Dataset for CDS BCL2L11 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

362 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      ggacggaagacaggcgcccgagccaggtgcgcgccacctccgccccctcc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      cgagcacgtgcgggcagctgcgtgtccccgccgcactctggccgccgggc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gggaggcggcggtccggcgggcgggctccctcccccacgcaggtccaggt
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      -------------------------------------------ccggcca
A0A7N5JE15_BCL2L11      ---------------------------------------------acacg
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      tggggagggggcgtgcgtgcgtgcggagctccgggcggggggccgaagtg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ----------atggggccggagtggggaacgcggccagccg---------
A0A7N5JE15_BCL2L11      cttggggcggcgggagccgccaaggctcgcgcggcgtccgggccgggaca
A0A7N5JE15_BCL2L11      ctcggctggggcagggccggcagcaagcgcgggggaacccggccgggcca
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      cggctcgggccgggattgcgcgcgccggggagcggggaagggcagcgcgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      gaggcggggcgggcagggggagccggggcagctcgggtccgcgagactcc
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      -gaaactcccgatatagagccagggctctcggggctcctgaggctttccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      -gaaactcccgatatagagccagggctctcggggctcctgaggctttccg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      -gaaactcccgatatagagccagggctctcggggctcctgaggctttccg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gctcggcgctgtcccgggagctgcggccccgctgctggatactgggctgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cgccgcggtcgcagccggggccgccttcggaggcgagtttgtcaacaatc
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cgggcggcagcggcggggtctggtttacactgtattcggagcgccccctc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      cgggcggcagcggcggggtctggtttacactgtattcggagcgccccctc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cgggcggcagcggcggggtctggtttacactgtattcggagcgccccctc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gcggccggccggcaagtgtcgccgccctgtcccgagacgccccccccccc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ----------------------cctgcaatcgctg-catctgcgcccgc-
A0A7N5JE15_BCL2L11      gcctcgcctttggcggcctga-cccgtaggcgccgcctccgccggcggcg
A0A7N5JE15_BCL2L11      ccctcgcctttacctgttggagcctgaaagcgccagcggctgcggctgc-
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      tgttccacgcgcactcctaggccaccgctggttggggaagaggagaggtt
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      tgttccacgcgcactcctaggccaccgctggttggggaagaggagaggtt
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      tgttccacgcgcactcctaggccaccgctggttggggaagaggagaggtt
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      ---------------------------------cgtagtgggcgcagccc
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gccctccccaggtagcggccgcgccgtcggagctggtctggcgccttggc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------tcctgtgctccagcgcagtatctgatcc--------
A0A7N5JE15_BCL2L11      gctattggctgtggcgcggagcgaccgcgcacgggccaattgggagcgcg
A0A7N5JE15_BCL2L11      ------ggctgcggcgcggcggggcggggcggggcgtgcttg--------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      acactttgagttgggggatgggtgcgcactgagccatccgcagccaagtc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      acactttgagttgggggatgggtgcgcactgagccatccgcagccaagtc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      acactttgagttgggggatgggtgcgcactgagccatccgcagccaagtc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      gcgacggccgggccccgcgcagacttgctgcgctcagcacattcgggaga
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       -----------------------------------------atggggcgg
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      tttcctcgggtgctcgggcccgctgcggaggatttgcggaactgcggcgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggcacccggcgccagcggcgcggggaggtcggcggtgccggcggcggcgg
A0A7N5JE15_BCL2L11      --------------cccgcgcgccggggcgggacttagagggggcggagc
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      actccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcgg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      actccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcgg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      actccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcgg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      acaatgggctgggacggggccgcggccgggcggctcctcctcgccgccgc
A0A7M4F197_BCL2L11      ---atgggctgggacggggccgcggccgggcggctcctcctcgccgccgc
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       gcagggcgcgggccgggagctgcacaatcagtgcaggcgccgcgccgcgt
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      ttctttcactggcgagactcggcgttttccttgcaccggctgaggccgag
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------cgggaa
A0A7N5JE15_BCL2L11      gcgcagtgcgcgaggaggagcgggaggancgcggaggccctcggctgccc
A0A7N5JE15_BCL2L11      tcgcggtgattgggtgaga-----------------gccctcggccgcca
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgt
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      ggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgt
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgt
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      cccctcctgctcgccggctgcggggcgggcacagcgcggacccgccgctc
A0A7M4F197_BCL2L11      cccctcctgctcgccggctgcggggcgggcacagcgcggacccgccgctc
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       cccagccttttgtcccgtggcgggggggtccgagcgcgcggctgcccgat
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gtttcagggcggctgcagcgttcgcgctcttctggacgtgtctgggggcg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      gtcagagcccgctgggagtttccgacttctgcaagtcggctctgagc---
A0A7N5JE15_BCL2L11      ggcggagcgcggcggcggg--cgggcggccagtggccggctctgcgctgc
A0A7N5JE15_BCL2L11      gtctgagctgagctgcggggctgtgcaggtttcacttcgctcggcgcagc
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cagcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      cagcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cagcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      tctcgccctcccagtcccaacacagcaagtttcgggcagagccgggaggg
A0A7M4F197_BCL2L11      tctcgccctcccagtcccaacacagcaagtttcgggcagagccgggaggg
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       tcccagctcc----------------------------ggccggggcgga
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      ccctgccctgccctgccctgcccgggccgcggctgcgctgcagacaccag
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cccgggggctctg-----------------aacgcgagtcccgggtattg
A0A7N5JE15_BCL2L11      ctccaagtcttggtcttgtgaaagcgctccgtcctgcgtcgccgctgcca
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggcc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggcc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggcc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      ctcggagcggagctgcttggctcgcaagtttcacttcaaaatgtaatggc
A0A7M4F197_BCL2L11      ctcggagcggagctgcttggctcgcaagtttcacttcaaaatgtaatggc
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       ctcggagcgccggggtctggctgaggaattgctcttggagcctgactcgc
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------------------atgttcccggcggcggc
A0A3Q2GRS5_BCL2L11      ---------------------------------atgttcccggcggcggc
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ------------------------------atgttcccggcggctgcgac
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ------------------------------atgttcccggcggctgcggc
A0A096NYC3_BCL2L11      ------------------------------atgttcccggcggctgcggc
A0A2K5X1Y3_BCL2L11      ------------------------------atgttcccggcggctgcggc
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ------------------------------atgttcccggcggctgcggc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       ------------------------------atgttcccggcggctgcggc
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       ------------------------------atgttcccggcggctgcggc
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ------------------------------------atgttcccggcggc
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      cagccgcacgatcccgacggcgagaggcctcgggccgcaggacctgctcc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      tctcctgcgctcccttcgtgctgacggtcagggggctccgggtcggcgaa
A0A7N5JE15_BCL2L11      ccgctgccaccggattctcacagtcaccctgcgcgcgccagcccaactgc
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      ------------------------------------atgttcccggcggc
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      ttttgtcggcggccggctgactccaggagcgctccggtcgggaccgctgg
A0A7M4F197_BCL2L11      ttttgtcggcggccggctgactccaggagcgctccggtcgggaccgctgg
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       ttttgttcagacaaagcctttctgcgagttactctttggacgca------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgcc
A0A3Q2GRS5_BCL2L11      ggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgcc
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ccgggccgcgagggccagaggggcagcgcgcggagccgtcggctgcccgg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      cggggcagcgcggggcagaggcgcggcgtgcggagccctcggctgcccgg
A0A096NYC3_BCL2L11      cggggcagcgcggggcagaggcgcggcgtgcggagccctcggctgcccgg
A0A2K5X1Y3_BCL2L11      cggggcagcgcgggccagaggcgcggcgtgcggaaccctcggctgcccgg
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      cggggcagcgcgggccagaggcgcggcgtgcggaaccctcggctgcccgg
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       cggggcagcgcgggccagaggcgcggcgtgcggagccctcggctgcccgg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       cggggcagcgcgggccagaggcgcggcgtgcggagccctcggctgcccgg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggct
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gcccgtggggcacccccactcgctcgcagtgccgccgggcggtgcggtgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      g---------gacgcgggcaggacg-------------------------
A0A7N5JE15_BCL2L11      ggccagcatcgccgcgggctgctcgcttcgccccgctcccgccgccaccc
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      tgcggtcggggtagcgcgtaccggagacgcggcgtgcggagccctcagct
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cagcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgcc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      cagcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgcc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cagcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgcc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      gggtttttggtctgtggaaaaaggcagtgcgttgttgtcgtatttctttg
A0A7M4F197_BCL2L11      gggtttttggtctgtggaaaaaggca------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A671W556_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ctgcggagcgcggcggcggcgggcgggcggcaagcggcaggctctgcgct
A0A3Q2GRS5_BCL2L11      ctgcggagcgcggcggcggcgggcgggcggcaagcggcaggctctgcgct
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      cggagcgcagcggcgggctggccggaaggcgtgggctctgtgctgcgccg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      cggagtgcggcggcgggctggcgggaaggcgcgggctgtgcgctgcgccg
A0A096NYC3_BCL2L11      cggagtgcggcggcgggctggcgggaaggcgcgggctgtgcgctgcgccg
A0A2K5X1Y3_BCL2L11      cggagtgcggcggcgggctggcgggaaggcgcgggctgtgcgctgcgccg
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      cggagtgcggcggcgggctggcgggaaggcgcgggctgtgcgctgcgccg
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       cggagtgcggcggcgggctggcgggtaggcgcgggctgtgcgctgcgccg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       cggagtgcggcggcgggctggcgggtaggcgcgggctgtgcgctgcgccg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       gccggacggctcgcggcggcgggcgggctgccagtggccggctctgcgct
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      cctcgggggcctgttcctcggtgtccgagctcgtggcggaagacccgccg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ccgcggggcccgggcccgggccc-----------------ggacgcgacg
A0A7N5JE15_BCL2L11      cctcggcgccctttccctggccctcgtccccccaatgtctgactctgact
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      gcccggcggagcgcggcagcggacgggcggcgagttgcaggctctccgct
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcaca
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcaca
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcaca
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      tttgtttgtttgtctgtctgtttgtgcggagcagttgcgggagatgcttt
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      ------------------------------------------------at
A0A3Q1ICY2_BCL2L11      ------------------------------------------------at
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      ------------------------------------------------at
A0A671W556_BCL2L11      ------------------------------------------------at
A0A4W6ETK4_BCL2L11      ------------------------------------------------at
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      ------------------------------------------------at
A0A3B4V919_BCL2L11      ------------------------------------------------at
A0A3B4XZH1_BCL2L11      ------------------------------------------------at
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      ------------------------------------------------at
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      ------------------------------------------------at
A0A3B5QAM1_BCL2L11      ------------------------------------------------at
A0A3B5QAM1_BCL2L11      ------------------------------------------------at
A0A3B3VNE0_BCL2L11      ------------------------------------------------at
A0A3B3YII5_BCL2L11      ------------------------------------------------at
A0A3B3YII5_BCL2L11      ------------------------------------------------at
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gtcctggcgcctctgagcgcgagtcccgggctttgtctcccccgctgcct
A0A3Q2GRS5_BCL2L11      gtcctggcgcctctgagcgcgagtcccgggctttgtctcccccgctgcct
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      gggactctgaacccgagtcccgggctttgtctcctgcattgtcttcgtgg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ggtactctgaacccaagtccagagctttgtttcctgcgctgccttcgtgg
A0A096NYC3_BCL2L11      ggtactctgaacccaagtccagagctttgtttcctgcgctgccttcgtgg
A0A2K5X1Y3_BCL2L11      ggtactctgaacccaagtccagagctttgtttcctgcgctgccttcgtgg
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ggtactctgaacccaagtccagagctttgtttcctgcgctgccttcgtgg
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       ggtactctgaacccaagtccagagctttgtttcctgcgctgccttcgtgg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       ggtactctgaacccaagtccagagctttgtttcctgcgctgccttcgtgg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       gccccgggggctctgaaggcgagtcccaggctttgtctcccgcgcttctt
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gccgcgggagcccggggcgtggatgtgttcgccgtctgccgcgctcacgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ----------aaagag----------------------------------
A0A7N5JE15_BCL2L11      atcggaagggaagggg----------------------------------
A0A7N5JE15_BCL2L11      ctcggactgagaaacg----------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      gccccgggcgctccgaccgcgagtcccgggctttgtctcccgggccgcct
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gtcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gtcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gtcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      gcatccagtcacttccctgatttaatcctgtcggacggagcttgtttctc
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      -----------------------------cgcat----------------
A0A4W4H3Y1_BCL2L11      --------------------------------at----------------
A0A3B1JXK6_BCL2L11      --------------------------------atgtcca-----------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------atgtcca-----------
A0A3B4BSH7_BCL2L11      -----------------------------cttctgtccgccagaaaagct
B2KKY9_BCL2L11-01       --------------------------------atgtc-------------
B8JK68_BCL2L11-01       --------------------------------atgtc-------------
A0A3G3M2M0_BCL2L11      --------------------------------atgtc-------------
A0A672PQD1_BCL2L11      --------------------------------atgtc-------------
A0A671M057_BCL2L11      --------------------------------atgtc-------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------atgtc-------------
A0A671SJ75_BCL2L11      --------------------------------gtaag-------------
A0A673IWZ7_BCL2L11      --------------------------------atggc-------------
A0A3P8XIA2_BCL2L11      --------------------------------atgtt-------------
A0A4W5R3N6_BCL2L11      --------------------------------atgacattgcaccgacaa
A0A4W5R3N6_BCL2L11      --------------------------------atgac-------------
A0A4W5R3N6_BCL2L11      --------------------------------atgacattgcaccgacaa
A0A1S3SAH9_BCL2L11      --------------------------------atgtc-------------
A0A673WET2_BCL2L11      --------------------------------atgtc-------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      gca-----------------------------------------------
A0A3Q1ICY2_BCL2L11      gga-----------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      gca-----------------------------------------------
A0A671W556_BCL2L11      gca-----------------------------------------------
A0A4W6ETK4_BCL2L11      gaa-----------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      gtatatatatatatgtatatgtacatataaatatatcacagacagcttga
A0A3B4V919_BCL2L11      gaa-----------------------------------------------
A0A3B4XZH1_BCL2L11      gaa-----------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      g-------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      gct-----------------------------------------------
A0A3B5QAM1_BCL2L11      gc------------------------------------------------
A0A3B5QAM1_BCL2L11      gct-----------------------------------------------
A0A3B3VNE0_BCL2L11      gc------------------------------------------------
A0A3B3YII5_BCL2L11      gc------------------------------------------------
A0A3B3YII5_BCL2L11      gc------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      ----------------atgccgctcagcgtgcggagttacttgtggattt
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      aagtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggac
A0A3Q2GRS5_BCL2L11      aagtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggac
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tgacggtcaggggccgccgggtcggcgaaaggcgcgggtcggacgccgtg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      tgacggtcagggggcgccgggtcggcgaagggcgcgggccagacgccccg
A0A096NYC3_BCL2L11      tgacggtcagggggcgccgggtcggcgaagggcgcgggccagacgccccg
A0A2K5X1Y3_BCL2L11      tgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccg
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      tgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccg
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       tgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       tgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       tcgtgctgagggtcagggagctccgggtcggcgaaggacgcgagcgggac
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gtgcgcgcggacacgcgtgcccgtggccagtggctgcggctgggatttgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      tcgtgttgacggtcagggggctccgggtcggcgaagggcgcgggctgggc
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ggttcgccccgctcccgccgccgccactcactcggcgcccttcccctggc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      ggttcgccccgctcccgccgccgccactcactcggcgcccttcccctggc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ggttcgccccgctcccgccgccgccactcactcggcgcccttcccctggc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      agaacttggggatggcgctgtgtggctgcaaagccccgatgttgtgtcgc
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      cgtttcagtgtttgcccgtgttcttctccggaggaccgtatacatcacct
B2KKY9_BCL2L11-01       -----------------------------tgacacgtccaga--------
B8JK68_BCL2L11-01       -----------------------------tgacacgtccaga--------
A0A3G3M2M0_BCL2L11      -----------------------------tgacacgtccaga--------
A0A672PQD1_BCL2L11      -----------------------------cgacacgtccagca-------
