------acccaaggaggc-----------------------tggc-
M3YDI3_BCL2L11-01       ----------acccaaggaggg-----------------------tcttt
U6CTE3_BCL2L11-01       ----------acccaaggaggg-----------------------tcttt
U6CTE3_BCL2L11-03       ----------acccaaggaggt-----------------------t----
U6CTE3_BCL2L11-02       ----------acccaaggaggt-----------------------t----
J9NWV6_BCL2L11-05       ---------------aggaagg-----------------------tgtc-
J9NWV6_BCL2L11-04       ----------acccaaggagg----------------------------t
J9NWV6_BCL2L11-02       -------------------ggg-----------------------tcttt
J9NWV6_BCL2L11-03       ----------acccaaggaggg-----------------------tcttt
G1LDR8_BCL2L11-01       ----------acccaaggaggg-----------------------tcttt
A0A452SBG5_BCL2L11      ----------acccaaggaggg-----------------------tcttt
J9NWV6_BCL2L11-01       ----------acccaaggaggg-----------------------tcttt
A0A2I2UX96_BCL2L11      ----------acccaaggaggg-----------------------tcttt
A0A2I2UX96_BCL2L11      ----------acccaaggaggg-----------------------tcttt
                                                                          

A0A3G3M2M0_BCL2L11      -------gggaacaacagagccca--------------------gctgca
B2KKY9_BCL2L11-01       -------gtgaa---------cca--------------------gctgcg
B8JK68_BCL2L11-01       -------gtgaa---------cca--------------------gctgca
A0A3B3QC78_BCL2L11      tcttcggccaactgctatgggccaaggggcaacactgactccttaccctg
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      -------caggccgacccagacgaaacatcgttcctc---tgaacctcct
A0A3Q2SZH6_BCL2L11      -------cgggacgacaacaacgagatatggtccctc---taaacctgat
A0A3P9N073_BCL2L11      ----------gcgacttccatcggtataaa--------------------
A0A3B5M375_BCL2L11      -------------aacatcaac--aacatggg------------------
A0A3B5QAM1_BCL2L11      -------cgagaggacaccaacggaatatagtccctc---taaacctgat
A0A3B5QAM1_BCL2L11      -------cgagaggacaccaacggaatatagtccctc---taaacctgat
A0A3B3VNE0_BCL2L11      -------cgagaagacaccaacggaatatagtccctc---taaacctgat
A0A3B3YII5_BCL2L11      -------cgagaagacaccaacggaatatagtccctc---taaacctgat
A0A3B3YII5_BCL2L11      -------cgagaagacaccaacggaatatagtccctc---taaacctgat
A0A3Q3ESW6_BCL2L11      -------caggtagacatggtcggcctgaggtccatc---caaacccgca
A0A3Q1ICY2_BCL2L11      -------caggcagacatagatgggtggggatccaac---caatccgatt
A0A3B4V919_BCL2L11      ---------------cagtgctgccaa-----------------------
A0A3B4XZH1_BCL2L11      ---------------c----ctgttaaggg--------------------
A0A3Q3SYA1_BCL2L11      --------------acgta----------g--------------------
A0A3Q3K6I5_BCL2L11      -------cagacagacgtagacgggttgtg--------------------
A0A3P8XIA2_BCL2L11      -agtggttgcagtaaaatgcctgt---------gttg---cat-------
A0A3P8XIA2_BCL2L11      -tcttggggcaa-gaaatggtcag---------gttg---cccaag----
A0A3B4BVX1_BCL2L11      ------------------agtcag--------------------------
A0A3B4BVX1_BCL2L11      ------------------agtcag--------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      ----------------caggcagaaatggaggtggtg---cccaacttcc
R4G9R5_BCL2L11-01       -------ttgg-----attaccaa---------gcag---taa-------
K7GA86_BCL2L11-01       -------ttggataatcaagcaat--------------------------
U3IW89_BCL2L11-01       -------tt---tacacttagtgc--------------------------
A0A3Q2U844_BCL2L11      -------ttggataaccgtgctgg--------------------------
G1MV54_BCL2L11-01       -------ttggataaccatgctgg--------------------------
F7FTC8_BCL2L11-01       -------ttggata--ataataat---------ccgg---caggaa----
G3W979_BCL2L11-01       ------ttggataataactatcaa---------gcag---cagatg----
F7CXT2_BCL2L11-02       ------ttggataataactatcaa---------ggag---caggtg----
F7CXT2_BCL2L11-01       ------------------------------------g---cag-------
G1PDJ5_BCL2L11-01       -------ctgaatg--tttaccgg---------gaag---cagaag----
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       tccatcagctggttgcttccccagatgcccaccacgg---cctggactgg
G1SSY0_BCL2L11-02       -------ttgaata--attaccca---------gcag---cggagg----
A0A1U8BW10_BCL2L11      ---------aaa--------------------------------------
A0A1U8BW10_BCL2L11      ---------aaata--attaccaa---------gagg---atgaagacca
A0A1U8BW10_BCL2L11      ---------aaata--attaccaa---------gagg---atgaagacca
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       -------gcaaatg--attaccgc---------gagg---ctgaag----
O88498_BCL2L11-01       -------gcaaacg--attaccga---------gagg---cggaag----
A0A3Q1MV27_BCL2L11      gtgc------------gtcaccag---------gcag---ttgagg----
A0A3Q1MV27_BCL2L11      gtgc------------gtcaccag---------gcag---ttgagg----
L8IVA4_BCL2L11-02       gtgc------------gtcaccag---------gcag---ttgagg----
L8IVA4_BCL2L11-01       gtgc------------gtcaccag---------gcag---ttgagg----
W5PY58_BCL2L11-01       gtgc------------gtcaccag---------gcga---ttgagg----
A0A452FCR6_BCL2L11      gtgc------------gtcaccag---------gcga---ttgagg----
A0A452FCR6_BCL2L11      gtgc------------gtcaccag---------gcga---ttgagg----
A0A3Q2GRS5_BCL2L11      -------ca-----------------------------------------
A0A3Q2GRS5_BCL2L11      -------gt-----------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      -------ttgaatc--atcaccaa---------gcag---ctgaag----
A0A3Q2GRS5_BCL2L11      -------ttgaatc--atcaccaa---------gcag---ctgaag----
