Dataset for CDS BAD of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

209 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      tccctctcctctctctctctgcctctcctcctttccctctcctctctctc
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      cctctcctctctctctccctctcctctctcccccctcctctccctctcct
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      ctctcctctctcgccctctccgccttcctctgcctctctctctctctgcc
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      tctccctcctcctctcctctcctctgcctctctccctcctcgctctcttg
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      atgttgtctccctctcctcctctccctttccctacctatccactctctct
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      cctctcgctctcctctctctcctctcctctctctcctccctctcctctct
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      ctctgcctctcctcctgtctctttccctctctccacctctctctttccct
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      ctctctctctgcctctcctccttccctctcctctctctcccctctcctct
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      ccctctctacctctccactctctctctgccctctctccttcatctctctc
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      ctctctctccctctcctctccctctcctctctctctccctctcctctctc
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      ------------------------------------atgaagacttaccg
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      taccctctct----------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      tctcctctcccctctcctcctctcttctctctctctctgcctctcctcct
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      gagtgttggcccgatgcagttagtgtctgtgctctcaatctcacgcagga
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      ttccctctcctctctctccccctctcctctctctctccctctcctctccc
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      ttcgctcgtgctctgctgctgtctcggcgctcgccatcttccataacctc
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      tctcctctctctcctccctctcctctctctctccctctcctctctctctc
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      gcgaccacagtctatgctcacgacgcactcttgagaacacagcgcccgcc
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      cctctcctctctctctccctctcctctctctgcctctcctcctttccctc
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      ggagagagagagaaagagagagagggggaaaatactggagcttttacttc
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      tccctctctctctccctctcctctctctctttctctgcctcttttctctc
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      ------------------------------------------------at
A0A3P8YI30_BAD-01      ------------------------------------------------at
A0A3P8YI30_BAD-02      ------------------------------------------------at
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      ------------------------------------------------at
A0A3B4DUY7_BAD-01      ------------------------------------------------at
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      cgtgctcagtatcctgcactgtgtgtgagctggaagtgaattgtagttgc
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------atgtttaacagcagcttt
A0A3B1IH05_BAD-01      --------------------------------atgt--------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      tctttgcctcttttctctctctctgcctcacctcctgtctctctctctct
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      -----atgaagtgtaacaacaagtgttatcattttataagacttgttttt
A0A3Q3FKT9_BAD-01      -----atgacac-taacagcaagt--------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      -----atgtacaggaacaaatgttgtttggtcatcatttgtatgaataac
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      gcacaatcaatatttgttgagattgaggaaagcgaattttactcgcgagg
A0A3P8YI30_BAD-01      gttttattcattttgtcactctccctgtgatgagtgtttcctaacaatat
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      -------------------------------------------------a
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      gagcaatcagtatctgctaaaactgaggagagctcgttttaattgcgacg
A0A3B4DUY7_BAD-01      gagcaatcaatatctgcagaaactgaggagagctcgttttaattgcgaag
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      gctgctactccacataacacgggtgcgtgtcaggacagcagcaggaatcc
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      gacttcgatcggttgagaaaagtttgtgcggcgcgtcaccgagaacaaca
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      ----------------------------ctccacacctcttccccctctc
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      ctcctcacgtctctttcccccctttccgctctctatctcgctcccctctc
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      gtcaaaaagcagtcggttatctgcgcaggttacggcactgtgaatacctt
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      gtgcttaacgtttgttttcctactgtggtattaataactgtgaaactcag
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      ------------atgtcgccaagtagcagcagccatattggatgctttcc
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      at------tataaaaaagtaatcaaggccaaaacactgcgt------gaa
A0A3P8YI30_BAD-01      gtaatgcctttggtcagtgtttattaaggatggatgttttt---------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      tggctataatcaacactatcattcactgtggatgtcctttt---------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      aggagggatatagccaagcacttaacagcagaacatcgactgaaggaggg
A0A3B4DUY7_BAD-01      aggagcgatataagaaagtaattaa------aacactgact------gga
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      aaacagggccagtgagtccaaacatccagacacccagatcacccggaaga
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      accacccgcagaccaaacgagtaggagcgttagcgttagctaccgggagt
A0A3B1IH05_BAD-01      ------------ccacagcggcgagagcggcggcggggacctgcga----
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      actccacccctcttcacctccatctcactcctttcttgtttcccctctct
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      tctccacccctcttcccctccatctcactgctttcttgtttcccct----
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      tggaccggcttacagcagggacagcacagagaataagatatcctgcttgg
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      taacattgactcgtgcacatctacttatgggcatttccttgtctataata
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      ttacccactgagaaatcagatcaactcgagtccaagttgcactttcattt
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          -----------------------------------------atgggggat
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          -----------------------------------------atggagaac
A0A672LB88_BAD-01      -----------------------------------------atggataac
A0A671PX91_BAD-01      -----------------------------------------atggataac
A0A673J5Q9_BAD-01      -----------------------------------------atggataac
A0A672R7P6_BAD-01      -----------------------------------------atggataaa
A0A671SBB4_BAD-01      -----------------------------------------atggataaa
A0A673I6H5_BAD-01      -----------------------------------------atggataaa
A0A4W4DXF5_BAD-01      gagggagagacaccttcgaacacatcgtgctggaatccttttagagtcac
A0A3P8YI30_BAD-01      -----------------------tctcttcaggcttttaaaatggatcac
A0A3P8YI30_BAD-02      -------------------------------ggcttttaaaatggatcac
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      -----------------------------------------atggaccac
A0A4W5MZR2_BAD-01      -----------------------------------------atggaccac
A0A674AVP9_BAD-01      -----------------------------------------atggaccac
A0A1S3L0Z2_BAD-01      -----------------------------------------atggactac
B5XEF1_BAD-01          -----------------------------------------atggactac
B5X1T1_BAD-01          -----------------------------------------atggaccac
A0A673ZHY7_BAD-01      -----------------------------------------atggaccac
A0A4W5R1T6_BAD-01      -----------------------tctcttcagatatttacaatgaaccac
A0A060W8P9_BAD-01      -----------------------------------------atgaaccac
A0A3B1JLM2_BAD-01      gggagagatacgcttttcaggccattgtgctggaattcatctggaagcac
A0A3B4DUY7_BAD-01      gagaaaggaacgccttttaacccattgtgctggaattcattaagaaccac
A0A672V9F8_BAD-01      -----------------------------------------atgg-----
A0A674GQ16_BAD-01      -----------------------------------------atgc-----
A7MCM4_BAD-01          -----------------------------------------atggcacat
Q4V925_BAD-02          -----------------------------------------atggcacat
Q4V925_BAD-03          -----------------------------------------atggcacat
Q4V925_BAD-01          -----------------------------------------atggcacat
Q4V925_BAD-04          -----------------------------------------atggcacat
A0A671NP27_BAD-01      -----------------------------------------atggcacaa
A0A672SAE4_BAD-01      -----------------------------------------atggcacaa
A0A672SAE4_BAD-02      -----------------------------------------atggcacaa
A0A673J9C6_BAD-01      ctgtacgtaggacgccgacagactcaagaaatcgtttaatcatggcacaa
A0A672RGH0_BAD-01      -----------------------------------------atggcacaa
A0A671RUV0_BAD-01      -----------------------------------------atggcacaa
A0A673HRQ3_BAD-01      -----------------------------------------atggcacaa
A0A4W4HE29_BAD-01      tcacatcagccgccggtcagctgtcagaagtcgttttcacaatggctcag