A0A671M057_BCL2L11      -----------------------------tgacacgtc---ca-------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      -----------------------------tgacacgtccaga--------
A0A671SJ75_BCL2L11      -----------------------------tgatactacaaca--------
A0A673IWZ7_BCL2L11      -----------------------------tgacagtacaatat-------
A0A3P8XIA2_BCL2L11      -----------------------------tgattcgtc---ca-------
A0A4W5R3N6_BCL2L11      aataataaaaatagcctaactctgatacttgatctatcttaca-------
A0A4W5R3N6_BCL2L11      -----------------------------cgattcgtc---ca-------
A0A4W5R3N6_BCL2L11      aataataaaaatagcctaactctgatacttgatctatcttaca-------
A0A1S3SAH9_BCL2L11      -----------------------------cgattcgtc---ca-------
A0A673WET2_BCL2L11      -----------------------------cgattcgtc---ca-------
A0A4W5NF23_BCL2L11      ----------------------------------------atg-------
A0A673XGV4_BCL2L11      -----------------------------------------ca-------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A669C520_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      -------------------------------------------ccgtccg
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      ----------------------------------------------ccta
A0A671W556_BCL2L11      -------------------------------------------gcatccg
A0A4W6ETK4_BCL2L11      -----------------agcccaggctgacggtgccgctctgttcatcca
A0A4W6ETK4_BCL2L11      ------------------------------------------------ca
A0A4W6ETK4_BCL2L11      catcgtgttattctcggagccagcggttatgtcgcgccactg-acatgca
A0A3B4V919_BCL2L11      -----------------agcccaggctgacggtgccgctctattcatcca
A0A3B4XZH1_BCL2L11      -----------------agcccaggctgacggtgccgctctattcatcca
A0A3Q3B113_BCL2L11      ----------------------------------atgcgtagtccatcc-
A0A3Q2SZH6_BCL2L11      -------------------------------gtgacgctctgttcatcca
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      ---------------------------cacggtgacgctctgttcatcca
A0A3B5QAM1_BCL2L11      ----------------------------------actcttta--------
A0A3B5QAM1_BCL2L11      ---------------------------cacggtgacgctctgttcatcca
A0A3B3VNE0_BCL2L11      ----------------------------------actcttca--------
A0A3B3YII5_BCL2L11      ----------------------------------actcttta--------
A0A3B3YII5_BCL2L11      ----------------------------------actcttta--------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      ggctggggtcgccaggagccggcttgggggaccttgctcccattcggaga
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gccgcggggcccgggcccggacgcgacgctcggaagggaaggggcggata
A0A3Q2GRS5_BCL2L11      gccgcggggcccgggcccggacgcgacgctcggaagggaaggggcggata
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      gtgccccgtcccgggccagaacgctgcgctctgaagggaaggctcggaca
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      gggcccgggcccgggcccagacgctacgctctgaagggaaggcgcggaca
A0A096NYC3_BCL2L11      gggcccgggcccgggcccagacgctacgctctgaagggaaggcgcggaca
A0A2K5X1Y3_BCL2L11      gggcccgggcgcgggcccggacgctacgctctgaagggaaggcgcggaca
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      gggcccgggcgcgggcccggacgctacgctctgaagggaaggcgcggaca
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       gggcccgggcgcgggcccggacgctacgctctgaagggaaggcgcggaca
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       gggcccgggcgcgggcccggacgctacgctctgaagggaaggcgcggaca
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       gccgcggggctcgggcccggacgcgacggtcggaagggaaggggcggaca
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      acgtacgcgccgcgctcggggaggaaaagggaggaatttgcggaggacga
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------cacata
A0A7N5JE15_BCL2L11      --------------------------------------------cggaca
A0A7N5JE15_BCL2L11      --------------------------------------------c-aaga
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      gccgccgggccccggcccggacgcgacgctcggaagggaaggggcggaca
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cctcgtccccccaatgtctgactctgactctcggactgagaaacgcaaga
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      cctcgtccccccaatgtctgactctgactctcggactgagaaacgcaaga
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cctcgtccccccaatgtctgactctgactctcggactgagaaacgcaaga
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
A0A669QMB4_BCL2L11      --------------------------------------------------
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      --------------------------------------------------
A0A672TST9_BCL2L11      --------------------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      tgtggagccgggagagcttactcgcgatgctttctctttctctgcaggga
A0A7M4F197_BCL2L11      -----------------------------------------------gga
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670Y3D3_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
K7GA86_BCL2L11-01       -----------------------------------------------gga
A0A674IAI8_BCL2L11      --------------------------------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      ------------acggcaaaac-----------------cgggccaatgg
A0A4W4H3Y1_BCL2L11      ------------acggcaaaac-----------------cgggccaatgg
A0A3B1JXK6_BCL2L11      -----------gaccgtcaaac-----------------cgggccacccg
A0A3B4BSH7_BCL2L11      ------------------atgc-----------------agaacagtaat
A0A3B4BSH7_BCL2L11      -----------ggcggtcaaac-----------------cgggccggccg
A0A3B4BSH7_BCL2L11      tcctcattatctgcggtcaaac-----------------cgggccggccg
B2KKY9_BCL2L11-01       -------------gagcaaacg-----------------ctggccaatgg
B8JK68_BCL2L11-01       -------------gagcaaacg-----------------ctggccaatgg
A0A3G3M2M0_BCL2L11      -------------gagcaaacg-----------------ccgggtaatgt
A0A672PQD1_BCL2L11      -----------gagagcaaacg-----------------ccgggc-----
A0A671M057_BCL2L11      -----------gagagcaaacg-----------------ccgggc-----
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      -------------gagcaaacg-----------------ccgggc-----
A0A671SJ75_BCL2L11      ----------------caaacg-----------------ctggccaatgg
A0A673IWZ7_BCL2L11      -----------tgaagcaaacg-----------------ctggccaatgg
A0A3P8XIA2_BCL2L11      -----------gaccacaaaat-----------------cggtccaatgg
A0A4W5R3N6_BCL2L11      -----------gacaacaaaat-----------------caatccaatgg
A0A4W5R3N6_BCL2L11      -----------gacaacaaaat-----------------caatccaatgg
A0A4W5R3N6_BCL2L11      -----------gacaacaaaat-----------------caatccaatgg
A0A1S3SAH9_BCL2L11      -----------gacaacaaaat-----------------cagtccaatgg
A0A673WET2_BCL2L11      -----------gacaacaaaat-----------------cagtccaatgg
A0A4W5NF23_BCL2L11      -----------aaccacaatat----------------cggtccaaatgt
A0A673XGV4_BCL2L11      -----------aaataaaatatataaaaagagaggctactactgcaacct
A0A3B3QC78_BCL2L11      ------------atgggac-------------aaattctattaacgatcc
A0A669C520_BCL2L11      ------------------------------------------tacttatt
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      ------------gttgc---------------------------------
M3XHJ5_BCL2L11-01       ------------atgccaacagaggaaagtttacaatttgacaaagacca
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      ------------------------------------------------cc
A0A3P8RLE2_BCL2L11      --------gcgaacagaac-----------------------acctagtt
A0A3Q3ESW6_BCL2L11      t-------ccagaccaccg-----------------------aaccggtt
A0A3Q1ICY2_BCL2L11      ------tcctagacaacca-----------------------aaccgctc
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      t-------ctagaccacca-----------------------aaccgctc
A0A671W556_BCL2L11      t-------ccagaccacca-----------------------aacagctc
A0A4W6ETK4_BCL2L11      a--------cagaccacca-----------------------aaccagtc
A0A4W6ETK4_BCL2L11      a---------agaccacca-----------------------aaccagtc
A0A4W6ETK4_BCL2L11      acctccgtccagaccacca-----------------------aaccagtc
A0A3B4V919_BCL2L11      a--------cagaccacaa-----------------------aaccggtc
A0A3B4XZH1_BCL2L11      a--------cagaccacaa-----------------------aaccggtc
A0A3Q3B113_BCL2L11      ----------agaccgcca-----------------------aatctgcg
A0A3Q2SZH6_BCL2L11      a--------cagaccgcca-----------------------aatctgcg
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      a--------cagaccgcca-----------------------aatctgct
A0A3B5QAM1_BCL2L11      ----------agaccgcca-----------------------aatctgct
A0A3B5QAM1_BCL2L11      a--------cagaccgcca-----------------------aatctgct
A0A3B3VNE0_BCL2L11      ----------agaccgcca-----------------------aatctgct
A0A3B3YII5_BCL2L11      ----------agaccgcca-----------------------aatctgct
A0A3B3YII5_BCL2L11      ----------agaccgcca-----------------------aatctgct
A0A6I8NCK5_BCL2L11      ------------atggcca-----------------------agcaacct
A0A6I8NCK5_BCL2L11      ------------atggcca-----------------------agcaacct
A0A6I8NCK5_BCL2L11      ------------atggcca-----------------------agcaacct
A0A6I8NCK5_BCL2L11      ------------atggcca-----------------------agcaacct
A0A6I8NCK5_BCL2L11      ------------atggcca-----------------------agcaacct
A0A667ZMY7_BCL2L11      ttatcagatgtgaccgcgg-----------------------cgcaaacc
A0A803WCD8_BCL2L11      ----------------cgc-----------------------agccgcgg
A0A803VLS8_BCL2L11      ------------atg----------------------------------t
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       ------------atggcaa-----------------------agcaacct
A0A5F9C9V3_BCL2L11      ------------atggcca-----------------------agcaacct
A0A671FCV3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A671FCV3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A671FCV3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A671FCV3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A5F9C9V3_BCL2L11      ------------atggcca-----------------------agcaacct
G3H020_BCL2L11-01       ------------atggcca-----------------------agcaacct
G3H020_BCL2L11-02       ------------atggcca-----------------------agcaacct
O54918_BCL2L11-03       ------------atggcca-----------------------agcaacct
O54918_BCL2L11-01       ------------atggcca-----------------------agcaacct
O54918_BCL2L11-05       ------------atggcca-----------------------agcaacct
O54918_BCL2L11-06       ------------atggcca-----------------------agcaacct
O54918_BCL2L11-08       ------------atggcca-----------------------agcaacct
L8IVA4_BCL2L11-02       ------------atggcaa-----------------------agcaacct
A0A4W2D2G6_BCL2L11      ------------atggcaa-----------------------agcaacct
L8IVA4_BCL2L11-01       ------------atggcaa-----------------------agcaacct
A0A4W2D2G6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A4W2D2G6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A4W2D2G6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A4W2G3J8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A3Q1MV27_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A3Q1MV27_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A4W2G3J8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A4W2G3J8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A3Q1MV27_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A4W2G3J8_BCL2L11      ------------atggcaa-----------------------agcaacct
W5PY58_BCL2L11-01       ------------atggcaa-----------------------agcaacct
A0A452FCR6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A452FCR6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A3Q2GRS5_BCL2L11      ------------atggcca-----------------------aacaacct
A0A3Q2GRS5_BCL2L11      ------------atggcca-----------------------aacaacct
A0A3Q2GRS5_BCL2L11      ------------atggcca-----------------------aacaacct
A0A3Q2GRS5_BCL2L11      aaaaaagaccaaatggcca-----------------------aacaacct
A0A3Q2GRS5_BCL2L11      aaaaaagaccaaatggcca-----------------------aacaacct
A0A286XJN2_BCL2L11      ------------atggcca-----------------------agcaacct
A0A286XJN2_BCL2L11      ------------atggcca-----------------------agcaacct
A0A286XJN2_BCL2L11      ------------atggcca-----------------------agcaacct
A0A2I3GAA1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-03       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-23       ------------------a-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A096NYC3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5X1Y3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3GAA1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-02       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-15       ------------atggcaa-----------------------agcaacct
A0A2K5X1Y3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A096NYC3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A287DFJ0_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A287DFJ0_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A1U7SU38_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A1U7SU38_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A1U7SU38_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A1U7SU38_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A1U7SU38_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A1U7SU38_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A1U7SU38_BCL2L11      ------------atggcaa-----------------------agcaacct
H0XW23_BCL2L11-01       ------------atggcaa-----------------------agcaacct
A0A2K6GE22_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6GE22_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6GE22_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6GE22_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6GE22_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6GE22_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5X1Y3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-07       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-22       ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3GAA1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R8M6L7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R8M6L7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R8M6L7_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A2R8M6L7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R8M6L7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R8M6L7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R8M6L7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R8M6L7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Q1U2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5CA52_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6TRJ7_BCL2L11      ------------atggcaa-----------------------agcaacct
Q6JTU4_BCL2L11-01       ------------atg-----------------------------------
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3GAA1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3GAA1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A096NYC3_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A096NYC3_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A2K5X1Y3_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A2K5X1Y3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5X1Y3_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
F7HHA1_BCL2L11-01       ------------atggcaa-----------------------agcaacct
F7HHA1_BCL2L11-02       aaaaaagaccaaatggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
F7HHA1_BCL2L11-03       aaaaaagaccaaatggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3GAA1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-17       ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3GAA1_BCL2L11      ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-20       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-09       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-14       ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-04       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-21       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-19       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-18       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-12       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-11       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-10       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-08       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-06       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-01       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-05       ------------atggcaa-----------------------agcaacct
O43521_BCL2L11-13       ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2Y4B3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3GAA1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2R9BZX9_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I3S5F6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5X1Y3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A096NYC3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A0D9RWE0_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5NTQ5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6E1Z6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5Z7V3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A096NYC3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5X1Y3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6KJM8_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K6QIJ1_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2K5HZ87_BCL2L11      ------------atggcaa-----------------------agcaacct
G3SU55_BCL2L11-01       ------------atggcaa-----------------------agcaacct
U6CTE3_BCL2L11-04       ------------atggcaa-----------------------agcaacct
M3YDI3_BCL2L11-01       aaaaaagaccaaatggcaa-----------------------agcaacct
U6CTE3_BCL2L11-01       ------------atggcaa-----------------------agcaacct
U6CTE3_BCL2L11-02       ------------atggcaa-----------------------agcaacct
U6CTE3_BCL2L11-03       ------------atggcaa-----------------------agcaacct
A0A452U4S4_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A673SRF7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A673SRF7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A7N5JE15_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2UX96_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A667H9R7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A673SRF7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A673SRF7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A7N5JE15_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A3Q7S5V2_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A3Q7S5V2_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A667H9R7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2UX96_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2UX96_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2I2UX96_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A667H9R7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A667H9R7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A667H9R7_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A7N5JE15_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A7N5JE15_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A7N5JE15_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A7N5JE15_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A7N5JE15_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A452SBG5_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2Y9Q753_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2Y9Q753_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A2Y9T3Y6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2Y9T3Y6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A2Y9T3Y6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A287AEC6_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A4X1VMQ3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A287AEC6_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
C1KGB8_BCL2L11-01       ------------atggcaa-----------------------agcaacct
A0A4X1VMQ3_BCL2L11      ------------atggcaa-----------------------agcaacct
C1KGB6_BCL2L11-01       ------------atggcaa-----------------------agcaacct
C1KGB7_BCL2L11-01       ------------atggcaa-----------------------agcaacct
A0A287AEC6_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A4X1VMQ3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A4X1VMQ3_BCL2L11      ------------atggcaa-----------------------agcaacct