J9NWV6_BCL2L11-06       atgttttatttactacttctcctc---------acac---cctccc----
A0A2K6TRU4_BCL2L11      ----------gttagcaaaatcaa---------gctg-------------
A0A2I3GVB2_BCL2L11      ----------gttagcaaaatcaa---------gcta-------------
A0A2R9C366_BCL2L11      ----------gttagcaaaatcaa---------gcta-------------
A0A2K5CA89_BCL2L11      -------gccaccaccacagtcaa---------ggta---cagaac----
A0A2K5Z7V3_BCL2L11      -------gccaccaccacagtcaa---------gata---cagaac----
A0A2K6KJP8_BCL2L11      atttatatttaccaccacagtcaa---------gata---cagaac----
A0A286XJN2_BCL2L11      -------ttgaatc--attaccag---------cccg---ctgaag----
A0A286XJN2_BCL2L11      -------ttgaatc--attaccag---------cccg---ctgaag----
A0A286XJN2_BCL2L11      -------ttgaatc--attaccag---------cccg---ctgaag----
H0XW23_BCL2L11-01       -------ttgcata--attaccaa---------gcag---ccgaag----
A0A1U7T0R1_BCL2L11      -------ctggcaa--aaaaccta---------gcat---cctcct----
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      tttccacctgatta--a---------------------------------
A0A1U7T0R1_BCL2L11      ---ttagagaaata--g---------------------------------
A0A1U7T0R1_BCL2L11      --cttatttgaata--ataaccaa---------gcag---ccgaag----
A0A1U7T0R1_BCL2L11      --cttatttgaata--a---------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      -------ttgaata--attaccaa---------gccg---acgaag----
A0A2R8M6L7_BCL2L11      -------ttgaata--attaccaa---------gcag---ctgaag----
A0A2R8M6L7_BCL2L11      -------ttgaata--attaccaa---------gcag---ctgaag----
H2P5E2_BCL2L11-01       -------ttgaata--attaccaa---------gcag---ccgaag----
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ---------aaata--g---------------------------------
A0A2K6TRU4_BCL2L11      ---------gacta--g---------------------------------
A0A2K5CA89_BCL2L11      cttccatctgattg--a---------------------------------
A0A2K5Q1Y0_BCL2L11      cttccatctgattg--a---------------------------------
Q6JTU4_BCL2L11-01       ---------aaata--g---------------------------------
A0A2I3SN61_BCL2L11      ---------aaata--g---------------------------------
A0A2I3GVB2_BCL2L11      ---------gacta--g---------------------------------
A0A2R9C366_BCL2L11      ---------gacta--g---------------------------------
A0A2I3SN61_BCL2L11      ---------gacta--g---------------------------------
A0A2K5HZI5_BCL2L11      ---------gacta--g---------------------------------
A0A2K6QIL2_BCL2L11      -------tcgtgta--g---------------------------------
A0A2I2YQ13_BCL2L11      -------tcgtgta--g---------------------------------
A0A2K6QIL2_BCL2L11      -------ttgaata--a---------------------------------
A0A2K5HZI5_BCL2L11      -------ttgaata--a---------------------------------
A0A2I2YQ13_BCL2L11      -------ttgaata--a---------------------------------
A0A096NYC3_BCL2L11      -------ttgaata--attaccaa---------gcag---ccgaag----
A0A2K5NU92_BCL2L11      -------ttgaata--a---------------------------------
A0A2K5X1Y3_BCL2L11      -------ttgaata--a---------------------------------
A0A2K6E212_BCL2L11      -------ttgaata--attaccaa---------gcag---ccgaag----
A0A2K5Z7V3_BCL2L11      -------ttgaata--attaccaa---------gcag---ccgaag----
A0A2K6KJP8_BCL2L11      ---------aaata--g---------------------------------
A0A2K5X1Y3_BCL2L11      cttccacctgatta--a---------------------------------
A0A2K6E212_BCL2L11      cttccacctgatta--a---------------------------------
A0A2K5NU92_BCL2L11      ---------aaata--g---------------------------------
A0A096NYC3_BCL2L11      ---------aaata--g---------------------------------
A0A0D9RWE0_BCL2L11      ---------aaata--g---------------------------------
A0A287DFJ0_BCL2L11      -------tttaata--attacca------------ac---ctgaag----
A0A287DFJ0_BCL2L11      -------tttaata--attacca------------ac---ctgaag----
G3SU55_BCL2L11-01       -------ttgaata--attaccaa---------gcag---ccgaag----
C1KGB6_BCL2L11-03       -------tagaaca--atag------------------------------
C1KGB6_BCL2L11-01       -------ctgaata--attaccaa---------gcag---ccgaag----
C1KGB6_BCL2L11-02       -------ctgtttt--cttt------------------------------
C1KGB8_BCL2L11-01       -------ctgtttt--cttt------------------------------
A0A250YBV9_BCL2L11      -------ttgaata--attaccaa---------ggag---tggaag----
A0A250YBV9_BCL2L11      -------ttgaata--attaccaa---------ggag---tggaag----
A0A1S3FFM9_BCL2L11      -------ttgaata--attaccaa---------gcag---ccgaag----
A0A1S3FFM9_BCL2L11      -------ttgaata--attaccaa---------gcag---ccgaag----
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       ----------aaga--attcc-----------------------------
M3YDI3_BCL2L11-01       -------ttgaata--attaccca---------gcag---ccgaag----
U6CTE3_BCL2L11-01       -------ttgaata--attaccca---------gcag---cagaag----
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       -------tagagca--atag------------------------------
J9NWV6_BCL2L11-02       -------ttgaata--a---------------------------------
J9NWV6_BCL2L11-03       -------ttgaata--attaccaa---------gcag---ccgaag----
G1LDR8_BCL2L11-01       -------ctgaata--attaccaa---------gcag---ccgaag----
A0A452SBG5_BCL2L11      -------ttgaata--attaccaa---------gcag---ccgaag----
J9NWV6_BCL2L11-01       -------ttgaata--attaccaa---------gcag---ccgaag----
A0A2I2UX96_BCL2L11      -------ttgaata--attaccaa---------gcag---ccgaag----