A0A3B1IH05_BAD-01      -ctccactgctgtcagccagccgtccaaactcgatttcacaatggatcac
A0A3B4CPH6_BAD-01      -----------------------------------------atggctcat
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      -----------------------------------------ctgg-----
A0A3P8Y761_BAD-01      -----------------------------------------atgg-----
A0A3P8Y761_BAD-02      -----------------------------------------atgggctgt
A0A667ZNC6_BAD-01      -----------------------------------------atgg-----
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      -----------------------------------------atgg-----
A0A4W5JLL9_BAD-01      -----------------------------------------atgg-----
A0A4W5JLL9_BAD-02      cactcactcccctgcctccctcttcctccgtagatgtcagcatgg-----
A0A1S3N9Q3_BAD-01      -----------------------------------------atgg-----
A0A674DKC6_BAD-01      ----------cctcacttcctcttcctctgtagatgtcagcatgg-----
A0A3Q2Y0E4_BAD-01      -----------------------------------------atgg-----
A0A668V3Q4_BAD-01      -----------------------------------------atgg-----
I3K7B6_BAD-01          -----------------------------------------atgg-----
A0A3P9B2E4_BAD-01      -----------------------------------------atgg-----
A0A3Q4GGN3_BAD-01      -----------------------------------------atgg-----
A0A3P8QRJ7_BAD-01      -----------------------------------------atgg-----
A0A3Q3C680_BAD-01      -----------------------------------------atgg-----
A0A3B4GXJ6_BAD-01      -----------------------------------------atgg-----
A0A3Q0QNQ2_BAD-01      ---------------------------------ttcatccatttt-----
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      -----------------------------------------atgg-----
A0A672JQ68_BAD-01      -----------------------------------------atgg-----
A0A3P8WI83_BAD-01      -----------------------------------------atgg-----
A0A3P8WI83_BAD-02      -----atgaatgtagaagtgtccatctttccagatgtcacaatgg-----
A0A3Q3FKT9_BAD-03      gtgtgttagatgtcacg------------------------atgg-----
A0A3Q3FKT9_BAD-01      --------gatgtcacg------------------------atgg-----
A0A3Q3FKT9_BAD-02      -----------------------------------------atgg-----
G3Q8B3_BAD-01          -----------------------------------------atgg-----
A0A3Q1K1C7_BAD-01      -----------------------------------------atgg-----
A0A672YF93_BAD-01      -----------------------------------------atgg-----
A0A3Q3RXS8_BAD-01      -----------------------------------------atgg-----
A0A3Q3R5S3_BAD-01      -----------------------------------------atgg-----
H3D8J8_BAD-01          -----------------------------------------atgg-----
A0A674MXC1_BAD-01      -----------------------------------------atgg-----
A0A674MXC1_BAD-02      -----------------------------------------atgg-----
A0A674MXC1_BAD-03      -----------------------------------------atgg-----
A0A674MXC1_BAD-04      -----------------------------------------atgg-----
A0A3B5BAL2_BAD-01      -----------------------------------------atgg-----
A0A3Q1GWH9_BAD-01      -----------------------------------------atgg-----
A0A3Q1CPU7_BAD-01      -----------------------------------------atgg-----
A0A3P8TWH6_BAD-01      -----------------------------------------atgg-----
A0A2U9BAC9_BAD-01      -----------------------------------------atgg-----
A0A671TL42_BAD-01      -----------------------------------------atgg-----
A0A665TUH3_BAD-01      -----------------------------------------atga-----
A0A4W6EMZ7_BAD-01      -----------------------------------------atgg-----
A0A4W6EMZ7_BAD-02      gagtacaatttcttttgaatcttccctccccagatgtcacaatgg-----
A0A3B4VFC5_BAD-01      -----------------------------------------atgg-----
A0A3B4W9T1_BAD-01      -----------------------------------------atgg-----
A0A3B3BQF7_BAD-01      -----------------------------------------atgg-----
A0A3P9HNZ2_BAD-01      -----------------------------------------atgg-----
A0A3B3HDU2_BAD-01      -----------------------------------------atgg-----
A0A3P9KSL7_BAD-01      -----------------------------------------atgg-----
A0A3P9KSL7_BAD-02      -----------------------------------------atgg-----
A0A3Q3AEL8_BAD-01      -----------------------------------------atgg-----
A0A3Q3AEL8_BAD-02      -----------------------------------------atgg-----
A0A1A8AQV0_BAD-01      -----------------------------------------atgg-----
A0A3Q2QC80_BAD-01      ctggtttgaattttccgaattcgtgtcttccagatgatacgatgg-----
A0A3Q2D5S0_BAD-01      --------atggctcagtcggtagagacttcggatcctattatgg-----
A0A3B5L9R9_BAD-01      -----------------------------------------atgg-----
A0A3B5Q2N7_BAD-01      -----------------------------------------atgg-----
A0A3P9Q7C3_BAD-01      -----------------------------------------atgg-----
A0A3B3YFR1_BAD-01      -----------------------------------------atgg-----
A0A087X8P8_BAD-01      -----------------------------------------atgg-----
A0A3B3UA11_BAD-01      -----------------------------------------atgg-----
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      -----------------------------------------atgacagtt
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          -----------------------------------------atgggaacc
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          -----------------------------------------atgggaacc
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          -----------------------------------------atgggaacc
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          -----------------------------------------cctacagcc
A0A4X1VE31_BAD-01      -----------------------------------------atggggagc
A0A287AEF3_BAD-01      -----------------------------------------atgggcatc
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      -----------------------------------------atgggcatc
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      -----------------------------------------atggggacc
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      -----------------------------------------atggggacc
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          -----------------------------------------caggggcct
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------ggaccc
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          -----------------------------------------atgcggact
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      -----------------------------------------atggggatc
A0A287CT05_BAD-02      -----------------------------------------atggggatc
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      -----------------------------------------atggggacc
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      -----------------------------------------atggggacc
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          tctcctcataagtct-----------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          acct----------------------------------------------
A0A672LB88_BAD-01      acac----------------------------------------------
A0A671PX91_BAD-01      acat----------------------------------------------
A0A673J5Q9_BAD-01      acat----------------------------------------------
A0A672R7P6_BAD-01      agat----------------------------------------------
A0A671SBB4_BAD-01      agat----------------------------------------------
A0A673I6H5_BAD-01      agat----------------------------------------------
A0A4W4DXF5_BAD-01      agctttcacaatggaaaaggcac---------------------------
A0A3P8YI30_BAD-01      a-------------------------------------------------
A0A3P8YI30_BAD-02      a-------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      a-------------------------------------------------
A0A4W5MZR2_BAD-01      a-------------------------------------------------
A0A674AVP9_BAD-01      a-------------------------------------------------
A0A1S3L0Z2_BAD-01      a-------------------------------------------------
B5XEF1_BAD-01          a-------------------------------------------------
B5X1T1_BAD-01          a-------------------------------------------------
A0A673ZHY7_BAD-01      a-------------------------------------------------
A0A4W5R1T6_BAD-01      a-------------------------------------------------
A0A060W8P9_BAD-01      a-------------------------------------------------
A0A3B1JLM2_BAD-01      agttttcacaatggaaaagacac---------------------------
A0A3B4DUY7_BAD-01      agcttgcgcaatggaaaag-------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      -------------aaaat--------------------------------
A0A3P8Y761_BAD-02      tccacaccctacagaaatgggatatcg-----------------------
A0A667ZNC6_BAD-01      ----------------------ca--------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      ----------------------ctcag-----------------------
A0A4W5JLL9_BAD-01      ----------------------ctcag-----------------------
A0A4W5JLL9_BAD-02      ----------------------ctcag-----------------------
A0A1S3N9Q3_BAD-01      ----------------------ctcag-----------------------
A0A674DKC6_BAD-01      ----------------------ctcag-----------------------