A0A287AEC6_BCL2L11      aaaaaagaccaaatggcaa-----------------------agcaacct
A0A4X1VMQ3_BCL2L11      ------------atggcaa-----------------------agcaacct
U3IW89_BCL2L11-01       ------------------------------------------ggcggcgc
A0A3Q2U844_BCL2L11      ------------atggcca-----------------------agcagccc
A0A669QMB4_BCL2L11      ------------atggcca-----------------------agcagccc
A0A663E970_BCL2L11      ------------atggcta-----------------------agcaaccc
A0A674H354_BCL2L11      ------------atggcca-----------------------agcagccc
A0A672TST9_BCL2L11      ------------atggcca-----------------------agcagccc
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      aaaaaagaccaaatggcaa-----------------------aacaaccc
A0A7M4F197_BCL2L11      aaaaaagaccaaatggcaa-----------------------aacaaccc
A0A670KEZ9_BCL2L11      ------------atggcaa-----------------------aacaatct
A0A670Y3D3_BCL2L11      ------------atggcaa-----------------------aacaatct
A0A7N4NUH6_BCL2L11      ------------atggcaa-----------------------agcaaccg
A0A7N4NUH6_BCL2L11      ------------atggcaa-----------------------agcaaccg
A0A7N4NUH6_BCL2L11      ------------atggcaa-----------------------agcaaccg
A0A7N4NUH6_BCL2L11      ------------atggcaa-----------------------agcaaccg
A0A4X2L9J9_BCL2L11      ------------atggcaa-----------------------agcaaccg
A0A5F8H037_BCL2L11      ------------atggcaa-----------------------aacaaccg
A0A5F8H037_BCL2L11      ------------atggcaa-----------------------aacaaccg
K7GA86_BCL2L11-01       aaaggcgaccaaatggcaa-----------------------agcaacct
A0A674IAI8_BCL2L11      ------------atggcaa-----------------------agcaatct
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      -------cccagccttcttaaag---------------------------
A0A4W4H3Y1_BCL2L11      -------cccagccttcttaaag---------------------------
A0A3B1JXK6_BCL2L11      -------cccacccttcttaaag---------------------------
A0A3B4BSH7_BCL2L11      -------tactgctgtttt-------------------------------
A0A3B4BSH7_BCL2L11      -------cccagccttcttaaag---------------------------
A0A3B4BSH7_BCL2L11      -------cccagccttcttaaag---------------------------
B2KKY9_BCL2L11-01       -------cccggcctcgc--------------------------------
B8JK68_BCL2L11-01       -------cccggcctcgc--------------------------------
A0A3G3M2M0_BCL2L11      -------cccggcgtcgc--------------------------------
A0A672PQD1_BCL2L11      -----------------c--------------------------------
A0A671M057_BCL2L11      -----------------c--------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      -----------------c--------------------------------
A0A671SJ75_BCL2L11      -------cccggcctcgc--------------------------------
A0A673IWZ7_BCL2L11      -------cccggcctcgc--------------------------------
A0A3P8XIA2_BCL2L11      -------cacgaccaccctaatt---------------------------
A0A4W5R3N6_BCL2L11      -------ctcgaccatcctaatt---------------------------
A0A4W5R3N6_BCL2L11      -------ctcgaccatcctaatt---------------------------
A0A4W5R3N6_BCL2L11      -------ctcgaccatcctaatt---------------------------
A0A1S3SAH9_BCL2L11      -------ctcgaccatcctaatt---------------------------
A0A673WET2_BCL2L11      -------ctcgaccatcctaatt---------------------------
A0A4W5NF23_BCL2L11      -------ctcgaccaccctaatt---------------------------
A0A673XGV4_BCL2L11      -------gtgggtggcgataatg---------------------------
A0A3B3QC78_BCL2L11      -------cctgctct--gtctgttct------------------------
A0A669C520_BCL2L11      tgaaaatgctgat----atgcaggct------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      -------tccgt--------------------------------------
M3XHJ5_BCL2L11-01       aggtacatcagat----gtaatttct------------------------
A0A3Q1ELG4_BCL2L11      ----ag-ctccagcgctgcttcacccgcggctccacatgcagacactaca
A0A3Q1CI15_BCL2L11      tacaaa-gtccggtcctgacgcagcagcg--------cgctg----cttc
A0A3P8RLE2_BCL2L11      tagtag-gacctgaacagaagaagaggaa--------cggagggaacctc
A0A3Q3ESW6_BCL2L11      ggatgg-ctcgcccacagtaacggaatca---------------------
A0A3Q1ICY2_BCL2L11      cgatgg-ctcgacagctgtaacggccaca---------------------
A0A3Q3SYA1_BCL2L11      --------------------atggcaaca---------------------
A0A3Q3K6I5_BCL2L11      cgatgg-ctcgaccgcagtaacagcaaca---------------------
A0A671W556_BCL2L11      cgatgg-gtcgaccgcagtaacggcaggt---------------------
A0A4W6ETK4_BCL2L11      cgatgg-ctcgaccgaagtaacggcaaga---------------------
A0A4W6ETK4_BCL2L11      cgatgg-ctcgaccgaagtaacggcaaga---------------------
A0A4W6ETK4_BCL2L11      cgatgg-ctcgaccgaagtaacggcaaga---------------------
A0A3B4V919_BCL2L11      cgatgg-ctcgaccgcagtaacggcaaga---------------------
A0A3B4XZH1_BCL2L11      cgatgg-ctcgaccgcagtaacggcaaga---------------------
A0A3Q3B113_BCL2L11      cgatgg-ctcgaccgaagtaaaggcaaca---------------------
A0A3Q2SZH6_BCL2L11      cgatgg-ctctaccgaagtaacgccacca---------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      cgatgg-ctcgaccgaagtaacgccagca---------------------
A0A3B5QAM1_BCL2L11      cgatgg-ctcgaccgaagtaacgccagca---------------------
A0A3B5QAM1_BCL2L11      cgatgg-ctcgaccgaagtaacgccagca---------------------
A0A3B3VNE0_BCL2L11      cgatgg-ctcgaccgaagtaacgccagca---------------------
A0A3B3YII5_BCL2L11      cgatgg-ctcgaccgaagtaacgccagca---------------------
A0A3B3YII5_BCL2L11      cgatgg-ctcgaccgaagtaacgccagca---------------------
A0A6I8NCK5_BCL2L11      -------tccgac----ctaaattct------------------------
A0A6I8NCK5_BCL2L11      -------tccgac----ctaaattct------------------------
A0A6I8NCK5_BCL2L11      -------tccgac----ctaaattct------------------------
A0A6I8NCK5_BCL2L11      -------tccgac----ctaaattct------------------------
A0A6I8NCK5_BCL2L11      -------tccgac----ctaaattct------------------------
A0A667ZMY7_BCL2L11      -------ccccgc----gcagcgccg------------------------
A0A803WCD8_BCL2L11      -------gccgggtcgggtcgggtcg------------------------
A0A803VLS8_BCL2L11      -------tcc----------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       -------tctgat----gtaagttct------------------------
A0A5F9C9V3_BCL2L11      -------tccgat----gtaagttct------------------------
A0A671FCV3_BCL2L11      -------tccgat----gcaagttct------------------------
A0A671FCV3_BCL2L11      -------tccgat----gcaagttct------------------------
A0A671FCV3_BCL2L11      -------tccgat----gcaagttct------------------------
A0A671FCV3_BCL2L11      -------tccgat----gcaagttct------------------------
A0A5F9C9V3_BCL2L11      -------tccgat----gtaagttct------------------------
G3H020_BCL2L11-01       -------tctgat----gtaagttct------------------------
G3H020_BCL2L11-02       -------tctgat----gtaagttct------------------------
O54918_BCL2L11-03       -------tctgat----gtaagttct------------------------
O54918_BCL2L11-01       -------tctgat----gtaagttct------------------------
O54918_BCL2L11-05       -------tctgat----gtaagttct------------------------
O54918_BCL2L11-06       -------tctgat----gtaagttct------------------------
O54918_BCL2L11-08       -------tctgat----gtaagttct------------------------
L8IVA4_BCL2L11-02       -------tccgat----gtaagttct------------------------
A0A4W2D2G6_BCL2L11      -------tccgat----gtaagttct------------------------
L8IVA4_BCL2L11-01       -------tccgat----gtaagttct------------------------
A0A4W2D2G6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4W2D2G6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4W2D2G6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4W2G3J8_BCL2L11      -------tccgat----gtaagttct------------------------
A0A3Q1MV27_BCL2L11      -------tccgat----gtaagttct------------------------
A0A3Q1MV27_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4W2G3J8_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4W2G3J8_BCL2L11      -------tccgat----gtaagttct------------------------
A0A3Q1MV27_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4W2G3J8_BCL2L11      -------tccgat----gtaagttct------------------------
W5PY58_BCL2L11-01       -------tccgat----gtaagttct------------------------
A0A452FCR6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A452FCR6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A3Q2GRS5_BCL2L11      -------tccgat----gtaagttct------------------------
A0A3Q2GRS5_BCL2L11      -------tccgat----gtaagttct------------------------
A0A3Q2GRS5_BCL2L11      -------tccgat----gtaagttct------------------------
A0A3Q2GRS5_BCL2L11      -------tccgat----gtaagttct------------------------
A0A3Q2GRS5_BCL2L11      -------tccgat----gtaagttct------------------------
A0A286XJN2_BCL2L11      -------tccgat----gtaagttgt------------------------
A0A286XJN2_BCL2L11      -------tccgat----gtaagttgt------------------------
A0A286XJN2_BCL2L11      -------tccgat----gtaagttgt------------------------
A0A2I3GAA1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
O43521_BCL2L11-03       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-23       -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A096NYC3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5X1Y3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2I3GAA1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
O43521_BCL2L11-02       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-15       -------tctgat----gtaagttct------------------------
A0A2K5X1Y3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A096NYC3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A287DFJ0_BCL2L11      -------tccgat----gtaagttct------------------------
A0A287DFJ0_BCL2L11      -------tccgat----gtaagttct------------------------
A0A1U7SU38_BCL2L11      -------tccgtt----gtaagttct------------------------
A0A1U7SU38_BCL2L11      -------tccgtt----gtaagttct------------------------
A0A1U7SU38_BCL2L11      -------tccgtt----gtaagttct------------------------
A0A1U7SU38_BCL2L11      -------tccgtt----gtaagttct------------------------
A0A1U7SU38_BCL2L11      -------tccgtt----gtaagttct------------------------
A0A1U7SU38_BCL2L11      -------tccgtt----gtaagttct------------------------
A0A1U7SU38_BCL2L11      -------tccgtt----gtaagttct------------------------
H0XW23_BCL2L11-01       -------tcagat----gtaggttct------------------------
A0A2K6GE22_BCL2L11      -------tccgat----gtaggttct------------------------
A0A2K6GE22_BCL2L11      -------tccgat----gtaggttct------------------------
A0A2K6GE22_BCL2L11      -------tccgat----gtaggttct------------------------
A0A2K6GE22_BCL2L11      -------tccgat----gtaggttct------------------------
A0A2K6GE22_BCL2L11      -------tccgat----gtaggttct------------------------
A0A2K6GE22_BCL2L11      -------tccgat----gtaggttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5X1Y3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
O43521_BCL2L11-07       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-22       -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3GAA1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R8M6L7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2R8M6L7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2R8M6L7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2R8M6L7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2R8M6L7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2R8M6L7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2R8M6L7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2R8M6L7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5Q1U2_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K5CA52_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2K6TRJ7_BCL2L11      -------tccgat----gtaagttct------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3GAA1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3GAA1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A096NYC3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A096NYC3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5X1Y3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5X1Y3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5X1Y3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
F7HHA1_BCL2L11-01       -------tctgat----gtaagttct------------------------
F7HHA1_BCL2L11-02       -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
F7HHA1_BCL2L11-03       -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3GAA1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
O43521_BCL2L11-17       -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3GAA1_BCL2L11      -------tctgat----gtaagttct------------------------
O43521_BCL2L11-20       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-09       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-14       -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
O43521_BCL2L11-04       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-21       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-19       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-18       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-12       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-11       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-10       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-08       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-06       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-01       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-05       -------tctgat----gtaagttct------------------------
O43521_BCL2L11-13       -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I2Y4B3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3GAA1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2R9BZX9_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2I3S5F6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5X1Y3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A096NYC3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A0D9RWE0_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5NTQ5_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6E1Z6_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5Z7V3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A096NYC3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5X1Y3_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6KJM8_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K6QIJ1_BCL2L11      -------tctgat----gtaagttct------------------------
A0A2K5HZ87_BCL2L11      -------tctgat----gtaagttct------------------------
G3SU55_BCL2L11-01       -------tcagat----gtaagttct------------------------
U6CTE3_BCL2L11-04       -------tcagat----gtaagttct------------------------
M3YDI3_BCL2L11-01       -------tcagat----gtaagttct------------------------
U6CTE3_BCL2L11-01       -------tcagat----gtaagttct------------------------
U6CTE3_BCL2L11-02       -------tcagat----gtaagttct------------------------
U6CTE3_BCL2L11-03       -------tcagat----gtaagttct------------------------
A0A452U4S4_BCL2L11      -------tcagat----gtaagttct------------------------
A0A673SRF7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A673SRF7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A7N5JE15_BCL2L11      -------tcagat----gtaagttct------------------------
A0A2I2UX96_BCL2L11      -------tcagat----gtaagttct------------------------
A0A667H9R7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A673SRF7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A673SRF7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A7N5JE15_BCL2L11      -------tcagat----gtaagttct------------------------
A0A3Q7S5V2_BCL2L11      -------tcagat----gtaagttct------------------------
A0A3Q7S5V2_BCL2L11      -------tcagat----gtaagttct------------------------
A0A667H9R7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A2I2UX96_BCL2L11      -------tcagat----gtaagttct------------------------
A0A2I2UX96_BCL2L11      -------tcagat----gtaagttct------------------------
A0A2I2UX96_BCL2L11      -------tcagat----gtaagttct------------------------
A0A667H9R7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A667H9R7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A667H9R7_BCL2L11      -------tcagat----gtaagttct------------------------
A0A7N5JE15_BCL2L11      -------tcagat----gtaagttct------------------------
A0A7N5JE15_BCL2L11      -------tcagat----gtaagttct------------------------
A0A7N5JE15_BCL2L11      -------tcagat----gtaagttct------------------------
A0A7N5JE15_BCL2L11      -------tcagat----gtaagttct------------------------
A0A7N5JE15_BCL2L11      -------tcagat----gtaagttct------------------------
A0A452SBG5_BCL2L11      -------tcagat----gtaagttct------------------------
A0A2Y9Q753_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2Y9Q753_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2Y9T3Y6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2Y9T3Y6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A2Y9T3Y6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A287AEC6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4X1VMQ3_BCL2L11      -------tccgat----gtaagttct------------------------
A0A287AEC6_BCL2L11      -------tccgat----gtaagttct------------------------
C1KGB8_BCL2L11-01       -------tccgat----gtaagttct------------------------
A0A4X1VMQ3_BCL2L11      -------tccgat----gtaagttct------------------------
C1KGB6_BCL2L11-01       -------tccgat----gtaagttct------------------------
C1KGB7_BCL2L11-01       -------tccgat----gtaagttct------------------------
A0A287AEC6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4X1VMQ3_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4X1VMQ3_BCL2L11      -------tccgat----gtaagttct------------------------
A0A287AEC6_BCL2L11      -------tccgat----gtaagttct------------------------
A0A4X1VMQ3_BCL2L11      -------tccgat----gtaagttct------------------------
U3IW89_BCL2L11-01       tggtaaacacggg----gcggggacg------------------------
A0A3Q2U844_BCL2L11      -------cccgag----gcgaaggcg------------------------
A0A669QMB4_BCL2L11      -------cccgag----gcgaaggcg------------------------
A0A663E970_BCL2L11      -------cccgag----gtgaaagcg------------------------
A0A674H354_BCL2L11      -------cccgag----gtgaaggcg------------------------
A0A672TST9_BCL2L11      -------cccgag----gtgaaggcg------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      -------tctgat----ttgaattcc------------------------
A0A7M4F197_BCL2L11      -------tctgat----ttgaattcc------------------------
A0A670KEZ9_BCL2L11      -------tctgat----ttaacttct------------------------
A0A670Y3D3_BCL2L11      -------tctgat----ttaaattct------------------------
A0A7N4NUH6_BCL2L11      -------tcagat----ctaaattct------------------------
A0A7N4NUH6_BCL2L11      -------tcagat----ctaaattct------------------------
A0A7N4NUH6_BCL2L11      -------tcagat----ctaaattct------------------------
A0A7N4NUH6_BCL2L11      -------tcagat----ctaaattct------------------------
A0A4X2L9J9_BCL2L11      -------tcagat----ctaaattct------------------------
A0A5F8H037_BCL2L11      -------tcagat----ctaaattct------------------------
A0A5F8H037_BCL2L11      -------tcagat----ctaaattct------------------------
K7GA86_BCL2L11-01       -------tctgat----ctgaattca------------------------
A0A674IAI8_BCL2L11      -------tctgat----ctaaattca------------------------
                                                                          

A0A4W3IWD3_BCL2L11      --atgca---------------------------------------gtcg
A0A4W3IWD3_BCL2L11      --atgtgttcaggt--------------------------------gtcg
A0A4W3IWD3_BCL2L11      agatgcagtcagtttcagttccacacactgactgacaaaagagaaggtcg
A0A4W4H3Y1_BCL2L11      gagcag---------------------------------ggggaaagcgg
A0A4W4H3Y1_BCL2L11      gagcag---------------------------------ggggaaagcgg
A0A3B1JXK6_BCL2L11      gagcag---------------------------------ggggaacgcgg
A0A3B4BSH7_BCL2L11      gagcag---------------------------------ggggagagtgg
A0A3B4BSH7_BCL2L11      gagcag---------------------------------ggggagagtgg
A0A3B4BSH7_BCL2L11      gagcag---------------------------------ggggagagtgg
B2KKY9_BCL2L11-01       ----------------------------------------agggaagcgg
B8JK68_BCL2L11-01       ----------------------------------------agggaagcgg
A0A3G3M2M0_BCL2L11      ----------------------------------------ggggaagtgg