A0A2I2UX96_BCL2L11      -------ttgaata--attaccaa---------gcag---ccgaag----
                                                                          

A0A3G3M2M0_BCL2L11      tgctcccaatgaacacgccatcatcatgtggatgaacgacct--------
B2KKY9_BCL2L11-01       tgctcccaacgaacacgccatcgtcctgtggatgaacgtcat--------
B8JK68_BCL2L11-01       tgctcccaacgaacacgccatcgtcctgtggatgaacgacat--------
A0A3B3QC78_BCL2L11      gggacaacaagaacaaagagtcacccctaagatccagatcttcctg----
A0A3Q1ELG4_BCL2L11      -----------------------tcgccattgtctgtccttgtctt----
A0A3Q1CI15_BCL2L11      -----------------------acgctgttttctgtcactgtttt----
A0A3P8RLE2_BCL2L11      -----------------------acgctgttttctgtcactgtttt----
A0A3Q3B113_BCL2L11      gccacacatccaccaggagcctgtcgccatgctctgcgtgagcctc----
A0A3Q2SZH6_BCL2L11      gccacacatccagcaggagcctgttgccatgctctgtgtcggcctc----
A0A3P9N073_BCL2L11      -----aaaaagaaaaagagtaggatatgatgatgattattatcatt----
A0A3B5M375_BCL2L11      -----------aacaaatagctgtta---------atatcggc-------
A0A3B5QAM1_BCL2L11      gccgcacatccagcaagagcctgttgccatgctttgtgtctgcctt----
A0A3B5QAM1_BCL2L11      gccgcacatccagcaagagcctgttgccatgctttgtgtctgcctt----
A0A3B3VNE0_BCL2L11      gccgcacatccagcaagagcctgttgccatgctttgtgtctgcctt----
A0A3B3YII5_BCL2L11      gccacacatccagcaagagcctgttgccatgctttgtgtctgcctt----
A0A3B3YII5_BCL2L11      gccacacatccagcaagagcctgttgccatgctttgtgtctgcctt----
A0A3Q3ESW6_BCL2L11      gccgcacatccaaccggagcccaccatgctgctgtgtacgggtctc----
A0A3Q1ICY2_BCL2L11      accacatatccaccaggaccccactgtcctgctctgcgtgggcctc----
A0A3B4V919_BCL2L11      ---acccatttctgctga--------------------------------
A0A3B4XZH1_BCL2L11      -tcagtcatcacagatggtgtgtgtgtgtgtgtgtgtgtgtgtgtg----
A0A3Q3SYA1_BCL2L11      -tcgcttattcac-------------------------tgcccatg----
A0A3Q3K6I5_BCL2L11      -ccgcgtatccaccaggaactcaccatcgtgctctgcgtgggcatc----
A0A3P8XIA2_BCL2L11      ----caccttatttacaaaccatatcaaggaccg-------cactg----
A0A3P8XIA2_BCL2L11      --caaaccttcctcagatgc---accaagaacctgcctttctactgtgga
A0A3B4BVX1_BCL2L11      ------------ctgcatgggtgcgttgctggtatgc-aagcgttg----
A0A3B4BVX1_BCL2L11      ------------ctgcatgggtgcgttgctggtatgc-aagcgttg----
M3XHJ5_BCL2L11-01       --------------------------------------gaacttta----
A0A3B1JXK6_BCL2L11      tgcacaaaatgaacccgccttcatactgtggatg----gggctcct----
R4G9R5_BCL2L11-01       --------accatcagatcataattttgcgcctg----ttacatta----
K7GA86_BCL2L11-01       -aa-----accaccaaattg---ttttgcgcttg----ttgcatta----
U3IW89_BCL2L11-01       -cacgtctacctcca------cctttcccgcgtccaggcagtgttg----
A0A3Q2U844_BCL2L11      -aa-----acccccaggttgtcattctgcgcctc----ctgcatta----
G1MV54_BCL2L11-01       -aa-----acccccaggtggtcattctgcgcctc----ctgcatta----
F7FTC8_BCL2L11-01       -----acaaccaccaaatgggttttgtgcacctg----ttacgtta----
G3W979_BCL2L11-01       -----atcatcaccaaatggttattttacggcta----ttacatta----
F7CXT2_BCL2L11-02       -----accatcaccaaatggttattttacgcctg----ttacgtta----
F7CXT2_BCL2L11-01       --------------------------------tg----tggcattg----
G1PDJ5_BCL2L11-01       -----gccacccccagatggtggtcttacgactg----ttgcgtta----
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       actgggccaggccaaagccaggagcctggaact-----tggctctg----
G1SSY0_BCL2L11-02       -----agcagccccaaatggttatcttgcgactg----ttgcgtta----
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      ccctcaccaccctcaaatggttatcttacaactg----ttacgctt----
A0A1U8BW10_BCL2L11      ccctcaccaccctcaaatggttatcttacaactg----ttacgctt----
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       -----accaccctcaaatggttatcttacaactg----ttacgctt----
O88498_BCL2L11-01       -----accacccgcaaatggttatcttacaactg----ttacgatt----
A0A3Q1MV27_BCL2L11      -----gccacccgcaaatggtcctcttgcgcgtc----ttgcgcta----
A0A3Q1MV27_BCL2L11      -----gccacccgcaaatggtcctcttgcgcgtc----ttgcgcta----
L8IVA4_BCL2L11-02       -----gccacccgcaaatggtcctcttgcgcgtc----ttgcgcta----
L8IVA4_BCL2L11-01       -----gccacccgcaaatggtcctcttgcgcgtc----ttgcgcta----
W5PY58_BCL2L11-01       -----gccacccacaaatggtcctcctgcgcgtc----ttgcgcta----
A0A452FCR6_BCL2L11      -----gccacccacaaatggtcctcctgcgcgtc----ttgcgcta----
A0A452FCR6_BCL2L11      -----gccacccacaaatggtcctcctgcgcgtc----ttgcgcta----
A0A3Q2GRS5_BCL2L11      ---------------------------atgcctg----gcattcta----
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      -----cccacccccaaatgatcatcttgcgactg----ttacgtta----
A0A3Q2GRS5_BCL2L11      -----cccacccccaaatgatcatcttgcgactg----ttacgtta----
J9NWV6_BCL2L11-06       -----cctccccacaattttttttctttaaggtt----actagtaa----
A0A2K6TRU4_BCL2L11      ------------------------------a-------------------
A0A2I3GVB2_BCL2L11      ------------------------------a-------------------
A0A2R9C366_BCL2L11      ------------------------------a-------------------
A0A2K5CA89_BCL2L11      -----aactccaccacaagtatttctcatga-------------------
A0A2K5Z7V3_BCL2L11      -----aactcaaccacaaggatttctcatga-------------------
A0A2K6KJP8_BCL2L11      -----aactcaaccacagggatttctcatga-------------------
A0A286XJN2_BCL2L11      -----accaaccccaaatggttatcttgcgattg----ttacgtta----
A0A286XJN2_BCL2L11      -----accaaccccaaatggttatcttgcgattg----ttacgtta----
A0A286XJN2_BCL2L11      -----accaaccccaaatggttatcttgcgattg----ttacgtta----