A0A3Q2Y0E4_BAD-01      ----------------------ccgca-----------------------
A0A668V3Q4_BAD-01      ----------------------ctgca-----------------------
I3K7B6_BAD-01          ----------------------ctgca-----------------------
A0A3P9B2E4_BAD-01      ----------------------ctgca-----------------------
A0A3Q4GGN3_BAD-01      ----------------------ctgca-----------------------
A0A3P8QRJ7_BAD-01      ----------------------ctgca-----------------------
A0A3Q3C680_BAD-01      ----------------------ctgca-----------------------
A0A3B4GXJ6_BAD-01      ----------------------ctgca-----------------------
A0A3Q0QNQ2_BAD-01      ----------------------cttcc-----------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      ----------------------ctacc-----------------------
A0A672JQ68_BAD-01      ----------------------ctgca-----------------------
A0A3P8WI83_BAD-01      ----------------------ctgca-----------------------
A0A3P8WI83_BAD-02      ----------------------ctgca-----------------------
A0A3Q3FKT9_BAD-03      ----------------------ctgcg-----------------------
A0A3Q3FKT9_BAD-01      ----------------------ctgcg-----------------------
A0A3Q3FKT9_BAD-02      ----------------------ctgcg-----------------------
G3Q8B3_BAD-01          ----------------------ctgca-----------------------
A0A3Q1K1C7_BAD-01      ----------------------cagca-----------------------
A0A672YF93_BAD-01      ----------------------ctgca-----------------------
A0A3Q3RXS8_BAD-01      ----------------------ctgca-----------------------
A0A3Q3R5S3_BAD-01      ----------------------ctgca-----------------------
H3D8J8_BAD-01          ----------------------ctgca-----------------------
A0A674MXC1_BAD-01      ----------------------cgaca-----------------------
A0A674MXC1_BAD-02      ----------------------cgacg-----------------------
A0A674MXC1_BAD-03      ----------------------cgacg-----------------------
A0A674MXC1_BAD-04      ----------------------cgacg-----------------------
A0A3B5BAL2_BAD-01      ----------------------ctgca-----------------------
A0A3Q1GWH9_BAD-01      ----------------------ctgca-----------------------
A0A3Q1CPU7_BAD-01      ----------------------ctgca-----------------------
A0A3P8TWH6_BAD-01      ----------------------ctgca-----------------------
A0A2U9BAC9_BAD-01      ----------------------cggca-----------------------
A0A671TL42_BAD-01      ----------------------ctgca-----------------------
A0A665TUH3_BAD-01      ----------------------gtgca-----------------------
A0A4W6EMZ7_BAD-01      ----------------------ctgca-----------------------
A0A4W6EMZ7_BAD-02      ----------------------ctgca-----------------------
A0A3B4VFC5_BAD-01      ----------------------ctgca-----------------------
A0A3B4W9T1_BAD-01      ----------------------ctgca-----------------------
A0A3B3BQF7_BAD-01      ----------------------cagca-----------------------
A0A3P9HNZ2_BAD-01      ----------------------cagca-----------------------
A0A3B3HDU2_BAD-01      ----------------------cagca-----------------------
A0A3P9KSL7_BAD-01      ----------------------cagca-----------------------
A0A3P9KSL7_BAD-02      ----------------------cagca-----------------------
A0A3Q3AEL8_BAD-01      ----------------------ctgca-----------------------
A0A3Q3AEL8_BAD-02      ----------------------ctgca-----------------------
A0A1A8AQV0_BAD-01      ----------------------ctgcc-----------------------
A0A3Q2QC80_BAD-01      ----------------------cggcc-----------------------
A0A3Q2D5S0_BAD-01      ----------------------ctgca-----------------------
A0A3B5L9R9_BAD-01      ----------------------acaca-----------------------
A0A3B5Q2N7_BAD-01      ----------------------acaca-----------------------
A0A3P9Q7C3_BAD-01      ----------------------acgca-----------------------
A0A3B3YFR1_BAD-01      ----------------------acgca-----------------------
A0A087X8P8_BAD-01      ----------------------acgca-----------------------
A0A3B3UA11_BAD-01      ----------------------acgca-----------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      tctctcacccaggcaacgggggctgggctcccaccgaaacaggagagagg
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          ccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtc
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          ccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtc
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          ccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtc
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          cagagc--------------------------------------------
A0A4X1VE31_BAD-01      tcaggcggaaagaagttgtggctggccaggccctccccctcaacagagga
A0A287AEF3_BAD-01      cca---gaaaatccctcatctgcttccacacacacccaaggaataaggaa
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      cca---gaaaatccctcatctgcttccacacacacccaaggaataaggaa
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      ccagagaatcccttatctgctcccacacacgtcccaggcccagggatgtc
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      ccggagaatccctcagcggctcccacaactcggaagctgagcatccggag
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          c-------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          ccagagaatccctcaccggcttccacacacgcccaaggcgtgaggatgtc
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          ccagagaacccctcacccgctcctacaaatgccgaaggattaaggaagtt
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      ccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtc
A0A287CT05_BAD-02      ccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtc
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      ccagagaatccctctcctgctcccacacacgcccaagatgtgaggcagcg
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      ccagagaatccctctcctgctcccacacacgcccaagatgtgaggcagcg
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      aggagggggaggagagagcccgggagccgagcacagggacctggctgctg
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          cgatcccggaatccggagcctggggagcgacgcgggaggaaggcggtgga
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          cgatcccggaatccggagcctggggagcgacgcgggaggaaggcggtgga
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          cgatcccggaatccggagcctggggagcgacgcgggaggaaggcggtgga
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      acccttgcctttgccgagcac------------aggcaaccggggtccct
A0A287AEF3_BAD-01      gtccggagctgaaccagggaccccggaggaaggcggtgggcggggccgga
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      gtccggagctgaaccagggaccccggaggaaggcggtgggcggggccgga
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      gggaactgagcagcgggaggcgaggaagggacccaggacgaaggcggtag
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      acgtagaagagaatcaggaggaaggcagtgggcggggccccggggaagc-
A0A452ER54_BAD-02      -------------------------tatcgggcttgggcccag---agc-
W5P8G9_BAD-01          -----------------------gttatcgggcttgggcccag---agc-
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          gggagctgaacatccggagaagaagaagggacgcaggagatcatcgggcg
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          ggagctggggatccggagacttgagtcagcccagagc-------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      agggaaggagggaccggggaggaaggcggtaggacccgcaggtcggcggc
A0A287CT05_BAD-02      agggaaggagggaccggggaggaaggcggtaggacccgcaggtcggcggc
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      aggat---------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      aggat---------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      cccctcgggagtcggagaccccctcctggccggacgatgcctcccgcccc
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          gaccagcagcccagagt---------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          gaccagcagcccagagt---------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          gaccagcagcccagagt---------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      cactcagag---------cccagagc------------------------
A0A287AEF3_BAD-01      gccgtagcggccccgcctcccagagc------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      gccgccaggggtacctgtcccagagc------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      gcagggagcaagtcccgcggcgggggcggagactgggtcggaagcggcca
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          ggctgcagagt---------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      gagggtggcacccggcctggacccagagc---------------------
A0A287CT05_BAD-02      gagggtggcacccggcctggacccagagc---------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      ---------------------cccagagc---------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      ---------------------cccagagc---------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      gtgagc--------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      atgagc--------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      cgccccctggccagccctggtgacatttcaaaagctgattgggccgggtc