A0A672PQD1_BCL2L11      ----------------------------------------ggggaagcgg
A0A671M057_BCL2L11      ----------------------------------------ggggaagcgg
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      ----------------------------------------ggggaagcgg
A0A671SJ75_BCL2L11      ----------------------------------------ggggaagcgg
A0A673IWZ7_BCL2L11      ----------------------------------------ggggaagcgg
A0A3P8XIA2_BCL2L11      gggaga---------------------------------gggaaaatcgg
A0A4W5R3N6_BCL2L11      gagaga---------------------------------gggaaatacgg
A0A4W5R3N6_BCL2L11      gagaga---------------------------------gggaaatacgg
A0A4W5R3N6_BCL2L11      gagaga---------------------------------gggaaatacgg
A0A1S3SAH9_BCL2L11      gagaga---------------------------------gggaaatacgg
A0A673WET2_BCL2L11      gagaga---------------------------------gggaaatacgg
A0A4W5NF23_BCL2L11      gagaga---------------------------------aggaaaagcgg
A0A673XGV4_BCL2L11      gaccaa---------------------------------ggggaaagcgg
A0A3B3QC78_BCL2L11      ---------------------------------------gcagaggacaa
A0A669C520_BCL2L11      gactgcggtctgcgcatttatttctggctgtttctctgtgacgcagctga
G1MV54_BCL2L11-01       -------------------------------------------gggatga
A0A673CKA1_BCL2L11      gcgtaaaat------------------------------cgcttaaacgc
M3XHJ5_BCL2L11-01       ------------------------------------------gaatgtgg
A0A3Q1ELG4_BCL2L11      gagggcggc------------------------------ggagcggatcc
A0A3Q1CI15_BCL2L11      accagcggc------------------------------t--ccagatgc
A0A3P8RLE2_BCL2L11      agaggcggc------------------------------ggagcagatcc
A0A3Q3ESW6_BCL2L11      cacgggacc------------------------------agaggagatcc
A0A3Q1ICY2_BCL2L11      ggggagagc------------------------------ggaggagaccc
A0A3Q3SYA1_BCL2L11      gaggagagc---------------------------------ggagatcc
A0A3Q3K6I5_BCL2L11      gaggagagc---------------------------------ggagatcc
A0A671W556_BCL2L11      caggggagc------------------------------ggaggagatcc
A0A4W6ETK4_BCL2L11      gaggagagc------------------------------ggaggagatcc
A0A4W6ETK4_BCL2L11      gaggagagc------------------------------ggaggagatcc
A0A4W6ETK4_BCL2L11      gaggagagc------------------------------ggaggagatcc
A0A3B4V919_BCL2L11      ggggagagc------------------------------gaaggggatcc
A0A3B4XZH1_BCL2L11      ggggagagc------------------------------gaaggggatcc
A0A3Q3B113_BCL2L11      gagggcagc------------------------------agcggaggagc
A0A3Q2SZH6_BCL2L11      gaggggacc------------------------------ggaggagaccc
A0A3P9N073_BCL2L11      ---------------------------------------------gaccc
A0A3B5M375_BCL2L11      gaggggacc------------------------------ggcggagaccc
A0A3B5QAM1_BCL2L11      gaggggacc------------------------------ggcggagaccc
A0A3B5QAM1_BCL2L11      gaggggacc------------------------------ggcggagaccc
A0A3B3VNE0_BCL2L11      gaggggacc------------------------------ggcggagaccc
A0A3B3YII5_BCL2L11      gaggggacc------------------------------ggcggagaccc
A0A3B3YII5_BCL2L11      gaggggacc------------------------------ggcggagaccc
A0A6I8NCK5_BCL2L11      gaatgtgac------------------------------agcgaaggcgg
A0A6I8NCK5_BCL2L11      gaatgtgac------------------------------agcgaaggcgg
A0A6I8NCK5_BCL2L11      gaatgtgac------------------------------agcgaaggcgg
A0A6I8NCK5_BCL2L11      gaatgtgac------------------------------agcgaaggcgg
A0A6I8NCK5_BCL2L11      gaatgtgac------------------------------agcgaaggcgg
A0A667ZMY7_BCL2L11      gcg---aac------------------------------gaaagcggcgg
A0A803WCD8_BCL2L11      ggtcgggtc------------------------------aggcacggccg
A0A803VLS8_BCL2L11      -----------------------------------------ataagg---
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       gagtgtgac------------------------------cgagaaggtag
A0A5F9C9V3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A671FCV3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A671FCV3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A671FCV3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A671FCV3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A5F9C9V3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
G3H020_BCL2L11-01       gagtgtgac------------------------------agagaaggtgg
G3H020_BCL2L11-02       gagtgtgac------------------------------agagaaggtgg
O54918_BCL2L11-03       gagtgtgac------------------------------agagaaggtgg
O54918_BCL2L11-01       gagtgtgac------------------------------agagaaggtgg
O54918_BCL2L11-05       gagtgtgac------------------------------agagaaggtgg
O54918_BCL2L11-06       gagtgtgac------------------------------agagaaggtgg
O54918_BCL2L11-08       gagtgtgac------------------------------agagaaggtgg
L8IVA4_BCL2L11-02       gagtgtgac------------------------------agagaaggtgg
A0A4W2D2G6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
L8IVA4_BCL2L11-01       gagtgtgac------------------------------agagaaggtgg
A0A4W2D2G6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4W2D2G6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4W2D2G6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4W2G3J8_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A3Q1MV27_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A3Q1MV27_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4W2G3J8_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4W2G3J8_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A3Q1MV27_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4W2G3J8_BCL2L11      gagtgtgac------------------------------agagaaggtgg
W5PY58_BCL2L11-01       gagtgtgac------------------------------agagaaggtgg
A0A452FCR6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A452FCR6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A3Q2GRS5_BCL2L11      gagtgtgac------------------------------agagaaggcgg
A0A3Q2GRS5_BCL2L11      gagtgtgac------------------------------agagaaggcgg
A0A3Q2GRS5_BCL2L11      gagtgtgac------------------------------agagaaggcgg
A0A3Q2GRS5_BCL2L11      gagtgtgac------------------------------agagaaggcgg
A0A3Q2GRS5_BCL2L11      gagtgtgac------------------------------agagaaggcgg
A0A286XJN2_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A286XJN2_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A286XJN2_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2I3GAA1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-03       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-23       gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A096NYC3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5X1Y3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3GAA1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-02       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-15       gagtgtgac------------------------------cgagaaggtag
A0A2K5X1Y3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A096NYC3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A287DFJ0_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A287DFJ0_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A1U7SU38_BCL2L11      gagtgtgac------------------------------cgagaaggggg
A0A1U7SU38_BCL2L11      gagtgtgac------------------------------cgagaaggggg
A0A1U7SU38_BCL2L11      gagtgtgac------------------------------cgagaaggggg
A0A1U7SU38_BCL2L11      gagtgtgac------------------------------cgagaaggggg
A0A1U7SU38_BCL2L11      gagtgtgac------------------------------cgagaaggggg
A0A1U7SU38_BCL2L11      gagtgtgac------------------------------cgagaaggggg
A0A1U7SU38_BCL2L11      gagtgtgac------------------------------cgagaaggggg
H0XW23_BCL2L11-01       gagtgtgac------------------------------cgagaaggtgg
A0A2K6GE22_BCL2L11      gagtgtgac------------------------------cgagaaggtgg
A0A2K6GE22_BCL2L11      gagtgtgac------------------------------cgagaaggtgg
A0A2K6GE22_BCL2L11      gagtgtgac------------------------------cgagaaggtgg
A0A2K6GE22_BCL2L11      gagtgtgac------------------------------cgagaaggtgg
A0A2K6GE22_BCL2L11      gagtgtgac------------------------------cgagaaggtgg
A0A2K6GE22_BCL2L11      gagtgtgac------------------------------cgagaaggtgg
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5X1Y3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-07       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-22       gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3GAA1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R8M6L7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R8M6L7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R8M6L7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R8M6L7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R8M6L7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R8M6L7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R8M6L7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R8M6L7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Q1U2_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5CA52_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6TRJ7_BCL2L11      gagtgtgac------------------------------cgagaaggtag
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3GAA1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3GAA1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A096NYC3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A096NYC3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5X1Y3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5X1Y3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5X1Y3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
F7HHA1_BCL2L11-01       gagtgtgac------------------------------cgagaaggtag
F7HHA1_BCL2L11-02       gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
F7HHA1_BCL2L11-03       gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3GAA1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-17       gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3GAA1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-20       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-09       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-14       gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-04       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-21       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-19       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-18       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-12       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-11       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-10       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-08       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-06       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-01       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-05       gagtgtgac------------------------------cgagaaggtag
O43521_BCL2L11-13       gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I2Y4B3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3GAA1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2R9BZX9_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2I3S5F6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5X1Y3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A096NYC3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A0D9RWE0_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5NTQ5_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6E1Z6_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5Z7V3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A096NYC3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5X1Y3_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6KJM8_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K6QIJ1_BCL2L11      gagtgtgac------------------------------cgagaaggtag
A0A2K5HZ87_BCL2L11      gagtgtgac------------------------------cgagaaggtag
G3SU55_BCL2L11-01       gagtgtgac------------------------------agagaaggtgg
U6CTE3_BCL2L11-04       gagtgtgac------------------------------cgagaaggtgg
M3YDI3_BCL2L11-01       gagtgtgac------------------------------cgagaaggtgg
U6CTE3_BCL2L11-01       gagtgtgac------------------------------cgagaaggtgg
U6CTE3_BCL2L11-02       gagtgtgac------------------------------cgagaaggtgg
U6CTE3_BCL2L11-03       gagtgtgac------------------------------cgagaaggtgg
A0A452U4S4_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A673SRF7_BCL2L11      gaatgtgac------------------------------agagaaggtgg
A0A673SRF7_BCL2L11      gaatgtgac------------------------------agagaaggtgg
A0A7N5JE15_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2I2UX96_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A667H9R7_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A673SRF7_BCL2L11      gaatgtgac------------------------------agagaaggtgg
A0A673SRF7_BCL2L11      gaatgtgac------------------------------agagaaggtgg
A0A7N5JE15_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A3Q7S5V2_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A3Q7S5V2_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A667H9R7_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2I2UX96_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2I2UX96_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2I2UX96_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A667H9R7_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A667H9R7_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A667H9R7_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A7N5JE15_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A7N5JE15_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A7N5JE15_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A7N5JE15_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A7N5JE15_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A452SBG5_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2Y9Q753_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2Y9Q753_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2Y9T3Y6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2Y9T3Y6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A2Y9T3Y6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A287AEC6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4X1VMQ3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A287AEC6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
C1KGB8_BCL2L11-01       gagtgtgac------------------------------agagaaggtgg
A0A4X1VMQ3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
C1KGB6_BCL2L11-01       gagtgtgac------------------------------agagaaggtgg
C1KGB7_BCL2L11-01       gagtgtgac------------------------------agagaaggtgg
A0A287AEC6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4X1VMQ3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4X1VMQ3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A287AEC6_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A4X1VMQ3_BCL2L11      gagtgtgac------------------------------agagaaggtgg
U3IW89_BCL2L11-01       ggacgggac------------------------------gggaggggcgg
A0A3Q2U844_BCL2L11      ccccgcgac------------------------------cgccgggccgg
A0A669QMB4_BCL2L11      ccccgcgac------------------------------cgccgggccgg
A0A663E970_BCL2L11      caacgcgac------------------------------ggcgaaggcgg
A0A674H354_BCL2L11      cgacgcgac------------------------------ggcgagggcgg
A0A672TST9_BCL2L11      caacgcgac------------------------------ggcgacggcgg
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      aagtgcggc------------------------------agtgaagacag
A0A7M4F197_BCL2L11      aagtgcggc------------------------------agtgaagacag
A0A670KEZ9_BCL2L11      gagtgcggt------------------------------agagagggtgg
A0A670Y3D3_BCL2L11      gagtgtgag------------------------------agagaaggtgg
A0A7N4NUH6_BCL2L11      gagtgtgac------------------------------cgtgaaggtgg
A0A7N4NUH6_BCL2L11      gagtgtgac------------------------------cgtgaaggtgg
A0A7N4NUH6_BCL2L11      gagtgtgac------------------------------cgtgaaggtgg
A0A7N4NUH6_BCL2L11      gagtgtgac------------------------------cgtgaaggtgg
A0A4X2L9J9_BCL2L11      gaatgccac------------------------------agagaaggtgg
A0A5F8H037_BCL2L11      gagtgtgac------------------------------agagaaggtgg
A0A5F8H037_BCL2L11      gagtgtgac------------------------------agagaaggtgg
K7GA86_BCL2L11-01       gagtgcgac------------------------------ggagaaggtgg
A0A674IAI8_BCL2L11      gagtgcaac------------------------------agagaaggtgg
                                                                          

A0A4W3IWD3_BCL2L11      tcaaggagtac---------------cc----------------------
A0A4W3IWD3_BCL2L11      tcaaggagtac---------------ccaggcatgtcacgaggtgagctt
A0A4W3IWD3_BCL2L11      tcaaggagtac---------------cc----------------------
A0A4W4H3Y1_BCL2L11      aga----aaaca--------------ccggt---gtcggaacagcctccc
A0A4W4H3Y1_BCL2L11      aga----aaaca--------------ccggt---gtcggaacagcctccc
A0A3B1JXK6_BCL2L11      cca----gagcg--------------gcgggggcggcggaacattgtccc
A0A3B4BSH7_BCL2L11      tca----gagca--------------gcgga------gcagcctcctccc
A0A3B4BSH7_BCL2L11      tca----gagca--------------gcgga------gcagcctcctccc
A0A3B4BSH7_BCL2L11      tca----gagca--------------gcgga------gcagcctcctccc
B2KKY9_BCL2L11-01       aga----gagca--------------ccggt---ggcggagtggtgttgc
B8JK68_BCL2L11-01       aga----gagca--------------ccggt---ggcggagtggtgttgc
A0A3G3M2M0_BCL2L11      aga----gagcg--------------ccggt---gtcggagctgcgttgc
A0A672PQD1_BCL2L11      aga----gagcg--------------ccggt---ggcgcagccgtcttag
A0A671M057_BCL2L11      aga----gagcg--------------ccggt---ggcggagctgtcgtgc
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      aga----gagcg--------------ccggt---ggcgcagccgtcttag
A0A671SJ75_BCL2L11      aga----gagcg--------------ccggt---ggcggagctgtcttgc
A0A673IWZ7_BCL2L11      aga----gagcg--------------ccggt---ggcggagctgtcttgc
A0A3P8XIA2_BCL2L11      aga-gtcgcatc--------------cctgt---ggcggagcaacctcga
A0A4W5R3N6_BCL2L11      aga-attgaatc--------------ccggt---ggcggagcagcctccg
A0A4W5R3N6_BCL2L11      aga-attgaatc--------------ccggt---ggcggagcagcctccg
A0A4W5R3N6_BCL2L11      aga-attgaatc--------------ccggt---ggcggagcagcctccg
A0A1S3SAH9_BCL2L11      aga-attgaatc--------------ccggt---ggcggagcagcctccg
A0A673WET2_BCL2L11      aga-attgaatc--------------ccggt---ggcggagcagcctccg
A0A4W5NF23_BCL2L11      aga-gtcgcatc--------------ccggt---ggcggagcagcctccc
A0A673XGV4_BCL2L11      aga-gtcgcatc--------------ccggt---ggcggagctgcctccc
A0A3B3QC78_BCL2L11      a---atcacacga-------------atggc---ggagag----------
A0A669C520_BCL2L11      agtcactctgggg-------------cttcc---tcatgcttttcctata
G1MV54_BCL2L11-01       aaa-gtcccgaag-------------tttgc---tctgag----------
A0A673CKA1_BCL2L11      gcatattgttcag-------------cgagc---ggcgag----------
M3XHJ5_BCL2L11-01       aca-tt--tgcat-------------cccac---ccaaagaccagat---
A0A3Q1ELG4_BCL2L11      aga-acccgtcggtgcagctggagtctcggc---gaaaacatcccgt---
A0A3Q1CI15_BCL2L11      aga--------gactcagagaggctaccgcc---aaatccgtcccat---
A0A3P8RLE2_BCL2L11      aga-acccgtcggtgcagctggggtctcggc---gaaaacatcccgt---
A0A3Q3ESW6_BCL2L11      acc-a------------------------------caaacctcccgt---
A0A3Q1ICY2_BCL2L11      acc-acccgtcggtgccgctggagtctcaac---gccaacctcccgt---
A0A3Q3SYA1_BCL2L11      acc-a---gccggtgatcccagagtctcggc---gcaaacctcccgt---
A0A3Q3K6I5_BCL2L11      acc-atctgtcggtgccgctggaacctcggc---gcaaagctcccgt---
A0A671W556_BCL2L11      atc-acccgccggtgccgccggagcctcagc---gcaaacctcccgc---
A0A4W6ETK4_BCL2L11      aca-cgtcgacggtgccgctggagcctcggc---gcaaacgtcccgt---
A0A4W6ETK4_BCL2L11      aca-cgtcgacggtgccgctggagcctcggc---gcaaacgtcccgt---
A0A4W6ETK4_BCL2L11      aca-cgtcgacggtgccgctggagcctcggc---gcaaacgtcccgt---
A0A3B4V919_BCL2L11      acc-actcgtcggtgccgctggagccccagc---gcaaaaccccagt---
A0A3B4XZH1_BCL2L11      acc-actcgtcggtgccgctggagccccggc---gcaaaaccccagt---
A0A3Q3B113_BCL2L11      tcc-ac------------------cgtccgc---cggcgccgctcgaggc
A0A3Q2SZH6_BCL2L11      agc-at------------------cctcagc---gcgaacaccacgtttg
A0A3P9N073_BCL2L11      agc-at------------------cgtcagc---gcgaacaccacgttcc
A0A3B5M375_BCL2L11      agc-at------------------cctcagc---gcgaacaccacgttcc