H0XW23_BCL2L11-01       -----accaccctcaaatggttatattacgactg----ttgcgtta----
A0A1U7T0R1_BCL2L11      -----cttga----------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      -----atcacccacaaatggttctcttacgactg----ttacgtta----
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      -----accaccctcaaatgcttatcttgcgactg----ttacgtta----
A0A2R8M6L7_BCL2L11      -----accacccacacatggttatcttacgactg----ttacgtta----
A0A2R8M6L7_BCL2L11      -----accacccacacatggttatcttacgactg----ttacgtta----
H2P5E2_BCL2L11-01       -----accacccacgaatggttatcttacgactg----ttacgtta----
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      -----accacccacaaatggttatcttacgactg----ttgcgtta----
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      -----accacccacaaatggttatcttacgactg----ttgcgtta----
A0A2K5Z7V3_BCL2L11      -----accacccacaaatggttatcttacgactg----ttgcgtta----
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      -----accgcccccaaatggttatcttgcgcctg----ttgcgttg----
A0A287DFJ0_BCL2L11      -----accgcccccaaatggttatcttgcgcctg----ttgcgttg----
G3SU55_BCL2L11-01       -----accaccctcaaatggttatcttacgtctc----ttacgcta----
C1KGB6_BCL2L11-03       --------------------------------------------------
C1KGB6_BCL2L11-01       -----cccaccctcagatggttatcttacgactg----ttacgcta----
C1KGB6_BCL2L11-02       --------accccc---------cttttcccctc----acaccctc----
C1KGB8_BCL2L11-01       --------accccc---------cttttcccctc----acaccctc----
A0A250YBV9_BCL2L11      -----accacccccaaatggttatcttacgactg----ttacgtta----
A0A250YBV9_BCL2L11      -----accacccccaaatggttatcttacgactg----ttacgtta----
A0A1S3FFM9_BCL2L11      -----accaaccccaaatggttatcttacggctg----ttacgtta----
A0A1S3FFM9_BCL2L11      -----accaaccccaaatggttatcttacggctg----ttacgtta----
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       -------------------agcatcctgcctctg----c-----------
M3YDI3_BCL2L11-01       -----cccacccccaaatgattatcttacgactg----ttacgtta----
U6CTE3_BCL2L11-01       -----cccacccccaaatgattatcttacgactg----ttacgtta----
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       -----cccacccccaaatgattatcttacgactg----ttacgtta----
G1LDR8_BCL2L11-01       -----cccacccccaaatgattatcttgcgactg----ttacgtta----
A0A452SBG5_BCL2L11      -----cccacccccaaatgattatcttgcgactg----ttacgtta----
J9NWV6_BCL2L11-01       -----cccacccccaaatgattatcttacgactg----ttacgtta----
A0A2I2UX96_BCL2L11      -----cccagccccaaatgattatcttacgactg----ttacgtta----
A0A2I2UX96_BCL2L11      -----cccagccccaaatgattatcttacgactg----ttacgtta----
                                                                          

A0A3G3M2M0_BCL2L11      ----------tatcggacgtgtagtacagtttttcctgcgaagaag----
B2KKY9_BCL2L11-01       ----------tatcggacgcctagtacactttttcctgcgaagaag----
B8JK68_BCL2L11-01       ----------tatcggacgcctagtacactttttcctgcgaagaag----
A0A3B3QC78_BCL2L11      -------------------gctccatgttagaatgggggaagtggagcaa
A0A3Q1ELG4_BCL2L11      --------------------ctgtcatttttgttca-----------ctg
A0A3Q1CI15_BCL2L11      --------------------ctgtcatcttcagtcg-----------ctg
A0A3P8RLE2_BCL2L11      --------------------ctgtcatcttcagtcg-----------ctg
A0A3Q3B113_BCL2L11      --------------------ctgctcctcctgattggacggctc---atg
A0A3Q2SZH6_BCL2L11      --------------------ttgctcctcctgattggacgaata---atg
A0A3P9N073_BCL2L11      ----------actacatagattgtttcttttta------aaatcagtaag
A0A3B5M375_BCL2L11      --------------------ccagttttatttatcaggccgataccgatg
A0A3B5QAM1_BCL2L11      --------------------ctgctcctcctggtcggacgaata---atg
A0A3B5QAM1_BCL2L11      --------------------ctgctcctcctggtcggacgaata---atg
A0A3B3VNE0_BCL2L11      --------------------ctgctcctcctggtcggacgaata---atg
A0A3B3YII5_BCL2L11      --------------------ctgctcctcctggtcggacgaata---atg
A0A3B3YII5_BCL2L11      --------------------ctgctcctcctggtcggacgaata---atg
A0A3Q3ESW6_BCL2L11      --------------------atgatccttctgattggatggatt---atc
A0A3Q1ICY2_BCL2L11      --------------------ctgctctttgtgattggacggata---atc
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------cgtgcgggtgtgtgtgtgcgtgcg---gg-
A0A3Q3SYA1_BCL2L11      --------------------ctg---------------------------
A0A3Q3K6I5_BCL2L11      --------------------ctggtccttgtgattggtcagata---at-
A0A3P8XIA2_BCL2L11      ---------------------tatta-----aattgagctga--------
A0A3P8XIA2_BCL2L11      tgggcctcctgattggtcgactattacagatcatttggcggagaag----
A0A3B4BVX1_BCL2L11      ----------agtgctcgagat--ctgcacgatc----aaatgtttgctt
A0A3B4BVX1_BCL2L11      ----------agtaatcctgttgccttttcaatcctggggctttttcgtg
M3XHJ5_BCL2L11-01       ----------cataa-----------------------------------
A0A3B1JXK6_BCL2L11      ----------gattgaacgtctccgacagttcctccacagaagaag----
R4G9R5_BCL2L11-01       ----------cattgtccgcttc---------atttggagaatgca----
K7GA86_BCL2L11-01       ----------catcatccgcctc---------atttggagaatgca----
U3IW89_BCL2L11-01       ----------caggaggtg-ttt---------gtctcgtgggtgct----
A0A3Q2U844_BCL2L11      ----------catcatccgcctc---------atctggaggatgca----
G1MV54_BCL2L11-01       ----------catcatccgcctc---------atctggaggatgca----
F7FTC8_BCL2L11-01       ----------catcatccgccgc---------gtttggagactgca----
G3W979_BCL2L11-01       ----------catcatccgcctt---------gtttggagaatgca----