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      ggtgacagttcccgttgcccaggcaactagggccgggctccctcagtact
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      ggagggaggcggcaggcccgggtcaggggcctcgagatcgggcttgggcc
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          ------atgtttagtattgaagagtttccaccgacagaaaggggg-----
H3ANP3_BAD-03          ------atgttccagattt------------c---agactccgac-----
H3ANP3_BAD-01          ------atgttccagattt------------c---agactccgac-----
H3ANP3_BAD-02          ------atgttccagattt------------c---agactccgac-----
H3ANP3_BAD-04          ------atgttccagattt------------c---agactccgac-----
E7FBJ6_BAD-01          ---------cgcatgacca----------------tcaagatgat-----
A0A672LB88_BAD-01      ---------tgcatgacca----------------tcaagatgat-----
A0A671PX91_BAD-01      ---------tgcatgacca----------------tcaagatgat-----
A0A673J5Q9_BAD-01      ---------tgcatgacca----------------tcaagatgat-----
A0A672R7P6_BAD-01      ---------tgcatgacca----------------tcgaaatgat-----
A0A671SBB4_BAD-01      ---------tgcatgacca----------------tcaaaatgat-----
A0A673I6H5_BAD-01      ---------tgcatggcca----------------tcaatatgat-----
A0A4W4DXF5_BAD-01      ---------catgtggtca----------------aagagatgac-----
A0A3P8YI30_BAD-01      ---------ctcaggattg----------------tgtgggtgac-----
A0A3P8YI30_BAD-02      ---------ctcaggattg----------------tgtgggtgac-----
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      ---------tacatgattg----------------tgtggatg-------
A0A4W5MZR2_BAD-01      ---------cacatgattg----------------tgtggatg-------
A0A674AVP9_BAD-01      ---------cacatgattg----------------tgtggatg-------
A0A1S3L0Z2_BAD-01      ---------cacatgattg----------------tgtggatg-------
B5XEF1_BAD-01          ---------cacatgattg----------------tgtggatg-------
B5X1T1_BAD-01          ---------cacatgattg----------------tgtggatgac-----
A0A673ZHY7_BAD-01      ---------cacatgattg----------------tgtggatgac-----
A0A4W5R1T6_BAD-01      ---------cacatgattg----------------tgtggatgac-----
A0A060W8P9_BAD-01      ---------cacatgattg----------------tgtggatgac-----
A0A3B1JLM2_BAD-01      ------caccacacagtaa----------------agaagatgac-----
A0A3B4DUY7_BAD-01      -----------cacagt-------------------gaagatggc-----
A0A672V9F8_BAD-01      -----------------------------------ggggtccgtg-----
A0A674GQ16_BAD-01      -----------------------------------tccggctgga-----
A7MCM4_BAD-01          ------atgtttaatatct------------c---cg---atgat-----
Q4V925_BAD-02          ------atgtttaatatct------------c---tg---atgat-----
Q4V925_BAD-03          ------atgtttaatatct------------c---tg---atgat-----
Q4V925_BAD-01          ------atgtttaatatct------------c---tg---atgat-----
Q4V925_BAD-04          ------atgtttaatatct------------c---tg---atgat-----
A0A671NP27_BAD-01      ------atgttcagcatct------------c---tgacaatgag-----
A0A672SAE4_BAD-01      ------atgttcagtatct------------c---tgacaatgag-----
A0A672SAE4_BAD-02      ------atgttcagtatct------------c---tgacaatgag-----
A0A673J9C6_BAD-01      ------atgttcagtatct------------c---tgacaatgag-----
A0A672RGH0_BAD-01      ------atgttcagtatct------------c---ggacaatgag-----
A0A671RUV0_BAD-01      ------atgttcagtatct------------c---tgacaatgag-----
A0A673HRQ3_BAD-01      ------atgttcagtatct------------c---tgacaatgag-----
A0A4W4HE29_BAD-01      ------atgttcactatat------------c---tgacacagag-----
A0A3B1IH05_BAD-01      ------atgttcacaatat------------c---tgat---gag-----
A0A3B4CPH6_BAD-01      ------atgttcacattat------------c---ggac---gac-----
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      ------agtttaataacat------------c---agaa-----------
A0A3P8Y761_BAD-01      ------attttcactatat------------c---agacaccgaa-----
A0A3P8Y761_BAD-02      ------acttctaccattctgcctcacaccac---aggaaccggagatag
A0A667ZNC6_BAD-01      ------agcttcaccattt------------c---agacggcgaa-----
A0A6F9CQZ0_BAD-02      ------atgttcactatat------------c---agactgcaaa-----
A0A6F9CA11_BAD-02      ------atgtttactatat------------c---agacagcgaa-----
A0A4W5JLL9_BAD-01      ------atgtttactatat------------c---agacagcgag-----
A0A4W5JLL9_BAD-02      ------atgtttactatat------------c---agacagcgag-----
A0A1S3N9Q3_BAD-01      ------atatttactatat------------c---agacagtgag-----
A0A674DKC6_BAD-01      ------atgtttactatat------------c---agacagtgag-----
A0A3Q2Y0E4_BAD-01      ------aacttcagcatat------------c---cgacagcgag-----
A0A668V3Q4_BAD-01      ------aacttcacaattt------------c---agacagtgaa-----
I3K7B6_BAD-01          ------aacttcacaattt------------c---agacagtgaa-----
A0A3P9B2E4_BAD-01      ------aacttcaaaattt------------c---agacagtgat-----
A0A3Q4GGN3_BAD-01      ------aacttcaaaattt------------c---agacagtgat-----
A0A3P8QRJ7_BAD-01      ------aacttcaaaattt------------c---agacagtgat-----
A0A3Q3C680_BAD-01      ------aacttcaaaattt------------c---agacagtgat-----
A0A3B4GXJ6_BAD-01      ------aacttcaaaattt------------c---agacagtgat-----
A0A3Q0QNQ2_BAD-01      ------gtttatccagggt------------c---gggggcagca-----
A0A3Q0QNQ2_BAD-02      ------------------------------------------atg-----
A0A3Q3WTY4_BAD-01      ------aatttcaccattt------------caagtgacagcgag-----
A0A672JQ68_BAD-01      ------aagttctcaattt------------c---agacagtgag-----
A0A3P8WI83_BAD-01      ------cagttcactatat------------c---ggacagcgaa-----
A0A3P8WI83_BAD-02      ------cagttcactatat------------c---ggacagcgaa-----
A0A3Q3FKT9_BAD-03      ------aagttcactattt------------c---agacagtgag-----
A0A3Q3FKT9_BAD-01      ------aagttcactattt------------c---agacagtgag-----
A0A3Q3FKT9_BAD-02      ------aagttcactattt------------c---agacagtgag-----
G3Q8B3_BAD-01          ------catttcaccattt------------c---cgacagcgag-----
A0A3Q1K1C7_BAD-01      ------agattcaccattt------------c---agacagcgac-----
A0A672YF93_BAD-01      ------aaattcaccattt------------c---cgacagtgaa-----
A0A3Q3RXS8_BAD-01      ------aaattcagtattt------------c---agaaagcgaa-----
A0A3Q3R5S3_BAD-01      ------aacttcacgattt------------c---agacagtgaa-----
H3D8J8_BAD-01          ------aagttcagtctgt------------gcagcgacagcgac-----
A0A674MXC1_BAD-01      ------aggttcagcattt------------ccagcgacagcgac-----
A0A674MXC1_BAD-02      ------aggttcagcattt------------ccagcgacagcgac-----
A0A674MXC1_BAD-03      ------aggttcagcattt------------ccagcgacagcgac-----
A0A674MXC1_BAD-04      ------aggttcagcattt------------ccagcgacagcgac-----
A0A3B5BAL2_BAD-01      ------caattctctatta------------g---tggcagcgag-----
A0A3Q1GWH9_BAD-01      ------aaattctcaattt------------c---agacggcgac-----
A0A3Q1CPU7_BAD-01      ------aaattcactattt------------c---agacagcgag-----
A0A3P8TWH6_BAD-01      ------aaattcactattt------------c---agacagcgag-----
A0A2U9BAC9_BAD-01      ------aacttcacaatat------------c---agacagtgag-----
A0A671TL42_BAD-01      ------aacttcaccattt------------ccagcgagagcgac-----
A0A665TUH3_BAD-01      ------caattcaccattt------------c---agacagtgag-----
A0A4W6EMZ7_BAD-01      ------aacttcactattt------------c---agacagtgag-----
A0A4W6EMZ7_BAD-02      ------aacttcactattt------------c---agacagtgag-----
A0A3B4VFC5_BAD-01      ------aacttcaccattt------------c---agacagtgag-----
A0A3B4W9T1_BAD-01      ------aacttcaccattt------------c---agacagtgag-----
A0A3B3BQF7_BAD-01      ------aagttctccatct------------c---agacaacgat-----
A0A3P9HNZ2_BAD-01      ------aagttcaccatct------------c---ag---acgat-----
A0A3B3HDU2_BAD-01      ------aagttcaccatct------------c---ag---acgat-----
A0A3P9KSL7_BAD-01      ------aagttcaccatct------------c---ag---acgat-----
A0A3P9KSL7_BAD-02      ------aagttcaccatct------------c---ag---acgat-----
A0A3Q3AEL8_BAD-01      ------aagttcaccattt------------c---agacagcgag-----
A0A3Q3AEL8_BAD-02      ------aagttcaccattt------------c---agacagcgag-----
A0A1A8AQV0_BAD-01      ------cacttcacgatct------------c---agacagtgac-----
A0A3Q2QC80_BAD-01      ------aagtttactattt------------c---ggacagcgac-----
A0A3Q2D5S0_BAD-01      ------acctttaccattt------------c---agacagcgac-----
A0A3B5L9R9_BAD-01      ------aaatttacaattt------------c---agacggtgag-----
A0A3B5Q2N7_BAD-01      ------aaatttacaattt------------c---agacggtgag-----
A0A3P9Q7C3_BAD-01      ------aaatttacaattt------------c---agacagcgac-----
A0A3B3YFR1_BAD-01      ------aaatttacaattt------------c---agacagcgac-----
A0A087X8P8_BAD-01      ------aaatttacaattt------------c---agacagcgac-----
A0A3B3UA11_BAD-01      ------aaatttacaattt------------c---agacagcgac-----
A0A452IFQ4_BAD-01      ------atgtttcgcatcc------------a---ggagttcc-------
A0A674I2R9_BAD-01      ------atgtttcgcatcc------------a---ggagttcc-------
A0A3B3QX41_BAD-01      ------atgtc-------------------------gggtgtcac-----
A0A5F8GA49_BAD-01      ------atgtttcagatcc------------c---agagtttgag-----
G3VRY3_BAD-01          ------atgttccagatat------------c---cgagtttgag-----
G3VRY3_BAD-02          ------atgttccagatat------------c---cgagtttgag-----
G3VRY3_BAD-03          ------atgttccagatat------------c---cgagtttgag-----
A0A4X2KAA5_BAD-01      ------atgtttcagatct------------c---agagtttgag-----