A0A3B5QAM1_BCL2L11      agc-at------------------cctcagc---gcgaacaccacgttcc
A0A3B5QAM1_BCL2L11      agc-at------------------cctcagc---gcgaacaccacgttcc
A0A3B3VNE0_BCL2L11      agc-at------------------cgtcagc---gcgaacaccacgttcc
A0A3B3YII5_BCL2L11      agc-at------------------cgtcagc---gcgaacaccacgttcc
A0A3B3YII5_BCL2L11      agc-at------------------cgtcagc---gcgaacaccacgttcc
A0A6I8NCK5_BCL2L11      acg-ac--tggag-------------cccgc---agaggggccggct---
A0A6I8NCK5_BCL2L11      acg-ac--tggag-------------cccgc---agaggggccggct---
A0A6I8NCK5_BCL2L11      acg-ac--tggag-------------cccgc---agaggggccggct---
A0A6I8NCK5_BCL2L11      acg-ac--tggag-------------cccgc---agaggggccggct---
A0A6I8NCK5_BCL2L11      acg-ac--tggag-------------cccgc---agaggggccggct---
A0A667ZMY7_BCL2L11      acg-gtgccgcggccacgccgctcctcccgg---agggaagggggac---
A0A803WCD8_BCL2L11      tcg-gg--cgctg-------------cccgc---cgagcg----------
A0A803VLS8_BCL2L11      -----c--tgcag-------------tt----------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       aca-at--tgcag-------------cctgc---ggagag----------
A0A5F9C9V3_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A671FCV3_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A671FCV3_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A671FCV3_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A671FCV3_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A5F9C9V3_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
G3H020_BCL2L11-01       aca-at--tgcag-------------cctgc---tgagag----------
G3H020_BCL2L11-02       aca-at--tgcag-------------cctgc---tgagag----------
O54918_BCL2L11-03       aca-at--tgcag-------------cctgc---tgagag----------
O54918_BCL2L11-01       aca-at--tgcag-------------cctgc---tgagag----------
O54918_BCL2L11-05       aca-at--tgcag-------------cctgc---tgagag----------
O54918_BCL2L11-06       aca-at--tgcag-------------cctgc---tgagag----------
O54918_BCL2L11-08       aca-at--tgcag-------------cctgc---tgagag----------
L8IVA4_BCL2L11-02       aca-at--tgcag-------------cctgc---cgagag----------
A0A4W2D2G6_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
L8IVA4_BCL2L11-01       aca-at--tgcag-------------cctgc---cgagag----------
A0A4W2D2G6_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A4W2D2G6_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A4W2D2G6_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A4W2G3J8_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A3Q1MV27_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A3Q1MV27_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A4W2G3J8_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A4W2G3J8_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A3Q1MV27_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A4W2G3J8_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
W5PY58_BCL2L11-01       aca-at--tgcag-------------cctgc---cgagag----------
A0A452FCR6_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A452FCR6_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A3Q2GRS5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A3Q2GRS5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A3Q2GRS5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A3Q2GRS5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A3Q2GRS5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A286XJN2_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A286XJN2_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A286XJN2_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A2I3GAA1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-03       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-23       aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A096NYC3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5X1Y3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2I3GAA1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-02       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-15       aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5X1Y3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A096NYC3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A287DFJ0_BCL2L11      aca-at--tgcag-------------cctgc---agagag----------
A0A287DFJ0_BCL2L11      aca-at--tgcag-------------cctgc---agagag----------
A0A1U7SU38_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A1U7SU38_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A1U7SU38_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A1U7SU38_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A1U7SU38_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A1U7SU38_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
A0A1U7SU38_BCL2L11      aca-at--tgcag-------------cctgc---cgagag----------
H0XW23_BCL2L11-01       aca-at--tgcaa-------------cctgc---ggagag----------
A0A2K6GE22_BCL2L11      aca-gt--tgcaa-------------tctgt---ggagag----------
A0A2K6GE22_BCL2L11      aca-gt--tgcaa-------------tctgt---ggagag----------
A0A2K6GE22_BCL2L11      aca-gt--tgcaa-------------tctgt---ggagag----------
A0A2K6GE22_BCL2L11      aca-gt--tgcaa-------------tctgt---ggagag----------
A0A2K6GE22_BCL2L11      aca-gt--tgcaa-------------tctgt---ggagag----------
A0A2K6GE22_BCL2L11      aca-gt--tgcaa-------------tctgt---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5X1Y3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-07       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-22       aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3GAA1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R8M6L7_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R8M6L7_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R8M6L7_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R8M6L7_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R8M6L7_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R8M6L7_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R8M6L7_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R8M6L7_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Q1U2_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5CA52_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6TRJ7_BCL2L11      aca-gt--tgcag-------------cctgc---ggagag----------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3GAA1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3GAA1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A096NYC3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A096NYC3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5X1Y3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5X1Y3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5X1Y3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
F7HHA1_BCL2L11-01       aca-at--tgcag-------------cctgc---ggagag----------
F7HHA1_BCL2L11-02       aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
F7HHA1_BCL2L11-03       aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3GAA1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-17       aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3GAA1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-20       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-09       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-14       aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-04       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-21       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-19       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-18       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-12       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-11       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-10       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-08       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-06       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-01       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-05       aca-at--tgcag-------------cctgc---ggagag----------
O43521_BCL2L11-13       aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I2Y4B3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3GAA1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2R9BZX9_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2I3S5F6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5X1Y3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A096NYC3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A0D9RWE0_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5NTQ5_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6E1Z6_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5Z7V3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A096NYC3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5X1Y3_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6KJM8_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K6QIJ1_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
A0A2K5HZ87_BCL2L11      aca-at--tgcag-------------cctgc---ggagag----------
G3SU55_BCL2L11-01       aca-gt--tacag-------------cctgc---ggagaggcccccg---
U6CTE3_BCL2L11-04       aca-at--tgcag-------------cctgt---tgagag----------
M3YDI3_BCL2L11-01       aca-at--tgcag-------------cctgt---tgagag----------
U6CTE3_BCL2L11-01       aca-at--tgcag-------------cctgt---tgagag----------
U6CTE3_BCL2L11-02       aca-at--tgcag-------------cctgt---tgagag----------
U6CTE3_BCL2L11-03       aca-at--tgcag-------------cctgt---tgagag----------
A0A452U4S4_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A673SRF7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A673SRF7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A7N5JE15_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A2I2UX96_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A667H9R7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A673SRF7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A673SRF7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A7N5JE15_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A3Q7S5V2_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A3Q7S5V2_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A667H9R7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A2I2UX96_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A2I2UX96_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A2I2UX96_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A667H9R7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A667H9R7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A667H9R7_BCL2L11      aca-at--tgcag-------------cctgc---tgagag----------
A0A7N5JE15_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A7N5JE15_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A7N5JE15_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A7N5JE15_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A7N5JE15_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A452SBG5_BCL2L11      aca-ac--tgcag-------------cctgc---tgagag----------
A0A2Y9Q753_BCL2L11      aca-at--tgcag-------------cctgc---cgaaag----------
A0A2Y9Q753_BCL2L11      aca-at--tgcag-------------cctgc---cgaaag----------
A0A2Y9T3Y6_BCL2L11      aca-at--tgcag-------------actgc---cgaaag----------
A0A2Y9T3Y6_BCL2L11      aca-at--tgcag-------------actgc---cgaaag----------
A0A2Y9T3Y6_BCL2L11      aca-at--tgcag-------------actgc---cgaaag----------
A0A287AEC6_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
A0A4X1VMQ3_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
A0A287AEC6_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
C1KGB8_BCL2L11-01       aca-gt--tgcag-------------cctgc---ggaaag----------
A0A4X1VMQ3_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
C1KGB6_BCL2L11-01       aca-gt--tgcag-------------cctgc---ggaaag----------
C1KGB7_BCL2L11-01       aca-gt--tgcag-------------cctgc---ggaaag----------
A0A287AEC6_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
A0A4X1VMQ3_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
A0A4X1VMQ3_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
A0A287AEC6_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
A0A4X1VMQ3_BCL2L11      aca-gt--tgcag-------------cctgc---ggaaag----------
U3IW89_BCL2L11-01       gca-g---------------------------------------------
A0A3Q2U844_BCL2L11      gcg-gc--tgccg-------------ccggg---agaggggccgggc---
A0A669QMB4_BCL2L11      gcg-gc--tgccg-------------ccggg---agaggggccgggc---
A0A663E970_BCL2L11      gcg-gc--taccg-------------ccggc---ggaggggccgggc---
A0A674H354_BCL2L11      gcg-gc--tgccg-------------gcggc---ggaggggccgggc---
A0A672TST9_BCL2L11      ----------------------------------ggagggcccgggc---
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      aca-gt--tgcag-------------ccccg---tgaaaggccaagt---
A0A7M4F197_BCL2L11      aca-gt--tgcag-------------ccccg---tgaaaggccaagt---
A0A670KEZ9_BCL2L11      aca-at--tgcag-------------cctgc---tgaaaggccagct---
A0A670Y3D3_BCL2L11      aca-at--tgcag-------------cctgc---tgaaaggccagct---
A0A7N4NUH6_BCL2L11      aca-at--tgcag-------------cctac---agaaaggcctact---
A0A7N4NUH6_BCL2L11      aca-at--tgcag-------------cctac---agaaaggcctact---
A0A7N4NUH6_BCL2L11      aca-at--tgcag-------------cctac---agaaaggcctact---
A0A7N4NUH6_BCL2L11      aca-at--tgcag-------------cctac---agaaaggcctact---
A0A4X2L9J9_BCL2L11      aca-at--tacac-------------cctac---agaaaggcctact---
A0A5F8H037_BCL2L11      aca-at--tgcag-------------cctac---agaaaggcctact---
A0A5F8H037_BCL2L11      aca-at--tgcag-------------cctac---agaaaggcctact---
K7GA86_BCL2L11-01       aca-gt--ttcag-------------tcaat---tgaaaggccaagt---
A0A674IAI8_BCL2L11      aca-gt--ttcag-------------tcaat---tgaaaggccaagt---
                                                                          

A0A4W3IWD3_BCL2L11      -------------------------------------agaatatccaatt
A0A4W3IWD3_BCL2L11      tctgggcaaagcgatttccctattaacacgacatgcgagaatatccaatt
A0A4W3IWD3_BCL2L11      ---------agcgatttccctattaacacgacatgcgagaatatccaatt
A0A4W4H3Y1_BCL2L11      gg---cccgaacagtttgactgctctcatccgaaccaag-gggac---ca
A0A4W4H3Y1_BCL2L11      gg---cccgaacagtttgactgctctcatccgaaccaag-gggac---ca
A0A3B1JXK6_BCL2L11      ga---gccgagcagtgcgagcagcctgagcccggcgatg-gcgac---cc
A0A3B4BSH7_BCL2L11      gggccgccgagcagtgcgagcagcctgagcccggcgagg-gggac---cc
A0A3B4BSH7_BCL2L11      gggccgccgagcagtgcgagcagcctgagcccggcgagg-gggac---cc
A0A3B4BSH7_BCL2L11      gggccgccgagcagtgcgagcagcctgagcccggcgagg-gggac---cc
B2KKY9_BCL2L11-01       cc---gccgggcactttgatttccctcagccgggcgaag-gggac---cc
B8JK68_BCL2L11-01       cc---gccgggcactttgatttccctcagccgggcgaag-gggac---cc
A0A3G3M2M0_BCL2L11      gc---cccgggcactttgacttccctcagccgagcgatg-gggac---cc
A0A672PQD1_BCL2L11      gc---tccgggcactttgacttccctcagccgagcgatg-gggac---cc
A0A671M057_BCL2L11      gc---tccgggtactttgacttccctcagccgagcgatg-gggac---cc
A0A673NIJ7_BCL2L11      ------------------------------------------------cc
A0A672L1R2_BCL2L11      gc---tccgggcactttgacttccctcagccgagcgatg-gggac---cc
A0A671SJ75_BCL2L11      gc---tccgggcactttgacttccctcagccgagcgatg-gggac---cc
A0A673IWZ7_BCL2L11      gc---tctgaacactttgacttccctcagccgagcgatg-gggac---cc
A0A3P8XIA2_BCL2L11      gt---tccaaactgtcagattacccccagtcctgcgaag-ggaaccagca
A0A4W5R3N6_BCL2L11      gt---gccgaaccgactgacatcccccagttcagcgaag-gggaccagca
A0A4W5R3N6_BCL2L11      gt---gccgaaccgactgacatcccccagttcagcgaag-gggaccagca
A0A4W5R3N6_BCL2L11      gt---gccgaaccgactgacatcccccagttcagcgaag-gggaccagca
A0A1S3SAH9_BCL2L11      gt---gccgaaccgactgacaacccccagttcagcgaaa-gggaccagca
A0A673WET2_BCL2L11      gt---gccgaaccgactgacaacccccagttcagcgaaa-gggaccagca
A0A4W5NF23_BCL2L11      gt---gccgaaccgtctgacaacccccagtcctgcgaag-gggaccagca
A0A673XGV4_BCL2L11      gt---gccgaaccgtctgacaacccccagtcctgcgaag-gggaccagca
A0A3B3QC78_BCL2L11      -----------------------tcgcaacccag---tg-gcggaacaga
A0A669C520_BCL2L11      aggcaaacagagatgtatctaccacctgtcggtgccacaggagctcaaac
G1MV54_BCL2L11-01       -------------------tgcactttagccaacactgg-----------
A0A673CKA1_BCL2L11      -----------------------------ctgagccccg----gtttcac
M3XHJ5_BCL2L11-01       -----------------caaccaccgtttgtaaagcaagagggctgctac
A0A3Q1ELG4_BCL2L11      tcgaactc---------caccgg---------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      ttgaactc---------caccgg---------------------------
A0A3Q3ESW6_BCL2L11      tcagacaa---------cagcgggggg--cgaaactttg-gccgcaccga
A0A3Q1ICY2_BCL2L11      tcgaacga---------cggcggggag--cggaggtttg-gccgccctga
A0A3Q3SYA1_BCL2L11      tcgaacgg---------cggcaccgac--cagagct--------------
A0A3Q3K6I5_BCL2L11      tcgaacgg---------cggcagcgag--cggagctttg-gccaccccgg
A0A671W556_BCL2L11      tcagacac---------cggcggcgtg--ccgagctccg-gccagcccag
A0A4W6ETK4_BCL2L11      tcgaacgacggcggcggcggcggcgag--cggagctttg-gccaccgcgg
A0A4W6ETK4_BCL2L11      tcgaacgacggcggcggcggcggcgag--cggagctttg-gccaccgcgg
A0A4W6ETK4_BCL2L11      tcgaacgacggcggcggcggcggcgag--cggagctttg-gccaccgcgg
A0A3B4V919_BCL2L11      tcgaaaga---------cagcggcgag--cggagccttg-gccacctcgg
A0A3B4XZH1_BCL2L11      tcgaaaga---------cagcggcgag--cgga-----------------
A0A3Q3B113_BCL2L11      tcggcgcacgc------gacccgtccggtccgcggcaga-gcgccg--ag
A0A3Q2SZH6_BCL2L11      tccaagcacagggaggggagctgcgcg--cagccgccgg-gcgccgttac
A0A3P9N073_BCL2L11      tcgaagcacacagagcggagctgcgcg--ccgcaggcgg-gcgcctccac
A0A3B5M375_BCL2L11      tcgaagcacacagagcggagccgcgcg--ccgcaggcgg-gcgcctccac
A0A3B5QAM1_BCL2L11      tcgaagcacacagagcggagccgcgcg--ccgcaggcgg-gcgcctccac
A0A3B5QAM1_BCL2L11      tcgaagcacacagagcggagccgcgcg--ccgcaggcgg-gcgcctccac
A0A3B3VNE0_BCL2L11      tcgaagcacacagagcggagctgcgcg--ccgcagacgg-gcgcctccac
A0A3B3YII5_BCL2L11      tcgaagcacacagagcggagctgcgcg--ccgcaggcgg-gcgcctccac
A0A3B3YII5_BCL2L11      tcgaagcacacagagcggagctgcgcg--ccgcaggcgg-gcgcctccac
A0A6I8NCK5_BCL2L11      -----------------cagcccccgcagctccgacccg-gggcacctac
A0A6I8NCK5_BCL2L11      -----------------cagcccccgcagctccgacccg-gggcacctac
A0A6I8NCK5_BCL2L11      -----------------cagcccccgcagctccgacccg-gggcacctac
A0A6I8NCK5_BCL2L11      -----------------cagcccccgcagctccgacccg-gggcacctac
A0A6I8NCK5_BCL2L11      -----------------cagcccccgcagctccgacccg-gggcacctac
A0A667ZMY7_BCL2L11      -----------------tcgccgtcccgg---ggagccg-gcccgcccat
A0A803WCD8_BCL2L11      -------------------------------cagccccg-cgcccgc---
A0A803VLS8_BCL2L11      -----------------------------------cctg-agg-------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       -------------------gcctccccagctcagacctg-gggcccctac
A0A5F9C9V3_BCL2L11      -------------------gccgccccagctcaggcctg-gggcccccac
A0A671FCV3_BCL2L11      -------------------accgcctcagctcaggcccg-gggctccgac
A0A671FCV3_BCL2L11      -------------------accgcctcagctcaggcccg-gggctccgac
A0A671FCV3_BCL2L11      -------------------accgcctcagctcaggcccg-gggctccgac
A0A671FCV3_BCL2L11      -------------------accgcctcagctcaggcccg-gggctccgac
A0A5F9C9V3_BCL2L11      -------------------gccgccccagctcaggcctg-gggcccccac
G3H020_BCL2L11-01       -------------------gcctccccagcttaggcctg-gggcccctac
G3H020_BCL2L11-02       -------------------gcctccccagcttaggcctg-gggcccctac
O54918_BCL2L11-03       -------------------gcctccccagctcaggcctg-gggcccctac
O54918_BCL2L11-01       -------------------gcctccccagctcaggcctg-gggcccctac
O54918_BCL2L11-05       -------------------gcctccccagctcaggcctg-gggcccctac
O54918_BCL2L11-06       -------------------gcctccccagctcaggcctg-gggcccctac
O54918_BCL2L11-08       -------------------gcctccccagctcaggcctg-gggcccctac
L8IVA4_BCL2L11-02       -------------------gcctcctcagctcagaccgg-gggcccccac
A0A4W2D2G6_BCL2L11      -------------------gcctcctcagctcagaccgg-gggcccccac
L8IVA4_BCL2L11-01       -------------------gcctcctcagctcagaccgg-gggcccccac
A0A4W2D2G6_BCL2L11      -------------------gcctcctcagctcagaccgg-gggcccccac
A0A4W2D2G6_BCL2L11      -------------------gcctcctcagctcagaccgg-gggcccccac
A0A4W2D2G6_BCL2L11      -------------------gcctcctcagctcagaccgg-gggcccccac
A0A4W2G3J8_BCL2L11      -------------------gcctcctcagctcagacctg-gggcccccac
A0A3Q1MV27_BCL2L11      -------------------gcctcctcagctcagacctg-gggcccccac
A0A3Q1MV27_BCL2L11      -------------------gcctcctcagctcagacctg-gggcccccac
A0A4W2G3J8_BCL2L11      -------------------gcctcctcagctcagacctg-gggcccccac