F7CXT2_BCL2L11-02       ----------catcatccgcctt---------gtttggagaatgca----
F7CXT2_BCL2L11-01       ----------tttcaagagctttgggattggagttggaagtcagct----
G1PDJ5_BCL2L11-01       ----------catcctccgtctg---------gtgtggaggaggatg---
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       ----------agtctcccgcctg---------ggtggcagggaccgag--
G1SSY0_BCL2L11-02       ----------catcgtgcgcctg---------gtgtggaggatgca----
A0A1U8BW10_BCL2L11      ----------------------a---------gt----------------
A0A1U8BW10_BCL2L11      ----------catcgtccgacta---------gtatggagaaggca----
A0A1U8BW10_BCL2L11      ----------catcgtccgacta---------gtatggagaaggca----
O54918_BCL2L11-03       -----------------tgcctg---------gtaca--------a----
O54918_BCL2L11-01       ----------tatcttccgtctg---------gtatggagaaggca----
O88498_BCL2L11-01       ----------catcttccgtctg---------gtctggagaaggca----
A0A3Q1MV27_BCL2L11      ----------catcgtgcgtctg---------gtgtggaggatgca----
A0A3Q1MV27_BCL2L11      ----------catcgtgcgtctg---------gtgtggaggatgca----
L8IVA4_BCL2L11-02       ----------catcgtgcgtctg---------gtgtggaggatgca----
L8IVA4_BCL2L11-01       ----------catcgtgcgtctg---------gtgtggaggatgca----
W5PY58_BCL2L11-01       ----------cctggtgcgtctg---------gtgtggaggatgca----
A0A452FCR6_BCL2L11      ----------cctggtgcgtctg---------gtgtggaggatgca----
A0A452FCR6_BCL2L11      ----------cctggtgcgtctg---------gtgtggaggatgca----
A0A3Q2GRS5_BCL2L11      ----------cacc------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------aga--gca----
A0A3Q2GRS5_BCL2L11      ----------catcatccgcctg---------gtacggagactgca----
A0A3Q2GRS5_BCL2L11      ----------catcatccgcctg---------gtacggagactgca----
J9NWV6_BCL2L11-06       ----------aaattccatactt---------attctggaaatgcaaggt
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      ----------cattatccgcctg---------gtatggcgaatgca----
A0A286XJN2_BCL2L11      ----------cattatccgcctg---------gtatggcgaatgca----
A0A286XJN2_BCL2L11      ----------cattatccgcctg---------gtatggcgaatgca----
H0XW23_BCL2L11-01       ----------catcgtccgcctg---------gtgtggaggctgca----
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      ----------cattgtccgcctg---------gtatggagaatgta----
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ----------cattgtccgcctg---------gtgtggaggaggca----
A0A2R8M6L7_BCL2L11      ----------cattgtccgcctg---------gtgtggagaatgca----
A0A2R8M6L7_BCL2L11      ----------cattgtccgcctg---------gtgtggagaatgca----
H2P5E2_BCL2L11-01       ----------cattgtccgcctg---------gtatggagaatgca----
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ----------cattgtccgcctg---------gtgtggaggatgca----
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      ----------cattgtccgcctg---------gtgtggagaatgca----
A0A2K5Z7V3_BCL2L11      ----------cattgtccgcctg---------gtgtggagaatgca----
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      ----------catcatccgcctg---------gtgtggaggatgca----
A0A287DFJ0_BCL2L11      ----------catcatccgcctg---------gtgtggaggatgca----
G3SU55_BCL2L11-01       ----------catcgtccgcctg---------gtgtggaga---------
C1KGB6_BCL2L11-03       --------------------------------------------------
C1KGB6_BCL2L11-01       ----------catcgcccgtctg---------gtgtggaggatgca----
C1KGB6_BCL2L11-02       ----------cctcccccttaca---------tt----------------
C1KGB8_BCL2L11-01       ----------cctcccccttaca---------tt----------------
A0A250YBV9_BCL2L11      ----------catcatccgtctg---------gtgtggagaatgca----
A0A250YBV9_BCL2L11      ----------catcatccgtctg---------gtgtggagaatgca----
A0A1S3FFM9_BCL2L11      ----------catcattcgcctg---------gtgtggagaatgca----
A0A1S3FFM9_BCL2L11      ----------catcattcgcctg---------gtgtggagaatgca----
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ----------catcatccgcctg---------gtgtggagattaca----
U6CTE3_BCL2L11-01       ----------catcatccgcctg---------gtgtggagattgca----
U6CTE3_BCL2L11-03       --------------------------------------aga--gca----
U6CTE3_BCL2L11-02       --------------------------------------aga--gca----
J9NWV6_BCL2L11-05       --------------------------------gtgtag------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       ----------catcgtccgcctg---------gtgtggagattgca----
G1LDR8_BCL2L11-01       ----------catcgtccgcctg---------gtgtggagattgca----
A0A452SBG5_BCL2L11      ----------catcatccgcctg---------gtgtggagattgca----
J9NWV6_BCL2L11-01       ----------catcgtccgcctg---------gtgtggagattgca----
A0A2I2UX96_BCL2L11      ----------catcgtccgcctg---------gtatggcgattgca----
A0A2I2UX96_BCL2L11      ----------catcgtccgcctg---------gtatggcgattgca----
                                                                          

A0A3G3M2M0_BCL2L11      -----------atga-----------------------------------
B2KKY9_BCL2L11-01       -----------atga-----------------------------------
B8JK68_BCL2L11-01       -----------atga-----------------------------------
A0A3B3QC78_BCL2L11      caggaaatagtatga-----------------------------------
A0A3Q1ELG4_BCL2L11      tttgctttcgtttctgcaacaaa-----------------------cgag
A0A3Q1CI15_BCL2L11      tttg----cgtctacgctacaaaac-------------gtcttgattagg
A0A3P8RLE2_BCL2L11      tttg----cgtctacgctacaaaac-------------gtcttgattagg