A0A6I8NVP2_BAD-01      ------atgtttcagattc------------c---ggagtttgag-----
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
Q61337_BAD-07          ----------tccagatcc------------c---agagtttgag-----
Q61337_BAD-02          ------atgttccagatcc------------c---agagtttgag-----
Q61337_BAD-05          ------atgttccagatcc------------c---agagtttgag-----
Q61337_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
Q61337_BAD-03          ------atgttccagatcc------------c---agagtttgag-----
Q61337_BAD-04          ------atgttccagatcc------------c---agagtttgag-----
Q61337_BAD-06          ------atgttccagatcc------------c---agagtttgag-----
G1P8C5_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A4X1VE31_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A287AEF3_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A4X1VE31_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A4X1VE31_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
F7DN67_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
M3YNE7_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A673V6P8_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A337SAW2_BAD-01      cagagcatgttccagatcc------------c---agagtttgag-----
A0A667H8Z9_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A452RJM6_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A384DJL2_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
Q45KI9_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A3Q7SWS0_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A4W2C9A8_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A4W2C9A8_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
F1MUT9_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
Q3SYZ0_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A452ER54_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A452ER54_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
W5P8G9_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A4U1FMC3_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2Y9EHU3_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
G3TP47_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A2K5E6A6_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5PDB1_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6TG62_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2I2YFH2_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2R8Z674_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
Q92934_BAD-03          ------atgttccagatcc------------c---agagtttgag-----
A0A2I3TBK7_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6E7I4_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5M0A7_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5XJR2_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
G5B6Q3_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
G5B6Q3_BAD-02          ------atgttccagatcc------------c---agagtttgag-----
H0V608_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A287CT05_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A287CT05_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A671ELU4_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2J8TYJ3_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2R8Z674_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2I2YFH2_BAD-04      ------atgttccagatcc------------c---agagtttgag-----
Q92934_BAD-04          ------atgttccagatcc------------c---agagtttgag-----
A0A2I3TBK7_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6E7I4_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5M0A7_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5XJR2_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5HKU7_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6N196_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6PUL3_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
H0WVR2_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A2K5E6A6_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6GWV0_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5HKU7_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6N196_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6PUL3_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A0D9R491_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5M0A7_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5XJR2_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6E7I4_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5VCA1_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A1D5QBW1_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6TG62_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2K5E6A6_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
U3F2S3_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A2J8TYJ3_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2J8TYJ3_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
A0A2I2YFH2_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
A0A2I2YFH2_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2I3TBK7_BAD-02      ------atgttccagatcc------------c---agagtttgag-----
A0A2R8Z674_BAD-01      ------atgttccagatcc------------c---agagtttgag-----
Q92934_BAD-01          ------atgttccagatcc------------c---agagtttgag-----
Q92934_BAD-02          ------atgttccagatcc------------c---agagtttgag-----
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
A0A2K6TG62_BAD-03      ------atgttccagatcc------------c---agagtttgag-----
                                                                         

C1C3S9_BAD-01          --------------------tctgca------------------------
H3ANP3_BAD-03          --------------------tcagacgcgtacgaagatgatagaacgggc
H3ANP3_BAD-01          --------------------tcagacgcgtacgaagatgatagaacgggc
H3ANP3_BAD-02          --------------------tcagacgcgtacgaagatgatagaacgggc
H3ANP3_BAD-04          --------------------tcagacgcgtacgaagatgatagaacgggc
E7FBJ6_BAD-01          ------------------t---ccag------------------------
A0A672LB88_BAD-01      ------------------t---ccag------------------------
A0A671PX91_BAD-01      ------------------t---ccag------------------------
A0A673J5Q9_BAD-01      ------------------t---ccag------------------------
A0A672R7P6_BAD-01      ------------------t---ccag------------------------
A0A671SBB4_BAD-01      ------------------t---ccag------------------------
A0A673I6H5_BAD-01      ------------------t---ccag------------------------
A0A4W4DXF5_BAD-01      ------------------a---tcag------------------------
A0A3P8YI30_BAD-01      ------------------attccaga------------------------
A0A3P8YI30_BAD-02      ------------------attccaga------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          ------------------aacccaga------------------------
A0A673ZHY7_BAD-01      ------------------aacccaga------------------------
A0A4W5R1T6_BAD-01      ------------------aacccaga------------------------
A0A060W8P9_BAD-01      ------------------aatccaga------------------------
A0A3B1JLM2_BAD-01      ------------------a---tcag------------------------
A0A3B4DUY7_BAD-01      ------------------a---taag------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------tcagagacaga-------------------
Q4V925_BAD-02          --------------------tcagagacaga-------------------
Q4V925_BAD-03          --------------------tcagagacaga-------------------
Q4V925_BAD-01          --------------------tcagagacaga-------------------
Q4V925_BAD-04          --------------------tcagagacaga-------------------
A0A671NP27_BAD-01      --------------------tcggacacaga-------------------
A0A672SAE4_BAD-01      --------------------tcggacaccga-------------------
A0A672SAE4_BAD-02      --------------------tcggacaccga-------------------
A0A673J9C6_BAD-01      --------------------tcagacacaga-------------------
A0A672RGH0_BAD-01      --------------------tcagagaccga-------------------
A0A671RUV0_BAD-01      --------------------tcagagaccga-------------------
A0A673HRQ3_BAD-01      --------------------tcagagaccga-------------------
A0A4W4HE29_BAD-01      --------------------tcagac------------------------
A0A3B1IH05_BAD-01      --------------------tcagat------------------------
A0A3B4CPH6_BAD-01      --------------------tcagac------------------------
A0A670YRG7_BAD-01      --------------------ttagaa------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------tctgaa------------------------
A0A3P8Y761_BAD-02      gctcctgccctacgggctgttctgcc------------------------
A0A667ZNC6_BAD-01      --------------------tcagat------------------------
A0A6F9CQZ0_BAD-02      --------------------tcagaa------------------------
A0A6F9CA11_BAD-02      --------------------tcagag------------------------
A0A4W5JLL9_BAD-01      --------------------tcagag------------------------
A0A4W5JLL9_BAD-02      --------------------tcagag------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------tcagag------------------------
A0A3Q2Y0E4_BAD-01      --------------------tccgag------------------------