A0A4W2G3J8_BCL2L11      -------------------gcctcctcagctcagacctg-gggcccccac
A0A3Q1MV27_BCL2L11      -------------------gcctcctcagctcagacctg-gggcccccac
A0A4W2G3J8_BCL2L11      -------------------gcctcctcagctcagacctg-gggcccccac
W5PY58_BCL2L11-01       -------------------gcctcctcagctcagaccag-gggcccccac
A0A452FCR6_BCL2L11      -------------------gcctcctcagctcagaccag-gggcccccac
A0A452FCR6_BCL2L11      -------------------gcctcctcagctcagaccag-gggcccccac
A0A3Q2GRS5_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A3Q2GRS5_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A3Q2GRS5_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A3Q2GRS5_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A3Q2GRS5_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A286XJN2_BCL2L11      -------------------gccatcccagctcagggctg-gggccccaac
A0A286XJN2_BCL2L11      -------------------gccatcccagctcagggctg-gggccccaac
A0A286XJN2_BCL2L11      -------------------gccatcccagctcagggctg-gggccccaac
A0A2I3GAA1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-03       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-23       -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A096NYC3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5X1Y3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2I3GAA1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-02       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-15       -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5X1Y3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A096NYC3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A287DFJ0_BCL2L11      -------------------gcctccccagctcaggccgg-gggcccctac
A0A287DFJ0_BCL2L11      -------------------gcctccccagctcaggccgg-gggcccctac
A0A1U7SU38_BCL2L11      -------------------gcctccccaactcaggcctg-gggcccctac
A0A1U7SU38_BCL2L11      -------------------gcctccccaactcaggcctg-gggcccctac
A0A1U7SU38_BCL2L11      -------------------gcctccccaactcaggcctg-gggcccctac
A0A1U7SU38_BCL2L11      -------------------gcctccccaactcaggcctg-gggcccctac
A0A1U7SU38_BCL2L11      -------------------gcctccccaactcaggcctg-gggcccctac
A0A1U7SU38_BCL2L11      -------------------gcctccccaactcaggcctg-gggcccctac
A0A1U7SU38_BCL2L11      -------------------gcctccccaactcaggcctg-gggcccctac
H0XW23_BCL2L11-01       -------------------acctccccagctcaggcctg-gggcccctac
A0A2K6GE22_BCL2L11      -------------------acctccccagctcaggcctg-gggcccctac
A0A2K6GE22_BCL2L11      -------------------acctccccagctcaggcctg-gggcccctac
A0A2K6GE22_BCL2L11      -------------------acctccccagctcaggcctg-gggcccctac
A0A2K6GE22_BCL2L11      -------------------acctccccagctcaggcctg-gggcccctac
A0A2K6GE22_BCL2L11      -------------------acctccccagctcaggcctg-gggcccctac
A0A2K6GE22_BCL2L11      -------------------acctccccagctcaggcctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5X1Y3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-07       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-22       -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3GAA1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R8M6L7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2R8M6L7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2R8M6L7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2R8M6L7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2R8M6L7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2R8M6L7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2R8M6L7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2R8M6L7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5Q1U2_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K5CA52_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
A0A2K6TRJ7_BCL2L11      -------------------acctccccagctcagacctg-gggcccctac
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3GAA1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3GAA1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A096NYC3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A096NYC3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5X1Y3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5X1Y3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5X1Y3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
F7HHA1_BCL2L11-01       -------------------gcctccccagctcagacctg-gggcccctac
F7HHA1_BCL2L11-02       -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
F7HHA1_BCL2L11-03       -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3GAA1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-17       -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3GAA1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-20       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-09       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-14       -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-04       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-21       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-19       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-18       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-12       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-11       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-10       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-08       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-06       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-01       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-05       -------------------gcctccccagctcagacctg-gggcccctac
O43521_BCL2L11-13       -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I2Y4B3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3GAA1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2R9BZX9_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2I3S5F6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5X1Y3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A096NYC3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A0D9RWE0_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5NTQ5_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6E1Z6_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5Z7V3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A096NYC3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5X1Y3_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6KJM8_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K6QIJ1_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
A0A2K5HZ87_BCL2L11      -------------------gcctccccagctcagacctg-gggcccctac
G3SU55_BCL2L11-01       -----------------cagcctcctcagctcaggcctg-gggcccctac
U6CTE3_BCL2L11-04       -------------------gcctcctcagctcaggcctg-gggcccctac
M3YDI3_BCL2L11-01       -------------------gcctcctcagctcaggcctg-gggcccctac
U6CTE3_BCL2L11-01       -------------------gcctcctcagctcaggcctg-gggcccctac
U6CTE3_BCL2L11-02       -------------------gcctcctcagctcaggcctg-gggcccctac
U6CTE3_BCL2L11-03       -------------------gcctcctcagctcaggcctg-gggcccctac
A0A452U4S4_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A673SRF7_BCL2L11      -------------------acctcctcagctcaggcctg-gggcccctac
A0A673SRF7_BCL2L11      -------------------acctcctcagctcaggcctg-gggcccctac
A0A7N5JE15_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A2I2UX96_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A667H9R7_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A673SRF7_BCL2L11      -------------------acctcctcagctcaggcctg-gggcccctac
A0A673SRF7_BCL2L11      -------------------acctcctcagctcaggcctg-gggcccctac
A0A7N5JE15_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A3Q7S5V2_BCL2L11      -------------------acctcctcagctcaggcctg-gggctcctac
A0A3Q7S5V2_BCL2L11      -------------------acctcctcagctcaggcctg-gggctcctac
A0A667H9R7_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A2I2UX96_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A2I2UX96_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A2I2UX96_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A667H9R7_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A667H9R7_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A667H9R7_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A7N5JE15_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A7N5JE15_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A7N5JE15_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A7N5JE15_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A7N5JE15_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A452SBG5_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccctac
A0A2Y9Q753_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccat
A0A2Y9Q753_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccat
A0A2Y9T3Y6_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccat
A0A2Y9T3Y6_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccat
A0A2Y9T3Y6_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccat
A0A287AEC6_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A4X1VMQ3_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A287AEC6_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
C1KGB8_BCL2L11-01       -------------------gcctcctcagctcaggcctg-gggcccccac
A0A4X1VMQ3_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
C1KGB6_BCL2L11-01       -------------------gcctcctcagctcaggcctg-gggcccccac
C1KGB7_BCL2L11-01       -------------------gcctcctcagctcaggcctg-gggcccccac
A0A287AEC6_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A4X1VMQ3_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A4X1VMQ3_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A287AEC6_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
A0A4X1VMQ3_BCL2L11      -------------------gcctcctcagctcaggcctg-gggcccccac
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      -----------------ccggccgtcccgctgcggcccg-gagcccccgc
A0A669QMB4_BCL2L11      -----------------ccggccgtcccgctgcggcccg-gggcccctgc
A0A663E970_BCL2L11      -----------------ccggccgcgcagctgcgccccg-gagctcccgc
A0A674H354_BCL2L11      -----------------ccgggcgcgcagctgcgtcccg-gcgctcccgc
A0A672TST9_BCL2L11      -----------------ccggccgcgcaactgcgccccg-gcgctcccgc
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      -----------------cagcctcagcccgttaggcctg-gggcccctac
A0A7M4F197_BCL2L11      -----------------cagcctcagcccgttaggcctg-gggcccctac
A0A670KEZ9_BCL2L11      -----------------cag------catcttcggcctg-gggcccctac
A0A670Y3D3_BCL2L11      -----------------cagcctcatcaccttcggcctg-gggcccctac
A0A7N4NUH6_BCL2L11      -----------------caacct---caactcagaccag-gggcccctac
A0A7N4NUH6_BCL2L11      -----------------caacct---caactcagaccag-gggcccctac
A0A7N4NUH6_BCL2L11      -----------------caacct---caactcagaccag-gggcccctac
A0A7N4NUH6_BCL2L11      -----------------caacct---caactcagaccag-gggcccctac
A0A4X2L9J9_BCL2L11      -----------------cagcctcaacaactcagaccag-gggcccctac
A0A5F8H037_BCL2L11      -----------------cagcctcaacaactcagaccag-gggcccctac
A0A5F8H037_BCL2L11      -----------------cagcctcaacaactcagaccag-gggcccctac
K7GA86_BCL2L11-01       -----------------cagcctcagcatcttagacctg-gggcccctac
A0A674IAI8_BCL2L11      -----------------cagcctcagcatcttagacctg-gggcccctac
                                                                          

A0A4W3IWD3_BCL2L11      gtcaccggccttcattacaact----------------------------
A0A4W3IWD3_BCL2L11      gtcaccggccttcattacaact----------------------------
A0A4W3IWD3_BCL2L11      gtcaccggccttcattacaact----------------------------
A0A4W4H3Y1_BCL2L11      atttaggggagggattaca-------------------------------
A0A4W4H3Y1_BCL2L11      atttaggggagggattaca-------------------------------
A0A3B1JXK6_BCL2L11      ggttaggggaccccctgcgctg----------------------------
A0A3B4BSH7_BCL2L11      ggttaggggagggattacaatg----------------------------
A0A3B4BSH7_BCL2L11      ggttaggggagggattacaatg----------------------------
A0A3B4BSH7_BCL2L11      ggttaggggagggattacaatg----------------------------
B2KKY9_BCL2L11-01       gttaaggggagggatatccatg----------------------------
B8JK68_BCL2L11-01       gttaaggggagggatatccatg----------------------------
A0A3G3M2M0_BCL2L11      gttaaggggagggattgccatg----------------------------
A0A672PQD1_BCL2L11      gttaaggggagggattgccatg----------------------------
A0A671M057_BCL2L11      gttaaggggagggatttccatg----------------------------
A0A673NIJ7_BCL2L11      gttaaggggagggatttccatg----------------------------
A0A672L1R2_BCL2L11      gttaaggggagggattgccatg----------------------------
A0A671SJ75_BCL2L11      gttaaggggagggattgccatg----------------------------
A0A673IWZ7_BCL2L11      gttaaggggagggattgccatg----------------------------
A0A3P8XIA2_BCL2L11      gtcacggggaggaataatgatg----------------------------
A0A4W5R3N6_BCL2L11      gtcacgtggaggaataatgatg----------------------------
A0A4W5R3N6_BCL2L11      gtcacgtggaggaataatgatg----------------------------
A0A4W5R3N6_BCL2L11      gtcacgtggaggaataatgatg----------------------------
A0A1S3SAH9_BCL2L11      gtcacggggaggaataatgatg----------------------------
A0A673WET2_BCL2L11      gtcacggggaggaataatgatg----------------------------
A0A4W5NF23_BCL2L11      gtcacggggaggaataatgatt----------------------------
A0A673XGV4_BCL2L11      gtcactgggaggaataatgatt----------------------------
A0A3B3QC78_BCL2L11      ctccgatccaagccgg----------------------------------
A0A669C520_BCL2L11      atcccgtttaaaccgcggctctaccggaggaggagaaccg----------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      cggtcccaccggcgaaggacgagagccg----------------------
M3XHJ5_BCL2L11-01       tgcattatcagcccactttcaaaagtgatcgcactggtgaggtggagaga
A0A3Q1ELG4_BCL2L11      ------------agga---------------------------------g
A0A3Q1CI15_BCL2L11      -------------ggc---------------------------------t
A0A3P8RLE2_BCL2L11      ------------agga---------------------------------g
A0A3Q3ESW6_BCL2L11      ttccacgggaggagga---------------------------------g
A0A3Q1ICY2_BCL2L11      ctccagtggaggagga---------------------------------g
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      ctcggccggaggagga---------------------------------g
A0A671W556_BCL2L11      caccagtggaggagga---------------------------------g
A0A4W6ETK4_BCL2L11      ctccaccggaggagga---------------------------------g
A0A4W6ETK4_BCL2L11      ctccaccggaggagga---------------------------------g
A0A4W6ETK4_BCL2L11      ctccaccggaggagga---------------------------------g
A0A3B4V919_BCL2L11      ctccaccggagaagga---------------------------------g
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      cgccgcgggagga------------------------------------g
A0A3Q2SZH6_BCL2L11      cgccgccggaggaggaggagg---------------------ggagccgg
A0A3P9N073_BCL2L11      agccgggggaggaggaggagg------------aggaagaggggagccgg
A0A3B5M375_BCL2L11      agccgggggaggaggaggaggagaaggagaaggacgaagaggggagccgg
A0A3B5QAM1_BCL2L11      agccgggggaggaggaggaggagagggaggaggacgaagaggggagccgg
A0A3B5QAM1_BCL2L11      agccgggggaggaggaggaggagagggaggaggacgaagaggggagccgg
A0A3B3VNE0_BCL2L11      agccgggggaggaggaggagg---aggagggggaggaggaggggagccgg
A0A3B3YII5_BCL2L11      agccgggggaggaggaggagg---gggaggaggaggaagaggggagccgg
A0A3B3YII5_BCL2L11      agccgggggaggaggaggagg---gggaggaggaggaagaggggagccgg
A0A6I8NCK5_BCL2L11      ctc-tatccgaacccagtatca----------------------------
A0A6I8NCK5_BCL2L11      ctc-tatccgaacccagtatca----------------------------
A0A6I8NCK5_BCL2L11      ctc-tatccgaacccagtatca----------------------------
A0A6I8NCK5_BCL2L11      ctc-tatccgaacccagtatcaaggtaatctctcgggc------------
A0A6I8NCK5_BCL2L11      ctc-tatccgaacccagtatca----------------------------
A0A667ZMY7_BCL2L11      ctcaccgactaacagcctgtccggatatcagttgaggt------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       ctc-cctacagacagagccacaag--------------------------
A0A5F9C9V3_BCL2L11      ctc-cctgcagtcggagccgca----------------------------
A0A671FCV3_BCL2L11      ctc-tgtacagatagagcggca----------------------------
A0A671FCV3_BCL2L11      ctc-tgtacagatagagcggcaaggtaatcctgaaggt------------
A0A671FCV3_BCL2L11      ctc-tgtacagatagagcggcaaggtaatcctgaaggt------------
A0A671FCV3_BCL2L11      ctc-tgtacagatagagcggcaaggtaatcctgaaggt------------
A0A5F9C9V3_BCL2L11      ctc-cctgcagtcggagccgcaaggtaatccggaaggc------------
G3H020_BCL2L11-01       ctc-cctacaaacagaaccgca----------------------------
G3H020_BCL2L11-02       ctc-cctacaaacagaaccgcaaggtaatccagacggt------------
O54918_BCL2L11-03       ctc-cctacagacagaaccgca----------------------------
O54918_BCL2L11-01       ctc-cctacagacagaaccgcaaggtaatcccgacggc------------
O54918_BCL2L11-05       ctc-cctacagacagaaccgca----------------------------
O54918_BCL2L11-06       ctc-cctacagacagaaccgca----------------------------
O54918_BCL2L11-08       ctc-cctacagacagaaccgca----------------------------
L8IVA4_BCL2L11-02       ctc-tttacagacagagcggcaaggtaatcctgaagga------------
A0A4W2D2G6_BCL2L11      ctc-tttacagacagagcggca----------------------------
L8IVA4_BCL2L11-01       ctc-tttacagacagagcggca----------------------------
A0A4W2D2G6_BCL2L11      ctc-tttacagacagagcggca----------------------------
A0A4W2D2G6_BCL2L11      ctc-tttacagacagagcggcaaggtaatcctgaagga------------
A0A4W2D2G6_BCL2L11      ctc-tttacagacagagcggcaaggtaatcctgaagga------------
A0A4W2G3J8_BCL2L11      ctc-tttacagacagagcggca----------------------------
A0A3Q1MV27_BCL2L11      ctc-tttacagacagagcggca----------------------------
A0A3Q1MV27_BCL2L11      ctc-tttacagacagagcggca----------------------------
A0A4W2G3J8_BCL2L11      ctc-tttacagacagagcggca----------------------------
A0A4W2G3J8_BCL2L11      ctc-tttacagacagagcggcaaggtaatcctgaagga------------
A0A3Q1MV27_BCL2L11      ctc-tttacagacagagcggcaaggtaatcctgaagga------------
A0A4W2G3J8_BCL2L11      ctc-tttacagacagagcggcaaggtaatcctgaagga------------
W5PY58_BCL2L11-01       ctc-tttacagacagagcggcaaggtaatcctgaagga------------
A0A452FCR6_BCL2L11      ctc-tttacagacagagcggcaaggtaatcctgaagga------------
A0A452FCR6_BCL2L11      ctc-tttacagacagagcggca----------------------------
A0A3Q2GRS5_BCL2L11      ctc-tctacagatagagcagca----------------------------
A0A3Q2GRS5_BCL2L11      ctc-tctacagatagagcagca----------------------------
A0A3Q2GRS5_BCL2L11      ctc-tctacagatagagcagcaaggtaatcccggaggc------------
A0A3Q2GRS5_BCL2L11      ctc-tctacagatagagcagcaaggtaatcccggaggc------------
A0A3Q2GRS5_BCL2L11      ctc-tctacagatagagcagca----------------------------
A0A286XJN2_BCL2L11      ctc-cctacagacggagccccaaggtaatcctgaaggc------------
A0A286XJN2_BCL2L11      ctc-cctacagacggagccccaaggtaatcctgaaggc------------
A0A286XJN2_BCL2L11      ctc-cctacagacggagcccca----------------------------
A0A2I3GAA1_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
O43521_BCL2L11-03       ctc-cctacagacagagccacaag--------------------------
O43521_BCL2L11-23       ctc-cctacagacagagccacaag--------------------------
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A096NYC3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5X1Y3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaag--------------------------
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2I3GAA1_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
O43521_BCL2L11-02       ctc-cctacagacagagccacaag--------------------------
O43521_BCL2L11-15       ctc-cctacagacagagccacaag--------------------------
A0A2K5X1Y3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A096NYC3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaag--------------------------
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaag--------------------------
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaag--------------------------
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A287DFJ0_BCL2L11      ctc-ccttcagacagagcctcaaggtaatcccgaaggc------------
A0A287DFJ0_BCL2L11      ctc-ccttcagacagagcctca----------------------------
A0A1U7SU38_BCL2L11      ctc-cctacagacagagccgcaag--------------------------
A0A1U7SU38_BCL2L11      ctc-cctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7SU38_BCL2L11      ctc-cctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7SU38_BCL2L11      ctc-cctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7SU38_BCL2L11      ctc-cctacagacagagccgca----------------------------