A0A3Q3B113_BCL2L11      tacttacaaggctgcacaaacagcc--------aga--ataattctcagg
A0A3Q2SZH6_BCL2L11      tacttgcaaggcagtacaaacagcc--------atg--accactctcagg
A0A3P9N073_BCL2L11      taaatacgacgtggcatag-------------------------------
A0A3B5M375_BCL2L11      ttagtgc-cgatatatcatgcatcc--------acgttaagaatctcagc
A0A3B5QAM1_BCL2L11      tacatgcaaggcaacacaagcagcc--------atg--accactctcagg
A0A3B5QAM1_BCL2L11      tacatgcaaggcaacacaagcagcc--------atg--accactctcagg
A0A3B3VNE0_BCL2L11      tacatgcaaggcaacacaagcagcc--------acg--accactctcagg
A0A3B3YII5_BCL2L11      tacatgcaaggcaacacaagcagcc--------acg--accactctcagg
A0A3B3YII5_BCL2L11      tacatgcaaggcaacacaagcagcc--------acg--accactctcagg
A0A3Q3ESW6_BCL2L11      tacttgcgaggcaatacaaacagcc--------atg--accactctcagg
A0A3Q1ICY2_BCL2L11      tactcgcaaggcagtacgaacagcg--------agg--gccactctcacg
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --tgtgtgtgcgggtgtgtgcgggtgtgtggtggtg--gagggggggtag
A0A3Q3SYA1_BCL2L11      ------------aatacacgcaggt--------aaa--gcagc-------
A0A3Q3K6I5_BCL2L11      --cttgcaaggcagtataaacagcc--------agg--acaactctcagg
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      -----------ataa-----------------------------------
A0A3B4BVX1_BCL2L11      taag-------ctaa-----------------------------------
A0A3B4BVX1_BCL2L11      gaca-------ctga-----------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      -----------atga-----------------------------------
R4G9R5_BCL2L11-01       -----------gtga-----------------------------------
K7GA86_BCL2L11-01       -----------gtaa-----------------------------------
U3IW89_BCL2L11-01       -----------gtgcagttgggaattaaagtcactttttttaccctgttt
A0A3Q2U844_BCL2L11      -----------gtga-----------------------------------
G1MV54_BCL2L11-01       -----------gtga-----------------------------------
F7FTC8_BCL2L11-01       -----------gtga-----------------------------------
G3W979_BCL2L11-01       -----------gtga-----------------------------------
F7CXT2_BCL2L11-02       -----------gtga-----------------------------------
F7CXT2_BCL2L11-01       -----------ttga-----------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       -----------ctag-----------------------------------
G1SSY0_BCL2L11-02       -----------ttga-----------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      -----------ttga-----------------------------------
A0A1U8BW10_BCL2L11      -----------ttga-----------------------------------
O54918_BCL2L11-03       -----------ctga-----------------------------------
O54918_BCL2L11-01       -----------ttga-----------------------------------
O88498_BCL2L11-01       -----------ctga-----------------------------------
A0A3Q1MV27_BCL2L11      -----------gtga-----------------------------------
A0A3Q1MV27_BCL2L11      -----------gtga-----------------------------------
L8IVA4_BCL2L11-02       -----------gtga-----------------------------------
L8IVA4_BCL2L11-01       -----------gtga-----------------------------------
W5PY58_BCL2L11-01       -----------gtga-----------------------------------
A0A452FCR6_BCL2L11      -----------gtga-----------------------------------
A0A452FCR6_BCL2L11      -----------gtga-----------------------------------
A0A3Q2GRS5_BCL2L11      ------------tga-----------------------------------
A0A3Q2GRS5_BCL2L11      -----------gtag-----------------------------------
A0A3Q2GRS5_BCL2L11      -----------atag-----------------------------------
A0A3Q2GRS5_BCL2L11      -----------gtga-----------------------------------
A0A3Q2GRS5_BCL2L11      -----------gtga-----------------------------------
J9NWV6_BCL2L11-06       attacctatatgtga-----------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      -----------ttga-----------------------------------
A0A286XJN2_BCL2L11      -----------ttga-----------------------------------
A0A286XJN2_BCL2L11      -----------ttga-----------------------------------
H0XW23_BCL2L11-01       -----------ctga-----------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      -----------ttga-----------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      -----------ttga-----------------------------------
A0A2R8M6L7_BCL2L11      -----------ttga-----------------------------------
A0A2R8M6L7_BCL2L11      -----------ttga-----------------------------------
H2P5E2_BCL2L11-01       -----------ttga-----------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      -----------ttga-----------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      -----------ttga-----------------------------------
A0A2K5Z7V3_BCL2L11      -----------ttga-----------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      -----------ctga-----------------------------------
A0A287DFJ0_BCL2L11      -----------ctga-----------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       --------------------------------------------------
C1KGB6_BCL2L11-01       -----------gtga-----------------------------------
C1KGB6_BCL2L11-02       ------------taa-----------------------------------
C1KGB8_BCL2L11-01       ------------taa-----------------------------------
A0A250YBV9_BCL2L11      -----------ttga-----------------------------------
A0A250YBV9_BCL2L11      -----------ttga-----------------------------------