A0A668V3Q4_BAD-01      --------------------tcggag------------------------
I3K7B6_BAD-01          --------------------tcggag------------------------
A0A3P9B2E4_BAD-01      --------------------tcagag------------------------
A0A3Q4GGN3_BAD-01      --------------------tcagag------------------------
A0A3P8QRJ7_BAD-01      --------------------tcagag------------------------
A0A3Q3C680_BAD-01      --------------------tcagag------------------------
A0A3B4GXJ6_BAD-01      --------------------tcagag------------------------
A0A3Q0QNQ2_BAD-01      --------------------gcctag------------------------
A0A3Q0QNQ2_BAD-02      --------------------cccgaa------------------------
A0A3Q3WTY4_BAD-01      --------------------tcagag------------------------
A0A672JQ68_BAD-01      --------------------tccgag------------------------
A0A3P8WI83_BAD-01      --------------------tccgag------------------------
A0A3P8WI83_BAD-02      --------------------tccgag------------------------
A0A3Q3FKT9_BAD-03      --------------------tccggg------------------------
A0A3Q3FKT9_BAD-01      --------------------tccggg------------------------
A0A3Q3FKT9_BAD-02      --------------------tccggg------------------------
G3Q8B3_BAD-01          --------------------tcagag------------------------
A0A3Q1K1C7_BAD-01      --------------------tcagac------------------------
A0A672YF93_BAD-01      --------------------tcagag------------------------
A0A3Q3RXS8_BAD-01      --------------------tcagac------------------------
A0A3Q3R5S3_BAD-01      --------------------tcagag------------------------
H3D8J8_BAD-01          --------------------tcagag------------------------
A0A674MXC1_BAD-01      --------------------tcggat------------------------
A0A674MXC1_BAD-02      --------------------tcggat------------------------
A0A674MXC1_BAD-03      --------------------tcggat------------------------
A0A674MXC1_BAD-04      --------------------tcggat------------------------
A0A3B5BAL2_BAD-01      --------------------tccgac------------------------
A0A3Q1GWH9_BAD-01      --------------------tcagag------------------------
A0A3Q1CPU7_BAD-01      --------------------tcagag------------------------
A0A3P8TWH6_BAD-01      --------------------tcagag------------------------
A0A2U9BAC9_BAD-01      --------------------tcagag------------------------
A0A671TL42_BAD-01      --------------------tcagag------------------------
A0A665TUH3_BAD-01      --------------------tcagat------------------------
A0A4W6EMZ7_BAD-01      --------------------tcagag------------------------
A0A4W6EMZ7_BAD-02      --------------------tcagag------------------------
A0A3B4VFC5_BAD-01      --------------------tcagag------------------------
A0A3B4W9T1_BAD-01      --------------------tcagag------------------------
A0A3B3BQF7_BAD-01      --------------------tcggag------------------------
A0A3P9HNZ2_BAD-01      --------------------tcggag------------------------
A0A3B3HDU2_BAD-01      --------------------tcggag------------------------
A0A3P9KSL7_BAD-01      --------------------tcggag------------------------
A0A3P9KSL7_BAD-02      --------------------tcggag------------------------
A0A3Q3AEL8_BAD-01      --------------------tcggag------------------------
A0A3Q3AEL8_BAD-02      --------------------tcggag------------------------
A0A1A8AQV0_BAD-01      --------------------tcggag------------------------
A0A3Q2QC80_BAD-01      --------------------tcggag------------------------
A0A3Q2D5S0_BAD-01      --------------------actgag------------------------
A0A3B5L9R9_BAD-01      --------------------tcggac------------------------
A0A3B5Q2N7_BAD-01      --------------------tcggac------------------------
A0A3P9Q7C3_BAD-01      --------------------tctgag------------------------
A0A3B3YFR1_BAD-01      --------------------tcggag------------------------
A0A087X8P8_BAD-01      --------------------tcggag------------------------
A0A3B3UA11_BAD-01      --------------------tcggag------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      ---------------------catgg------------------------
A0A5F8GA49_BAD-01      ---------------------ccggg------------------------
G3VRY3_BAD-01          ---------------------cccag------------------------
G3VRY3_BAD-02          ---------------------cccag------------------------
G3VRY3_BAD-03          ---------------------cccag------------------------
A0A4X2KAA5_BAD-01      ---------------------cccag------------------------
A0A6I8NVP2_BAD-01      ---------------------ccgag------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          ---------------------ccgag------------------------
Q61337_BAD-07          ---------------------ccgag------------------------
Q61337_BAD-02          ---------------------ccgag------------------------
Q61337_BAD-05          ---------------------ccgag------------------------
Q61337_BAD-01          ---------------------ccgag------------------------
Q61337_BAD-03          ---------------------ccgag------------------------
Q61337_BAD-04          ---------------------ccgag------------------------
Q61337_BAD-06          ---------------------ccgag------------------------
G1P8C5_BAD-01          ---------------------cacag------------------------
A0A4X1VE31_BAD-01      ---------------------cagag------------------------
A0A287AEF3_BAD-01      ---------------------cagag------------------------
A0A4X1VE31_BAD-02      ---------------------cagag------------------------
A0A4X1VE31_BAD-03      ---------------------cagag------------------------
F7DN67_BAD-01          ---------------------cagag------------------------
M3YNE7_BAD-01          ---------------------cccag------------------------
A0A673V6P8_BAD-01      ---------------------cccag------------------------
A0A337SAW2_BAD-01      ---------------------cccag------------------------
A0A667H8Z9_BAD-01      ---------------------cccag------------------------
A0A452RJM6_BAD-01      ---------------------cccag------------------------
A0A384DJL2_BAD-01      ---------------------cccag------------------------
Q45KI9_BAD-01          ---------------------cccag------------------------
A0A3Q7SWS0_BAD-01      ---------------------cccag------------------------
A0A4W2C9A8_BAD-01      ---------------------cagag------------------------
A0A4W2C9A8_BAD-01      ---------------------cagag------------------------
F1MUT9_BAD-01          ---------------------cagag------------------------
Q3SYZ0_BAD-01          ---------------------cagag------------------------
A0A452ER54_BAD-01      ---------------------cagag------------------------
A0A452ER54_BAD-02      ---------------------cagag------------------------
W5P8G9_BAD-01          ---------------------cagag------------------------
A0A4U1FMC3_BAD-01      ---------------------cagag------------------------
A0A2Y9EHU3_BAD-01      ---------------------cagag------------------------
G3TP47_BAD-01          ---------------------cagag------------------------
A0A2K5E6A6_BAD-02      ---------------------ccgag------------------------
A0A2K5PDB1_BAD-02      ---------------------ccgag------------------------
A0A2K6TG62_BAD-02      ---------------------ccgag------------------------
A0A2I2YFH2_BAD-03      ---------------------ccgag------------------------
A0A2R8Z674_BAD-02      ---------------------ccgag------------------------
Q92934_BAD-03          ---------------------ccgag------------------------
A0A2I3TBK7_BAD-01      ---------------------ccgag------------------------
A0A2K6E7I4_BAD-02      ---------------------cctag------------------------
A0A2K5M0A7_BAD-02      ---------------------cctag------------------------
A0A2K5XJR2_BAD-02      ---------------------cctag------------------------
G5B6Q3_BAD-01          ---------------------ccaag------------------------
G5B6Q3_BAD-02          ---------------------ccaag------------------------
H0V608_BAD-01          ---------------------ccaag------------------------
A0A287CT05_BAD-01      ---------------------cccag------------------------
A0A287CT05_BAD-02      ---------------------cccag------------------------
A0A671ELU4_BAD-01      ---------------------cagag------------------------
A0A2J8TYJ3_BAD-01      ---------------------ccgag------------------------
A0A2R8Z674_BAD-03      ---------------------ccgag------------------------
A0A2I2YFH2_BAD-04      ---------------------ccgag------------------------
Q92934_BAD-04          ---------------------ccgag------------------------
A0A2I3TBK7_BAD-03      ---------------------ccgag------------------------
A0A2K6E7I4_BAD-03      ---------------------cctag------------------------
A0A2K5M0A7_BAD-03      ---------------------cctag------------------------
A0A2K5XJR2_BAD-03      ---------------------cctag------------------------
A0A2K5HKU7_BAD-02      ---------------------cctag------------------------
A0A2K6N196_BAD-02      ---------------------cctag------------------------
A0A2K6PUL3_BAD-02      ---------------------cctag------------------------
H0WVR2_BAD-01          ---------------------ccgag------------------------