A0A1U7SU38_BCL2L11      ctc-cctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7SU38_BCL2L11      ctc-cctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
H0XW23_BCL2L11-01       ctc-tctacatacagagccccaaggtaatcccgaaggcaatccggaagtc
A0A2K6GE22_BCL2L11      ctc-cctacagacagagccccaag--------------------------
A0A2K6GE22_BCL2L11      ctc-cctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE22_BCL2L11      ctc-cctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE22_BCL2L11      ctc-cctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE22_BCL2L11      ctc-cctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE22_BCL2L11      ctc-cctacagacagagcccca----------------------------
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5X1Y3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaag--------------------------
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaag--------------------------
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaag--------------------------
O43521_BCL2L11-07       ctc-cctacagacagagccacaag--------------------------
O43521_BCL2L11-22       ctc-cctacagacagagccacaag--------------------------
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2I3GAA1_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2R8M6L7_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaag--------------------------
A0A2R8M6L7_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2R8M6L7_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R8M6L7_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R8M6L7_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R8M6L7_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R8M6L7_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R8M6L7_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6TRJ7_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      ctc-cctacagacaga----------------------------------
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccaca----------------------------
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccaca----------------------------
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccaca----------------------------
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2I3GAA1_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GAA1_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A096NYC3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A096NYC3_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K5X1Y3_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K5X1Y3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5X1Y3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F7HHA1_BCL2L11-01       ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F7HHA1_BCL2L11-02       ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccaca----------------------------
F7HHA1_BCL2L11-03       ctc-cctacagacagagccaca----------------------------
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GAA1_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
O43521_BCL2L11-17       ctc-cctacagacagagccaca----------------------------
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GAA1_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-20       ctc-cctacagacagagccacaag--------------------------
O43521_BCL2L11-09       ctc-cctacagacagagccacaag--------------------------
O43521_BCL2L11-14       ctc-cctacagacagagccacaag--------------------------
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-04       ctc-cctacagacagagccacaag--------------------------
O43521_BCL2L11-21       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-19       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-18       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-12       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-11       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-10       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-08       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-06       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-01       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-05       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-13       ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2I2Y4B3_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GAA1_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2R9BZX9_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3S5F6_BCL2L11      ctc-cctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K5X1Y3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A096NYC3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A0D9RWE0_BCL2L11      ctc-cctacagacagagccaca----------------------------
A0A2K5NTQ5_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6E1Z6_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Z7V3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A096NYC3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5X1Y3_BCL2L11      ctc-cctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6KJM8_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6QIJ1_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K5HZ87_BCL2L11      ctc-cctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
G3SU55_BCL2L11-01       ctc-tctgctcacggagcctcaaggtaatcctgacggt------------
U6CTE3_BCL2L11-04       ctc-tctacagacagagcagca----------------------------
M3YDI3_BCL2L11-01       ctc-tctacagacagagcagca----------------------------
U6CTE3_BCL2L11-01       ctc-tctacagacagagcagcaaggtaatcctgaaggc------------
U6CTE3_BCL2L11-02       ctc-tctacagacagagcagcaaggtaatcctgaaggc------------
U6CTE3_BCL2L11-03       ctc-tctacagacagagcagca----------------------------
A0A452U4S4_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A673SRF7_BCL2L11      ctc-tctacagacccagcggca----------------------------
A0A673SRF7_BCL2L11      ctc-tctacagacccagcggca----------------------------
A0A7N5JE15_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A2I2UX96_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A667H9R7_BCL2L11      ctc-tctacagaccgagcagca----------------------------
A0A673SRF7_BCL2L11      ctc-tctacagacccagcggcaaggtaatcctgaaggc------------
A0A673SRF7_BCL2L11      ctc-tctacagacccagcggcaaggtaatcctgaaggc------------
A0A7N5JE15_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A3Q7S5V2_BCL2L11      ctc-tctacagacagaacagca----------------------------
A0A3Q7S5V2_BCL2L11      ctc-tctacagacagaacagca----------------------------
A0A667H9R7_BCL2L11      ctc-tctacagaccgagcagcaaggtaatcctgaaggc------------
A0A2I2UX96_BCL2L11      ctc-tctacagacagagcagcaaggtaatcctgaaggc------------
A0A2I2UX96_BCL2L11      ctc-tctacagacagagcagcaaggtaatcctgaaggc------------
A0A2I2UX96_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A667H9R7_BCL2L11      ctc-tctacagaccgagcagcaaggtaatcctgaaggc------------
A0A667H9R7_BCL2L11      ctc-tctacagaccgagcagcaaggtaatcctgaaggc------------
A0A667H9R7_BCL2L11      ctc-tctacagaccgagcagca----------------------------
A0A7N5JE15_BCL2L11      ctc-tctacagacagagcagcaaggtaatcctgaaggc------------
A0A7N5JE15_BCL2L11      ctc-tctacagacagagcagcaaggtaatcctgaaggc------------
A0A7N5JE15_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A7N5JE15_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A7N5JE15_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A452SBG5_BCL2L11      ctc-tctacagacagagcagca----------------------------
A0A2Y9Q753_BCL2L11      ctc-tctacagacagagcggcaaggtaatcccgaagga------------
A0A2Y9Q753_BCL2L11      ctc-tctacagacagagcggca----------------------------
A0A2Y9T3Y6_BCL2L11      ctc-tctacagacagagcggcaaggtaatcccgaagga------------
A0A2Y9T3Y6_BCL2L11      ctc-tctacagacagagcggca----------------------------
A0A2Y9T3Y6_BCL2L11      ctc-tctacagacagagcggcaaggtaatcccgaagga------------
A0A287AEC6_BCL2L11      ctc-tctacaaacagagcggcaa---------------------------
A0A4X1VMQ3_BCL2L11      ctc-tctacaaacagagcggcaa---------------------------
A0A287AEC6_BCL2L11      ctc-tctacaaacagagcggca----------------------------
C1KGB8_BCL2L11-01       ctc-tctacagacagagcggcaa---------------------------
A0A4X1VMQ3_BCL2L11      ctc-tctacaaacagagcggcaaggtaatccggaagga------------
C1KGB6_BCL2L11-01       ctc-tctacagacagagcggcaaggtaatccggaagga------------
C1KGB7_BCL2L11-01       ctc-tctacagacagagcggca----------------------------
A0A287AEC6_BCL2L11      ctc-tctacaaacagagcggcaaggtaatccggaagga------------
A0A4X1VMQ3_BCL2L11      ctc-tctacaaacagagcggcaaggtaatccggaagga------------
A0A4X1VMQ3_BCL2L11      ctc-tctacaaacagagcggca----------------------------
A0A287AEC6_BCL2L11      ctc-tctacaaacagagcggcaaggtaatccggaagga------------
A0A4X1VMQ3_BCL2L11      ctc-tctacaaacagagcggcaaggtaatccggaagga------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      cgc-gctgc-----------------------------------------
A0A669QMB4_BCL2L11      cgc-gctgc-----------------------------------------
A0A663E970_BCL2L11      cgc-tctgc-----------------------------------------
A0A674H354_BCL2L11      cgc-cctgc-----------------------------------------
A0A672TST9_BCL2L11      agc-cctgc-----------------------------------------
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      ctc-tatacaaacacagtatca----------------------------
A0A7M4F197_BCL2L11      ctc-tatacaaacacagtatca----------------------------
A0A670KEZ9_BCL2L11      ctc-cttacaaactgtgtaccaaggtaatcattcgggcgagcgggac---
A0A670Y3D3_BCL2L11      ctc-cttacaaactgaatatcaaggtaatcatttgggtgaacgggac---
A0A7N4NUH6_BCL2L11      ctc-tatacaaacacaatatca----------------------------
A0A7N4NUH6_BCL2L11      ctc-tatacaaacacaatatca----------------------------
A0A7N4NUH6_BCL2L11      ctc-tatacaaacacaatatcaaggta---attcaggtgaaggggac---
A0A7N4NUH6_BCL2L11      ctc-tatacaaacacaatatcaaggta---attcaggtgaaggggac---
A0A4X2L9J9_BCL2L11      ctc-tatacaaacacagtatca----------------------------
A0A5F8H037_BCL2L11      ctc-tatacaaacacagtatca----------------------------
A0A5F8H037_BCL2L11      ctc-tatacaaacacagtatcaaggta---attcaggtgaaggggac---
K7GA86_BCL2L11-01       ctc-tatacaaacacagtacca----------------------------
A0A674IAI8_BCL2L11      ctc-tatacaaacacagtatcaaggtaatcattcaggtgagggggacttc
                                                                          

A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W3IWD3_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A671M057_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A672L1R2_BCL2L11      --------------------------------------------------
A0A671SJ75_BCL2L11      --------------------------------------------------
A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A1S3SAH9_BCL2L11      --------------------------------------------------
A0A673WET2_BCL2L11      --------------------------------------------------
A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A673XGV4_BCL2L11      --------------------------------------------------
A0A3B3QC78_BCL2L11      ---------------------------tccgagaaccgccaaggtccctg
A0A669C520_BCL2L11      ------------------gattcgccttcctggtgcagaa----------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      ------------------gactcgccgtcccagatcggagtcaaagccac
M3XHJ5_BCL2L11-01       c-----------------agatctttactcagcaccctgatgggaggact
A0A3Q1ELG4_BCL2L11      agc---cg----------gactccccgtcctggtccaga------gc---
A0A3Q1CI15_BCL2L11      cgc---cg----------gactccccgtcctggtccagagcgcaggc---
A0A3P8RLE2_BCL2L11      agc---cg----------gactccccgtcctggtccagagcgcaggc---
A0A3Q3ESW6_BCL2L11      agc---cg----------gactcaccgtcccggtgcagattcaaaccagt
A0A3Q1ICY2_BCL2L11      agc---ct----------gaatcgcagtcccggtgcagaaccaaaagtag
A0A3Q3SYA1_BCL2L11      ------cc----------gtctcgccgtcccgaggcagaaccagatccat
A0A3Q3K6I5_BCL2L11      agc---cg----------gtctcgccttcccggtgcagaaccaaagccat
A0A671W556_BCL2L11      agc---cg----------gactcgccgtgctggcgcagaggcaaaaccat
A0A4W6ETK4_BCL2L11      agctggcg----------gactcgccgccccggt----------------
A0A4W6ETK4_BCL2L11      agctggcg----------gactcgccgccccggtgcagaaccaaagccat
A0A4W6ETK4_BCL2L11      agctggcg----------gactcgccgccccggtgcagaaccaaagccat
A0A3B4V919_BCL2L11      agc---ca----------gactcgccgccccggtgcagaaccatagccac
A0A3B4XZH1_BCL2L11      --------------------------------------aaccatagccac
A0A3Q3B113_BCL2L11      agc---cc----------gagtcgccggcctgct------------cctc
A0A3Q2SZH6_BCL2L11      act---cg----------gactcgccgccccgct------------ccat
A0A3P9N073_BCL2L11      act---cg----------gactcgccgccgtgca------------ccgt
A0A3B5M375_BCL2L11      act---cg----------gactcgccgccttgct------------ccgt
A0A3B5QAM1_BCL2L11      act---cg----------gactcgccgccttgct------------ccgt
A0A3B5QAM1_BCL2L11      act---cg----------gactcgccgccttgct------------ccgt
A0A3B3VNE0_BCL2L11      acg---cg----------gattcgccgccgtgct------------ccgt
A0A3B3YII5_BCL2L11      att---cg----------gactcgccgccgtgct------------ccgt
A0A3B3YII5_BCL2L11      att---cg----------gactcgccgccgtgct------------ccgt
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      ---------------------ggaggggaaagctgttcacagggcccgtt
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      gaaggggac---------cgctgcccccacggcagccctcagggcccgct
A0A671FCV3_BCL2L11      gaaggggac---------cgctgcccccacggcagccctcagggcccgct
A0A671FCV3_BCL2L11      gaaggggac---------cgctgcccccacggcagccctcagggcccgct
A0A5F9C9V3_BCL2L11      ------gac---------cgctgtgcgcacggcagccctcagggcccgct
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       gacggggac---------cgctgcccccacggcagccctcagggcccgct
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       gaaggggac---------cgctgcccccacggcagccctcagggcccgct
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       gaaggggac---------cgctgcccccaaggcagcccacagggcccgct
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      gaaggggac---------cgctgcctccaaggcagcccacagggcccgct
A0A4W2D2G6_BCL2L11      gaaggggac---------cgctgcctccaaggcagcccacagggcccgct
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccacagggcccgct
A0A3Q1MV27_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccacagggcccgct
A0A4W2G3J8_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccacagggcccgct
W5PY58_BCL2L11-01       gaaggggac---------cgctgcccccaaggcagcccgcagggcccgct
A0A452FCR6_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccgcagggcccgct
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctctgggcccgct
A0A3Q2GRS5_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctctgggcccgct
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      gcaggggac---------cgctccccccacggcagccctcagggcccgct
A0A286XJN2_BCL2L11      gcaggggac---------cgctccccccacggcagccctcagggcccgct
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      gaaggggac---------cgctgcccccacggcagcccacagggcccgct
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      gaaggggac---------cgctgcccccacggcagccctcagggcccact
A0A1U7SU38_BCL2L11      gaaggggac---------cgctgcccccacggcagccctcagggcccact
A0A1U7SU38_BCL2L11      gaaggggac---------cgctgcccccacggcagccctcagggcccact
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      gaaggggac---------cgctgcccccacggcagccctcagggcccact
A0A1U7SU38_BCL2L11      gaaggggac---------cgctgcccccacggcagccctcagggcccact
H0XW23_BCL2L11-01       gaaggggac---------cgctgcccccaaggcagccctcagggcccact
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      gaaggggac---------cgctgctcccacggcagccctcagggcccgct
A0A2K6GE22_BCL2L11      gaaggggac---------cgctgctcccacggcagccctcagggcccgct
A0A2K6GE22_BCL2L11      gaaggggac---------cgctgctcccacggcagccctcagggcccgct
A0A2K6GE22_BCL2L11      gaaggggac---------cgctgctcccacggcagccctcagggcccgct
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      gaaggggac---------agctgcctccacggcagccctcagggcccgct
A0A2K6TRJ7_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6TRJ7_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6TRJ7_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5CA52_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5CA52_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2R8M6L7_BCL2L11      gaaggggac---------agctgcctccacggcagccctcagggcccgct
A0A2R8M6L7_BCL2L11      gaaggggac---------agctgcctccacggcagccctcagggcccgct
A0A2R8M6L7_BCL2L11      gaaggggac---------agctgcctccacggcagccctcagggcccgct
A0A2R8M6L7_BCL2L11      gaaggggac---------agctgcctccacggcagccctcagggcccgct
A0A2R8M6L7_BCL2L11      gaaggggac---------agctgcctccacggcagccctcagggcccgct
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5CA52_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Q1U2_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6TRJ7_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5CA52_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Q1U2_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6TRJ7_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5CA52_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Q1U2_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Q1U2_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5CA52_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6TRJ7_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5HZ87_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6QIJ1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6QIJ1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6KJM8_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6KJM8_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I2Y4B3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I3GAA1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2R9BZX9_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I3S5F6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I2Y4B3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2R9BZX9_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5X1Y3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5NTQ5_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6E1Z6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Z7V3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5NTQ5_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
F7HHA1_BCL2L11-01       gaaggggac---------agctgcccccacggcagccctcagggcccgct
F7HHA1_BCL2L11-02       gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6E1Z6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6E1Z6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Z7V3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6QIJ1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5HZ87_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I2Y4B3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I3GAA1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2R9BZX9_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I3S5F6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5NTQ5_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6E1Z6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Z7V3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I2Y4B3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2R9BZX9_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I3GAA1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I2Y4B3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2R9BZX9_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-19       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-18       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-12       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-11       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-10       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-08       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-06       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-01       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-05       gaaggggac---------agctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-13       gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6KJM8_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6QIJ1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I2Y4B3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I3GAA1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2R9BZX9_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2I3S5F6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5NTQ5_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6E1Z6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Z7V3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5HZ87_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6KJM8_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6QIJ1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5X1Y3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5HZ87_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5NTQ5_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6E1Z6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Z7V3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A096NYC3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6E1Z6_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5Z7V3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A096NYC3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5X1Y3_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6KJM8_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K6QIJ1_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