A0A1S3FFM9_BCL2L11      -----------ttga-----------------------------------
A0A1S3FFM9_BCL2L11      -----------ttga-----------------------------------
A0A452U4S4_BCL2L11      ------------tga-----------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       -----------gtga-----------------------------------
U6CTE3_BCL2L11-01       -----------gtga-----------------------------------
U6CTE3_BCL2L11-03       -----------atag-----------------------------------
U6CTE3_BCL2L11-02       -----------atag-----------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       -----------gtga-----------------------------------
G1LDR8_BCL2L11-01       -----------gtga-----------------------------------
A0A452SBG5_BCL2L11      -----------gtga-----------------------------------
J9NWV6_BCL2L11-01       -----------gtga-----------------------------------
A0A2I2UX96_BCL2L11      -----------gtga-----------------------------------
A0A2I2UX96_BCL2L11      -----------gtga-----------------------------------
                                                                          

A0A3G3M2M0_BCL2L11      ---------------------------------------------
B2KKY9_BCL2L11-01       ---------------------------------------------
B8JK68_BCL2L11-01       ---------------------------------------------
A0A3B3QC78_BCL2L11      ---------------------------------------------
A0A3Q1ELG4_BCL2L11      ttaaataa-------------------------------------
A0A3Q1CI15_BCL2L11      tttattaacccaaactacttcagtacattttggaacagatgttaa
A0A3P8RLE2_BCL2L11      tttattaacccaaactacttcagtacattttggaaaagatgttaa
A0A3Q3B113_BCL2L11      tttag----------------------------------------
A0A3Q2SZH6_BCL2L11      tttag----------------------------------------
A0A3P9N073_BCL2L11      ---------------------------------------------
A0A3B5M375_BCL2L11      tctcgagtaa-----------------------------------
A0A3B5QAM1_BCL2L11      tttag----------------------------------------
A0A3B5QAM1_BCL2L11      tttag----------------------------------------
A0A3B3VNE0_BCL2L11      tttag----------------------------------------
A0A3B3YII5_BCL2L11      tttag----------------------------------------
A0A3B3YII5_BCL2L11      tttag----------------------------------------
A0A3Q3ESW6_BCL2L11      tgtag----------------------------------------
A0A3Q1ICY2_BCL2L11      tttag----------------------------------------
A0A3B4V919_BCL2L11      ---------------------------------------------
A0A3B4XZH1_BCL2L11      agtag----------------------------------------
A0A3Q3SYA1_BCL2L11      cttaa----------------------------------------
A0A3Q3K6I5_BCL2L11      tttag----------------------------------------
A0A3P8XIA2_BCL2L11      ---------------------------------------------
A0A3P8XIA2_BCL2L11      ---------------------------------------------
A0A3B4BVX1_BCL2L11      ---------------------------------------------
A0A3B4BVX1_BCL2L11      ---------------------------------------------
M3XHJ5_BCL2L11-01       ---------------------------------------------
A0A3B1JXK6_BCL2L11      ---------------------------------------------
R4G9R5_BCL2L11-01       ---------------------------------------------
K7GA86_BCL2L11-01       ---------------------------------------------
U3IW89_BCL2L11-01       tccttctag------------------------------------
A0A3Q2U844_BCL2L11      ---------------------------------------------
G1MV54_BCL2L11-01       ---------------------------------------------
F7FTC8_BCL2L11-01       ---------------------------------------------
G3W979_BCL2L11-01       ---------------------------------------------
F7CXT2_BCL2L11-02       ---------------------------------------------
F7CXT2_BCL2L11-01       ---------------------------------------------
G1PDJ5_BCL2L11-01       ---------------------------------------------
O43521_BCL2L11-20       ---------------------------------------------
G1SSY0_BCL2L11-01       ---------------------------------------------
G1SSY0_BCL2L11-02       ---------------------------------------------
A0A1U8BW10_BCL2L11      ---------------------------------------------
A0A1U8BW10_BCL2L11      ---------------------------------------------
A0A1U8BW10_BCL2L11      ---------------------------------------------
O54918_BCL2L11-03       ---------------------------------------------
O54918_BCL2L11-01       ---------------------------------------------
O88498_BCL2L11-01       ---------------------------------------------
A0A3Q1MV27_BCL2L11      ---------------------------------------------
A0A3Q1MV27_BCL2L11      ---------------------------------------------
L8IVA4_BCL2L11-02       ---------------------------------------------
L8IVA4_BCL2L11-01       ---------------------------------------------
W5PY58_BCL2L11-01       ---------------------------------------------
A0A452FCR6_BCL2L11      ---------------------------------------------
A0A452FCR6_BCL2L11      ---------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------------------------------
J9NWV6_BCL2L11-06       ---------------------------------------------
A0A2K6TRU4_BCL2L11      ---------------------------------------------
A0A2I3GVB2_BCL2L11      ---------------------------------------------