A0A2K5E6A6_BAD-03      ---------------------ccgag------------------------
A0A2K6GWV0_BAD-01      ---------------------ccaag------------------------
A0A2K5HKU7_BAD-01      ---------------------cctag------------------------
A0A2K6N196_BAD-01      ---------------------cctag------------------------
A0A2K6PUL3_BAD-01      ---------------------cctag------------------------
A0A0D9R491_BAD-01      ---------------------cctag------------------------
A0A2K5M0A7_BAD-01      ---------------------cctag------------------------
A0A2K5XJR2_BAD-01      ---------------------cctag------------------------
A0A2K6E7I4_BAD-01      ---------------------cctag------------------------
A0A2K5VCA1_BAD-01      ---------------------cctag------------------------
A0A1D5QBW1_BAD-01      ---------------------cctag------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      ---------------------ccgag------------------------
A0A2K6TG62_BAD-01      ---------------------ccgag------------------------
A0A2K5E6A6_BAD-01      ---------------------ccgag------------------------
U3F2S3_BAD-01          ---------------------ccgag------------------------
A0A2J8TYJ3_BAD-02      ---------------------ccgag------------------------
A0A2J8TYJ3_BAD-03      ---------------------ccgag------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          ---------------------ccgag------------------------
A0A2I2YFH2_BAD-01      ---------------------ccgag------------------------
A0A2I2YFH2_BAD-02      ---------------------ccgag------------------------
A0A2I3TBK7_BAD-02      ---------------------ccgag------------------------
A0A2R8Z674_BAD-01      ---------------------ccgag------------------------
Q92934_BAD-01          ---------------------ccgag------------------------
Q92934_BAD-02          ---------------------ccgag------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      ---------------------ccgag------------------------
A0A2K6TG62_BAD-03      ---------------------ccgag------------------------
                                                                         

C1C3S9_BAD-01          ---------ttttctg---gaa----------------------------
H3ANP3_BAD-03          cccttgccactgcagtctggaggaggaagaggcgagggat----cagagc
H3ANP3_BAD-01          cccttgccactgcagtctggaggaggaagaggcgagggat----cagagc
H3ANP3_BAD-02          cccttgccactgcagtctggaggaggaagaggcgagggat----cagagc
H3ANP3_BAD-04          cccttgccactgcagtctggaggaggaagaggcgagggat----cagagc
E7FBJ6_BAD-01          ---------caccttggatgaaaaagagagat------------------
A0A672LB88_BAD-01      ---------cacctggaatgacaaaaagaaag------------------
A0A671PX91_BAD-01      ---------cacctggaatgacaaaaagaaag------------------
A0A673J5Q9_BAD-01      ---------cacctggaatgacaaaaagaaag------------------
A0A672R7P6_BAD-01      ---------caccttgaatgacagaaagaaag------------------
A0A671SBB4_BAD-01      ---------caccttgaatgacaaaaagaaag------------------
A0A673I6H5_BAD-01      ---------caccttgaatgacaaaaagaaag------------------
A0A4W4DXF5_BAD-01      ---------tgcattggatgaccaagacgaat------------------
A0A3P8YI30_BAD-01      ---------aaacataaacgaaaaatatgatt------------------
A0A3P8YI30_BAD-02      ---------aaacataaacgaaaaatatgatt------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      -----------------------aatgtgagt------------------
A0A4W5MZR2_BAD-01      -----------------------aatgtgagt------------------
A0A674AVP9_BAD-01      -----------------------aatgtgagt------------------
A0A1S3L0Z2_BAD-01      -----------------------aatgtgagt------------------
B5XEF1_BAD-01          -----------------------aatgtgagt------------------
B5X1T1_BAD-01          ---------aaccatgaatgaacatgatgagt------------------
A0A673ZHY7_BAD-01      ---------aaccatgaatgaacaagatgagt------------------
A0A4W5R1T6_BAD-01      ---------aaccatgaatgaaaaagatgagt------------------
A0A060W8P9_BAD-01      ---------aaccatgaatgaacaagatgagt------------------
A0A3B1JLM2_BAD-01      ---------tcccatagatgaccacgatgaat------------------
A0A3B4DUY7_BAD-01      ---------taccatggatgaccaagatgaat------------------
A0A672V9F8_BAD-01      ---------t---------gaggttgtggggtgcagcccccccgtgcccc
A0A674GQ16_BAD-01      ---------c---------gaga---------------cccccgaggatc
A7MCM4_BAD-01          --------aacaatg----gaagacagtgaagcctcaag-----------
Q4V925_BAD-02          --------aacaatg----gaagacagtgaagactcaag-----------
Q4V925_BAD-03          --------aacaatg----gaagacagtgaagactcaag-----------
Q4V925_BAD-01          --------aacaatg----gaagacagtgaagactcaag-----------
Q4V925_BAD-04          --------aacaatg----gaagacagtgaagactcaag-----------
A0A671NP27_BAD-01      --------gacatcg----gaagactgtgaggactcgga-----------
A0A672SAE4_BAD-01      --------gacatcg----gaagactgtgaggactcgga-----------
A0A672SAE4_BAD-02      --------gacatcg----gaagactgtgaggactcgga-----------
A0A673J9C6_BAD-01      --------gacatcg----gaagactgtgaggactcgga-----------
A0A672RGH0_BAD-01      --------gacatcg----gaagactgtgaggaatcggg-----------
A0A671RUV0_BAD-01      --------gacatcg----gaagactgtgaggaatcagg-----------
A0A673HRQ3_BAD-01      --------gacatca----gaagactgtgaggaatcagg-----------
A0A4W4HE29_BAD-01      ---------acatct----gaaggaccaggagacacaga-----------
A0A3B1IH05_BAD-01      ---------gcatct----gaagagctaggagactcaga-----------
A0A3B4CPH6_BAD-01      ---------acatct----gaagatctaggagacgcaga-----------
A0A670YRG7_BAD-01      ---------c----------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      ---------tcct-------cagatgtagaagaaaccaaa----aagga-
A0A3P8Y761_BAD-02      ---------tcataa----ccataggaactagagatggta----caggag
A0A667ZNC6_BAD-01      ---------ccctca----gaggaggtaggggagtcagaa----accga-
A0A6F9CQZ0_BAD-02      ---------ccctca----gag---gtaggagaaacagaa----aagga-
A0A6F9CA11_BAD-02      ---------ccctca----gaggatgtaggagaaacagaa----actga-
A0A4W5JLL9_BAD-01      ---------ccctca----gaggaggtaggagaaaccgaa----aagga-
A0A4W5JLL9_BAD-02      ---------ccctca----gaggaggtaggagaaaccgaa----aagga-
A0A1S3N9Q3_BAD-01      ------------tca----gaggaggtaggagaaaccgaa----aatga-
A0A674DKC6_BAD-01      ---------ccctca----gaggaggtaggagaaaccgaa----aagga-
A0A3Q2Y0E4_BAD-01      ---------ccctct----gaggaggtagaagaaggggacgacggccaa-
A0A668V3Q4_BAD-01      ---------acatca----gaggaggtaggggaagaagaa----aa----
I3K7B6_BAD-01          ---------acatca----gaggaggtaggggaagaagaa----aa----
A0A3P9B2E4_BAD-01      ---------gcatca----gaggaggtaggggaaggagaa----aa----
A0A3Q4GGN3_BAD-01      ---------acatca----gaggaggtaggggaaggagaa----aa----
A0A3P8QRJ7_BAD-01      ---------gcatca----gaggaggtaggggaaggagaa----aa----
A0A3Q3C680_BAD-01      ---------gcatca----gaggaggtaggggaagaagaa----aa----
A0A3B4GXJ6_BAD-01      ---------gcatca----gaggaggtaggggaaggagaa----aa----
A0A3Q0QNQ2_BAD-01      ---------ccacctcctgcagctgatctggggaacacca----aggca-
A0A3Q0QNQ2_BAD-02      ---------ccacct----cgactggt-----------------------
A0A3Q3WTY4_BAD-01      ---------ctgtca----gaggaaatagaagaaggagaa----aacag-
A0A672JQ68_BAD-01      ---------ccatcc----gaggaggtagaagaggaagaa----accaa-
A0A3P8WI83_BAD-01      ---------ccggag----gaggaagtcgagggaggaaaa----attaa-
A0A3P8WI83_BAD-02      ---------ccggag----gaggaagtcgagggaggaaaa----attaa-
A0A3Q3FKT9_BAD-03      ---------tcagaa----gaggaggtaaaagaggaagag----aacga-
A0A3Q3FKT9_BAD-01      ---------tcagaa----gaggaggtaaaagaggaagag----aacga-
A0A3Q3FKT9_BAD-02      ---------tcagaa----gaggaggtaaaagaggaagag----aacga-
G3Q8B3_BAD-01          ---------ccctcg----gatggggtagaggaaagagaa----gatgg-
A0A3Q1K1C7_BAD-01      ---------ccatca----gaggggatggaggaagaagga----cacaa-
A0A672YF93_BAD-01      ---------ccatcc----gaagatttagaggaggaacaa----cgccg-
A0A3Q3RXS8_BAD-01      ---------tcatca----gaggaggtagagggaggaaaa----cagaa-
A0A3Q3R5S3_BAD-01      ---------tcttcg----gaggaggtagaggaaggaaaa----cacag-
H3D8J8_BAD-01          ---------ccatca----gaggaggtggaagaaggagag----agggg-
A0A674MXC1_BAD-01      ---------ccctcg----gaggaggtggacgaaggagag----aggaa-
A0A674MXC1_BAD-02      ---------ccctcg----gaggaggtggacgaaggagag----aggaa-
A0A674MXC1_BAD-03      ---------ccctcg----gaggaggtggacgaaggagag----aggaa-
A0A674MXC1_BAD-04      ---------ccctcg----gaggaggtggacgaaggagag----aggaa-
A0A3B5BAL2_BAD-01      ---------ccg-------gaggaggtagaagagggagaa----aacaa-
A0A3Q1GWH9_BAD-01      ---------cca----------gaggaagtggagggagaa----aacaa-
A0A3Q1CPU7_BAD-01      ---------ccatca----gaggaggtagaagagggagaa----aacaa-
A0A3P8TWH6_BAD-01      ---------ccatca----gaggaggtagaagagggagaa----aacaa-
A0A2U9BAC9_BAD-01      ---------ccatcg----gaggaggtggaggaaggagaa----gtgag-
A0A671TL42_BAD-01      ---------ccctcg----gaggaggtcgaggaaggagaa----cacag-
A0A665TUH3_BAD-01      ---------ccttca----gaggaagtagaagaaggagac----atgag-
A0A4W6EMZ7_BAD-01      ---------gcttcg----gaggaggtagaggagggagaa----atgaa-
A0A4W6EMZ7_BAD-02      ---------gcttcg----gaggaggtagaggagggagaa----atgaa-
A0A3B4VFC5_BAD-01      ---------ccatcg----gaggaggtagacgaaggagaa----atgag-
A0A3B4W9T1_BAD-01      ---------ccatcg----gaggaggtagacgaaggagaa----atgag-