A0A2K5HZ87_BCL2L11      gaaggggac---------agctgcccccacggcagccctcagggcccgct
G3SU55_BCL2L11-01       gaaggggac---------agctgcccccagggcagcccacagggcccgca
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       gaaggggac---------cgctgcccccaaggcagccctcagggcccact
U6CTE3_BCL2L11-02       gaaggggac---------cgctgcccccaaggcagccctcagggcccact
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A673SRF7_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A2I2UX96_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A2I2UX96_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A667H9R7_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A7N5JE15_BCL2L11      gaaggggac---------cgctgcccccaaggcagccctcagggcccgct
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccacagggcccact
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccgcagggcccact
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccgcagggcccact
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccccagggcccact
C1KGB6_BCL2L11-01       gaaggggac---------cgctgcccccaaggcagcccccagggcccact
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccccagggcccact
A0A4X1VMQ3_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccccagggcccact
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccccagggcccact
A0A4X1VMQ3_BCL2L11      gaaggggac---------cgctgcccccaaggcagcccccagggcccact
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      -ccggcgcc---------gcccggcccgc---------------------
A0A669QMB4_BCL2L11      -ccggcgcc---------gcccggcccgc---------------------
A0A663E970_BCL2L11      -ccg----------------------------------------------
A0A674H354_BCL2L11      -ctgg---g---------gccggcccggtgtccgcgggcgccgcggcgcg
A0A672TST9_BCL2L11      -ccggctcc---------gccgccaccgccacggcggggcctccgccgcg
A0A663E983_BCL2L11      --------------------------------------------------
A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      ------------------acttcatcacccagtagccctcagggaccact
A0A670Y3D3_BCL2L11      ------------------agttcatcacccggtagccctcagggaccact
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      ------------------agctgctcacctagcagccctcagggaccgtt
A0A7N4NUH6_BCL2L11      ------------------agctgctcacctagcagccctcagggaccgtt
A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      ------------------agctgctcacccagcagtcctcagggaccgtt
K7GA86_BCL2L11-01       --------------------------------------------------
A0A674IAI8_BCL2L11      acccagcagccctcagggagctcttcgcccagcagccctcagggaccatt
                                                                          

A0A4W3IWD3_BCL2L11      -tgcccattattcaatacgaatttttttcgtacaccatattcccctgttt
A0A4W3IWD3_BCL2L11      -tgcccattattcaatacgaatttttttcgtacaccatattcccctgttt
A0A4W3IWD3_BCL2L11      -tgcccattattcaatacgaatttttttcgtacaccatattcccctgttt
A0A4W4H3Y1_BCL2L11      ----------agtagtctttctggttaccattcaaggtcgcc--------
A0A4W4H3Y1_BCL2L11      ----------agtagtctttctggttaccattcaaggtcgcc--------
A0A3B1JXK6_BCL2L11      ----c---acaatagccttctcggttaccagacccggtcgcc--------
A0A3B4BSH7_BCL2L11      ----c---ctaatagccttctgggttaccagtcgcgttcgcc--------
A0A3B4BSH7_BCL2L11      ----c---ctaatagccttctgggttaccagtcgcgttcgcc--------
A0A3B4BSH7_BCL2L11      ----c---ctaatagccttctgggttaccagtcgcgttcgcc--------
B2KKY9_BCL2L11-01       ----t---cgaata------------accagtcgaggtcacc--------
B8JK68_BCL2L11-01       ----t---cgaata------------accagtcgaggtcacc--------
A0A3G3M2M0_BCL2L11      ----t---cgaatagtc---------accagtcgaggtcacc--------
A0A672PQD1_BCL2L11      ----t---cgagtagtc---------accagtcgaggtcacc--------
A0A671M057_BCL2L11      ----t---cgaatagtc---------accagtcgaggtcacc--------
A0A673NIJ7_BCL2L11      ----t---cgaatagtc---------accagtcgaggtcacc--------
A0A672L1R2_BCL2L11      ----t---cgagtagtc---------accagtcgaggtcacc--------
A0A671SJ75_BCL2L11      ----t---caaatagtc---------accagtcgaggtcacc--------
A0A673IWZ7_BCL2L11      ----t---caaatagtc---------accagtcgaggtcacc--------
A0A3P8XIA2_BCL2L11      ----ccgacgaatagtctgcttggtttccagtcgaggtcgcc--------
A0A4W5R3N6_BCL2L11      ----c---cgaatagtctgcttggtttccagtcgaggtcgcc--------
A0A4W5R3N6_BCL2L11      ----c---cgaatagtctgcttggtttccagtcgaggtcgcc--------
A0A4W5R3N6_BCL2L11      ----c---cgaatagtctgcttggtttccagtcgaggtcgcc--------
A0A1S3SAH9_BCL2L11      ----c---cgaatagtctgcttggtttccagtcgaggtcgcc--------
A0A673WET2_BCL2L11      ----c---cgaatagtctgcttggtttccagtcgaggtcgcc--------
A0A4W5NF23_BCL2L11      ----c---cgaatagtctgcttggtttccagtcgaggtcgcc--------
A0A673XGV4_BCL2L11      ----c---cgaatagtctgcttggtttccagtcgaggtcgcc--------
A0A3B3QC78_BCL2L11      gtcaactgcaagcgacccc-------------------------------
A0A669C520_BCL2L11      -----ccccgaagagctttgacgtttttcagagccggac-----------
G1MV54_BCL2L11-01       --------------------------------------------------
A0A673CKA1_BCL2L11      cctcctttctgatagcctcagcaggtttcagatgaggtctatattccgtg
M3XHJ5_BCL2L11-01       tctgttgccccccagcccctgtccttttgtcactaggtccccgtttttca
A0A3Q1ELG4_BCL2L11      ------------cagcctaggcgtgtttcagaccaggtc-----------
A0A3Q1CI15_BCL2L11      ------------cagcctaggcgtgtttcagaccaggtc-----------
A0A3P8RLE2_BCL2L11      ------------cagcctaggcgtgtttcagaccaggtc-----------
A0A3Q3ESW6_BCL2L11      ctcccctgtggacagcctcggcgtgttccagaagagatc-----------
A0A3Q1ICY2_BCL2L11      ctcgtcttccgacggcctaggcgtgttt------aggtc-----------
A0A3Q3SYA1_BCL2L11      tgcccatctcgacagcctaagcgtgtttcacacgaggtc-----------
A0A3Q3K6I5_BCL2L11      cgctcctctcgacagcctaagcgtgtttcacacaaggtc-----------
A0A671W556_BCL2L11      ctcccctctcgacagtcttggcgtgtttcagacgaggtc-----------
A0A4W6ETK4_BCL2L11      ---------------cctaggcgtgtttcagaagaggtc-----------
A0A4W6ETK4_BCL2L11      ctcccctctcgacagcctaggcgtgtttcagaagaggtc-----------
A0A4W6ETK4_BCL2L11      ctcccctctcgacagcctaggcgtgtttcagaagaggtc-----------
A0A3B4V919_BCL2L11      ctctcctgtcaaca------------------------------------
A0A3B4XZH1_BCL2L11      ctctcctggcaacagcctaggcgtgtttcaaaagaggtc-----------
A0A3Q3B113_BCL2L11      caacccccccgctggcttagacgtgtttcggagcaggtc-----------
A0A3Q2SZH6_BCL2L11      aag---cccgaacagtttagacgtctttcaaagaaggtc-----------
A0A3P9N073_BCL2L11      gag---cccggccagtttagacgtctttcgaagcaggtc-----------
A0A3B5M375_BCL2L11      gag---cccggccagtttagacgtctttcgaagcaggtc-----------
A0A3B5QAM1_BCL2L11      gag---cccggccagtttagacgtctttcgaagcaggtc-----------
A0A3B5QAM1_BCL2L11      gag---cccggccagtttagacgtctttcgaagcaggtc-----------
A0A3B3VNE0_BCL2L11      gag---cccggccagtttagacgtctttcgaagcaggtc-----------
A0A3B3YII5_BCL2L11      gag---cccggccagtttagacgtctttcgaagcaggtc-----------
A0A3B3YII5_BCL2L11      gag---cccggccagtttagacgtctttcgaagcaggtc-----------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      cccgccgtccagtagccccaggccgtttgccaccagatccccacttttca
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A667ZMY7_BCL2L11      --------------------------------------------------
A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      ggccccgcctgccagccccgggccttttgccaccagatccccgctcttca
A0A671FCV3_BCL2L11      ggccccgcctgccagccccgggccttttgccaccagatccccgctcttca
A0A671FCV3_BCL2L11      ggccccgcctgccagccccgggccttttgccaccagatccccgctcttca
A0A5F9C9V3_BCL2L11      ggccccatcggccagccctggccctttcgctaccaggtccccgctcttca
G3H020_BCL2L11-01       --------------------------------------------------
G3H020_BCL2L11-02       ggccccaccggccagccctggcccttttgctaccagatccccacttttca
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       ggccccaccggccagccctggcccttttgctaccagatccccacttttca
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
L8IVA4_BCL2L11-02       ggccccaccggccagccctggccctttcgctaccagatccccgctcttca
A0A4W2D2G6_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
A0A4W2D2G6_BCL2L11      --------------------------------------------------
A0A4W2D2G6_BCL2L11      ggccccaccggccagccctggccctttcgctaccagatccccgctcttca
A0A4W2D2G6_BCL2L11      ggccccaccggccagccctggccctttcgctaccagatccccgctcttca
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      --------------------------------------------------
A0A4W2G3J8_BCL2L11      ggccccaccggccagccctggccctttcgctaccagatccccgctcttca
A0A3Q1MV27_BCL2L11      ggccccaccggccagccctggccctttcgctaccagatccccgctcttca
A0A4W2G3J8_BCL2L11      ggccccaccggccagccctggccctttcgctaccagatccccgctcttca
W5PY58_BCL2L11-01       ggccccaccggccagccccggccctttcgctaccagatccccgctcttca
A0A452FCR6_BCL2L11      ggccccaccggccagccccggccctttcgctaccagatccccgctcttca
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgtttttca
A0A3Q2GRS5_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgtttttca
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      ggccccaccggccagtcctggcccttttgctaccagatccccgctattca
A0A286XJN2_BCL2L11      ggccccaccggccagtcctggcccttttgctaccagatccccgctattca
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A1U7SU38_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A1U7SU38_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A1U7SU38_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
H0XW23_BCL2L11-01       ggccccaccggccagccctggtccttttgctaccagatccccgcttttca
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6GE22_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6GE22_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6GE22_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      --------------------------------------------------
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ggccccaccggccagccccggcccttttgctaccagatccccgcttttca
A0A2K6TRJ7_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6TRJ7_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6TRJ7_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6TRJ7_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5CA52_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5CA52_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2R8M6L7_BCL2L11      ggccccaccggccagccccggcccttttgctaccagatccccgcttttca
A0A2R8M6L7_BCL2L11      ggccccaccggccagccccggcccttttgctaccagatccccgcttttca
A0A2R8M6L7_BCL2L11      ggccccaccggccagccccggcccttttgctaccagatccccgcttttca
A0A2R8M6L7_BCL2L11      ggccccaccggccagccccggcccttttgctaccagatccccgcttttca
A0A2R8M6L7_BCL2L11      ggccccaccggccagccccggcccttttgctaccagatccccgcttttca
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRJ7_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5CA52_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Q1U2_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6TRJ7_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5CA52_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Q1U2_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6TRJ7_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5CA52_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Q1U2_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Q1U2_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5CA52_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6TRJ7_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      ---------------ccctggcccttttgctaccagatcccc--------
A0A2K5HZ87_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5HZ87_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5HZ87_BCL2L11      --------------------------------------------------
A0A2K6QIJ1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6QIJ1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6QIJ1_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6QIJ1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6KJM8_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6KJM8_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3GAA1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I2Y4B3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I3GAA1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2R9BZX9_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I3S5F6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I2Y4B3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2R9BZX9_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I2Y4B3_BCL2L11      --------------------------------------------------
A0A2R9BZX9_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5X1Y3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5NTQ5_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6E1Z6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Z7V3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5NTQ5_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
F7HHA1_BCL2L11-01       ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
F7HHA1_BCL2L11-02       ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6E1Z6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6E1Z6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Z7V3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6QIJ1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5HZ87_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I2Y4B3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I3GAA1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2R9BZX9_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I3S5F6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5NTQ5_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6E1Z6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Z7V3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-17       --------------------------------------------------
A0A2I3S5F6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I2Y4B3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2R9BZX9_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I3GAA1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-14       --------------------------------------------------
A0A2I3S5F6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I2Y4B3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2R9BZX9_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-04       --------------------------------------------------
O43521_BCL2L11-21       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-19       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-18       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-12       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-11       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-10       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-08       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-06       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-01       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-05       ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-13       ggccccacctgccagccctggccc--------------------------
A0A2K6KJM8_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6QIJ1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I2Y4B3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I3GAA1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2R9BZX9_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2I3S5F6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5NTQ5_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6E1Z6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Z7V3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5HZ87_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6KJM8_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6QIJ1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5X1Y3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5HZ87_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5NTQ5_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6E1Z6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Z7V3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A096NYC3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6E1Z6_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5Z7V3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A096NYC3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5X1Y3_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6KJM8_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K6QIJ1_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
A0A2K5HZ87_BCL2L11      ggccccaccggccagccctggcccttttgctaccagatccccgcttttca
G3SU55_BCL2L11-01       ggccccaccagccagccccggcccttttgctaccagatccccgcttttca
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       ggccccacctgccagccccggcccttttgctaccagatccccgcttttca
U6CTE3_BCL2L11-02       ggccccacctgccagccccggcccttttgctaccagatccccgcttttca
U6CTE3_BCL2L11-03       --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      ggccccaccagccagccccgggccttttgctaccagatccccgcttttca
A0A673SRF7_BCL2L11      ggccccaccagccagccccgggccttttgctaccagatccccgcttttca
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      ggccccaccagccagccccgggccttttgctaccagatccccgcttttca
A0A2I2UX96_BCL2L11      ggccccaccagccagccccgggccttttgctaccagatccccgtttttca
A0A2I2UX96_BCL2L11      ggccccaccagccagccccgggccttttgctaccagatccccgtttttca
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      ggccccaccagccagccccgggccttttgctaccagatccccgcttttca
A0A667H9R7_BCL2L11      ggccccaccagccagccccgggccttttgctaccagatccccgcttttca
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggccccaccagccagcccaggcccttttgctaccagatccccgcttttca
A0A7N5JE15_BCL2L11      ggccccaccagccagcccaggcccttttgctaccagatccccgcttttca
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      ggccccaccggccagtcccggccctttcgctaccagatccccgcttttca
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      ggccccaccggccagtcccggcccttttgctaccagatccccgcttttca
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      ggccccaccggccagtcccggcccttttgctaccagatccccgcttttca
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      ggccccaccgaccagccctggcccctttgctaccagatccccgcttttca
C1KGB6_BCL2L11-01       ggccccaccgaccagccctggcccctttgctaccagatccccgcttttca
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      ggccccaccgaccagccctggcccctttgctaccagatccccgcttttca
A0A4X1VMQ3_BCL2L11      ggccccaccgaccagccctggcccctttgctaccagatccccgcttttca
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ggccccaccgaccagccctggcccctttgctaccagatccccgcttttca
A0A4X1VMQ3_BCL2L11      ggccccaccgaccagccctggcccctttgctaccagatccccgcttttca
U3IW89_BCL2L11-01       ---------cggcagccccgagc---------------------------
A0A3Q2U844_BCL2L11      ---ctcgcccggcagccccggcccgttcgccatccgctcgccgctcttct
A0A669QMB4_BCL2L11      ---ctcgcccggcagccccggcccgttcgccatccgctcgccgctcttct
A0A663E970_BCL2L11      --------------------------------------------------
A0A674H354_BCL2L11      gggcccgcccgccagccccggccccttcgccacccgctcgccgctcttca
A0A672TST9_BCL2L11      gggcccccccgccagccccgggcccttcgccacacggtcgccgctgttca
A0A663E983_BCL2L11      ----------------------------atcacacag-------------
A0A663MLZ1_BCL2L11      ----------------------------gggtcacag-------------
A0A803SRF0_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A670KEZ9_BCL2L11      ggcaccaccctccagccccagtccgtttgctaccagatccccgttgttca
A0A670Y3D3_BCL2L11      ggcaccaccctccagtcccagtccatttgcaaccagatccccgttgttca
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      tgcaccacccactagccctagcccgtttgctaccagatccccacttttca
A0A7N4NUH6_BCL2L11      tgcaccacccactagccctagcccgtttgctaccagatccc