A0A2R9C366_BCL2L11      ---------------------------------------------
A0A2K5CA89_BCL2L11      ---------------------------------------------
A0A2K5Z7V3_BCL2L11      ---------------------------------------------
A0A2K6KJP8_BCL2L11      ---------------------------------------------
A0A286XJN2_BCL2L11      ---------------------------------------------
A0A286XJN2_BCL2L11      ---------------------------------------------
A0A286XJN2_BCL2L11      ---------------------------------------------
H0XW23_BCL2L11-01       ---------------------------------------------
A0A1U7T0R1_BCL2L11      ---------------------------------------------
A0A1U7T0R1_BCL2L11      ---------------------------------------------
A0A1U7T0R1_BCL2L11      ---------------------------------------------
A0A1U7T0R1_BCL2L11      ---------------------------------------------
A0A1U7T0R1_BCL2L11      ---------------------------------------------
A0A1U7T0R1_BCL2L11      ---------------------------------------------
A0A2K6GE31_BCL2L11      ---------------------------------------------
A0A2K6GE31_BCL2L11      ---------------------------------------------
A0A2R8M6L7_BCL2L11      ---------------------------------------------
A0A2R8M6L7_BCL2L11      ---------------------------------------------
H2P5E2_BCL2L11-01       ---------------------------------------------
A0A2K5Q1Y0_BCL2L11      ---------------------------------------------
A0A2R8M6L7_BCL2L11      ---------------------------------------------
A0A2K6TRU4_BCL2L11      ---------------------------------------------
A0A2K5CA89_BCL2L11      ---------------------------------------------
A0A2K5Q1Y0_BCL2L11      ---------------------------------------------
Q6JTU4_BCL2L11-01       ---------------------------------------------
A0A2I3SN61_BCL2L11      ---------------------------------------------
A0A2I3GVB2_BCL2L11      ---------------------------------------------
A0A2R9C366_BCL2L11      ---------------------------------------------
A0A2I3SN61_BCL2L11      ---------------------------------------------
A0A2K5HZI5_BCL2L11      ---------------------------------------------
A0A2K6QIL2_BCL2L11      ---------------------------------------------
A0A2I2YQ13_BCL2L11      ---------------------------------------------
A0A2K6QIL2_BCL2L11      ---------------------------------------------
A0A2K5HZI5_BCL2L11      ---------------------------------------------
A0A2I2YQ13_BCL2L11      ---------------------------------------------
A0A096NYC3_BCL2L11      ---------------------------------------------
A0A2K5NU92_BCL2L11      ---------------------------------------------
A0A2K5X1Y3_BCL2L11      ---------------------------------------------
A0A2K6E212_BCL2L11      ---------------------------------------------
A0A2K5Z7V3_BCL2L11      ---------------------------------------------
A0A2K6KJP8_BCL2L11      ---------------------------------------------
A0A2K5X1Y3_BCL2L11      ---------------------------------------------
A0A2K6E212_BCL2L11      ---------------------------------------------
A0A2K5NU92_BCL2L11      ---------------------------------------------
A0A096NYC3_BCL2L11      ---------------------------------------------
A0A0D9RWE0_BCL2L11      ---------------------------------------------
A0A287DFJ0_BCL2L11      ---------------------------------------------
A0A287DFJ0_BCL2L11      ---------------------------------------------
G3SU55_BCL2L11-01       ---------------------------------------------
C1KGB6_BCL2L11-03       ---------------------------------------------
C1KGB6_BCL2L11-01       ---------------------------------------------
C1KGB6_BCL2L11-02       ---------------------------------------------
C1KGB8_BCL2L11-01       ---------------------------------------------
A0A250YBV9_BCL2L11      ---------------------------------------------
A0A250YBV9_BCL2L11      ---------------------------------------------
A0A1S3FFM9_BCL2L11      ---------------------------------------------
A0A1S3FFM9_BCL2L11      ---------------------------------------------
A0A452U4S4_BCL2L11      ---------------------------------------------
U6CTE3_BCL2L11-04       ---------------------------------------------
M3YDI3_BCL2L11-01       ---------------------------------------------
U6CTE3_BCL2L11-01       ---------------------------------------------
U6CTE3_BCL2L11-03       ---------------------------------------------
U6CTE3_BCL2L11-02       ---------------------------------------------
J9NWV6_BCL2L11-05       ---------------------------------------------
J9NWV6_BCL2L11-04       ---------------------------------------------
J9NWV6_BCL2L11-02       ---------------------------------------------
J9NWV6_BCL2L11-03       ---------------------------------------------
G1LDR8_BCL2L11-01       ---------------------------------------------
A0A452SBG5_BCL2L11      ---------------------------------------------
J9NWV6_BCL2L11-01       ---------------------------------------------
A0A2I2UX96_BCL2L11      ---------------------------------------------
A0A2I2UX96_BCL2L11      ---------------------------------------------
                                                                     

© 1998-2020Legal notice