A0A3B3BQF7_BAD-01      ---------tcatcc----gaggaggtagagggaggaagacttgacctg-
A0A3P9HNZ2_BAD-01      ---------tcatcc----gaggaggtagagggaggaaaacttgacctg-
A0A3B3HDU2_BAD-01      ---------tcatcc----gaggaggtagagggaggaaaacttgacctg-
A0A3P9KSL7_BAD-01      ---------tcatcc----gaggaggtagagggaggaaaacttgacctg-
A0A3P9KSL7_BAD-02      ---------tcatcc----gaggaggtagagggaggaaaacttgacctg-
A0A3Q3AEL8_BAD-01      ---------ccctca----gacgaggtagaggagggaaag----agcaa-
A0A3Q3AEL8_BAD-02      ---------ccctca----gacgaggtagaggagggaaag----agcaa-
A0A1A8AQV0_BAD-01      ---------ccgtcg----gaagaggtggaggagggagag----aagaa-
A0A3Q2QC80_BAD-01      ---------ccacca----gaagaagtcgaggaagaagga----aacga-
A0A3Q2D5S0_BAD-01      ---------ccatca----gaggaggtggaggaaacaaga----aacaa-
A0A3B5L9R9_BAD-01      ---------ccatcg----gaagacgtagaggaaagagga----gactt-
A0A3B5Q2N7_BAD-01      ---------ccatcg----gaagacgtagaggaaagagga----gactt-
A0A3P9Q7C3_BAD-01      ---------ccatcg----gaagacgtagaggaaagagga----aactt-
A0A3B3YFR1_BAD-01      ---------ccatcg----gaagacgtagaggaaagagga----aactt-
A0A087X8P8_BAD-01      ---------ccatcg----gaagacgtagaggaaagagga----aactt-
A0A3B3UA11_BAD-01      ---------ccatcg----gaagacgtagaggaaagagga----aactt-
A0A452IFQ4_BAD-01      ---------c---------ggacgaggtgttc------------------
A0A674I2R9_BAD-01      ---------c---------ggacgaggtgttc------------------
A0A3B3QX41_BAD-01      ---------c---------gcacatgttta--------------------
A0A5F8GA49_BAD-01      ---------c---------gagcag-------------------------
G3VRY3_BAD-01          ---------t---------gag---------c------------------
G3VRY3_BAD-02          ---------t---------gag---------c------------------
G3VRY3_BAD-03          ---------t---------gag---------c------------------
A0A4X2KAA5_BAD-01      ---------t---------gagcaggaaactc------------------
A0A6I8NVP2_BAD-01      ---------c---------gagcggggggacg------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          ---------t---------gagcaggaagacg------------------
Q61337_BAD-07          ---------t---------gagcaggaagacg------------------
Q61337_BAD-02          ---------t---------gagcaggaagacg------------------
Q61337_BAD-05          ---------t---------gagcaggaagacg------------------
Q61337_BAD-01          ---------t---------gagcaggaagacg------------------
Q61337_BAD-03          ---------t---------gagcaggaagacg------------------
Q61337_BAD-04          ---------t---------gagcaggaagacg------------------
Q61337_BAD-06          ---------t---------gagcaggaagacg------------------
G1P8C5_BAD-01          ---------t---------gagcaggaagact------------------
A0A4X1VE31_BAD-01      ---------t---------gagcaggaagact------------------
A0A287AEF3_BAD-01      ---------t---------gagcaggaagact------------------
A0A4X1VE31_BAD-02      ---------t---------gagcaggaagact------------------
A0A4X1VE31_BAD-03      ---------t---------gagcaggaagact------------------
F7DN67_BAD-01          ---------t---------gagccagaagact------------------
M3YNE7_BAD-01          ---------t---------gagcaggaagact------------------
A0A673V6P8_BAD-01      ---------t---------gagcaggaagact------------------
A0A337SAW2_BAD-01      ---------t---------gagcaggaagact------------------
A0A667H8Z9_BAD-01      ---------c---------gagcaggaagact------------------
A0A452RJM6_BAD-01      ---------t---------gagcaggaagact------------------
A0A384DJL2_BAD-01      ---------t---------gagcaggaagact------------------
Q45KI9_BAD-01          ---------t---------gagcaggaagact------------------
A0A3Q7SWS0_BAD-01      ---------t---------gagcaggaagact------------------
A0A4W2C9A8_BAD-01      ---------t---------gagcaggaagact------------------
A0A4W2C9A8_BAD-01      ---------t---------gagcaggaagact------------------
F1MUT9_BAD-01          ---------t---------gagcaggaagact------------------
Q3SYZ0_BAD-01          ---------t---------gagcaggaagact------------------
A0A452ER54_BAD-01      ---------t---------gagcaggaagact------------------
A0A452ER54_BAD-02      ---------t---------gagcaggaagact------------------
W5P8G9_BAD-01          ---------t---------gagcaggaagact------------------
A0A4U1FMC3_BAD-01      ---------t---------gagcaggaagact------------------
A0A2Y9EHU3_BAD-01      ---------t---------gagcaggaagact------------------
G3TP47_BAD-01          ---------t---------gaccgggaagact------------------
A0A2K5E6A6_BAD-02      ---------t---------gagcaggaagact------------------
A0A2K5PDB1_BAD-02      ---------t---------gagcaggaaggct------------------
A0A2K6TG62_BAD-02      ---------t---------gagcaggaagact------------------
A0A2I2YFH2_BAD-03      ---------t---------gagcaggaagact------------------
A0A2R8Z674_BAD-02      ---------t---------gagcaggaagact------------------
Q92934_BAD-03          ---------t---------gagcaggaagact------------------
A0A2I3TBK7_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K6E7I4_BAD-02      ---------t---------gagcaggaagact------------------
A0A2K5M0A7_BAD-02      ---------t---------gagcaggaagact------------------
A0A2K5XJR2_BAD-02      ---------t---------gagcaggaagact------------------
G5B6Q3_BAD-01          ---------t---------gagcaggaagact------------------
G5B6Q3_BAD-02          ---------t---------gagcaggaagact------------------
H0V608_BAD-01          ---------t---------gagcaggaagact------------------
A0A287CT05_BAD-01      ---------t---------gagcaggaagact------------------
A0A287CT05_BAD-02      ---------t---------gagcaggaagact------------------
A0A671ELU4_BAD-01      ---------t---------gagcaggaagact------------------
A0A2J8TYJ3_BAD-01      ---------t---------gagcaggaagact------------------
A0A2R8Z674_BAD-03      ---------t---------gagcaggaagact------------------
A0A2I2YFH2_BAD-04      ---------t---------gagcaggaagact------------------
Q92934_BAD-04          ---------t---------gagcaggaagact------------------
A0A2I3TBK7_BAD-03      ---------t---------gagcaggaagact------------------
A0A2K6E7I4_BAD-03      ---------t---------gagcaggaagact------------------
A0A2K5M0A7_BAD-03      ---------t---------gagcaggaagact------------------
A0A2K5XJR2_BAD-03      ---------t---------gagcaggaagact------------------
A0A2K5HKU7_BAD-02      ---------t---------gagcaggaagact------------------
A0A2K6N196_BAD-02      ---------t---------gagcaggaagact------------------
A0A2K6PUL3_BAD-02      ---------t---------gagcaggaagact------------------
H0WVR2_BAD-01          ---------t---------gagcaggaagact------------------
A0A2K5E6A6_BAD-03      ---------t---------gagcaggaagact------------------
A0A2K6GWV0_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K5HKU7_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K6N196_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K6PUL3_BAD-01      ---------t---------gagcaggaagact------------------
A0A0D9R491_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K5M0A7_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K5XJR2_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K6E7I4_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K5VCA1_BAD-01      ---------t---------gagcaggaagact------------------
A0A1D5QBW1_BAD-01      ---------t---------gagcaggaagact------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      ---------t---------gagcaggaaggct------------------
A0A2K6TG62_BAD-01      ---------t---------gagcaggaagact------------------
A0A2K5E6A6_BAD-01      ---------t---------gagcaggaagact------------------
U3F2S3_BAD-01          ---------t---------gagcaggaagact------------------
A0A2J8TYJ3_BAD-02      ---------t---------gagcaggaagact------------------
A0A2J8TYJ3_BAD-03      ---------t---------gagcaggaagact------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          ---------t---------gagcaggaagact------------------
A0A2I2YFH2_BAD-01      ---------t---------gagcaggaagact------------------
A0A2I2YFH2_BAD-02      ---------t---------gagcaggaagact------------------
A0A2I3TBK7_BAD-02      ---------t---------gagcaggaagact------------------
A0A2R8Z674_BAD-01      ---------t---------gagcaggaagact------------------
Q92934_BAD-01          ---------t---------gagcaggaagact------------------
Q92934_BAD-02          ---------t---------gagcaggaagact------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      ---------t---------gagcaggaaggct------------------
A0A2K6TG62_BAD-03      ---------t---------gagcaggaagact------------------
                                                                         

C1C3S9_BAD-01          caaatc--------------------ctccaggttttggaggagatc---
H3ANP3_BAD-03          caagtg--------------aaaaaacagcgggtttaaagaaacacagcc
H3ANP3_BAD-01          caagtg--------------aaaaaacagcgggtttaaagaaacacagcc
H3ANP3_BAD-02          caagtg--------------aaaaaacagcgggtttaaagaaacacagcc
H3ANP3_BAD-04          caagtg--------------aaaaaacagcgggtttaaagaaacacagcc
E7FBJ6_BAD-01          cacatc--------------------tgaaagg-----gacaatcaagaa
A0A672LB88_BAD-01      gaag-----------------------agaaga-----gacaatcaaaaa
A0A671PX91_BAD-01      gaag-----------------------agaaga-----gacaatcaaaaa
A0A673J5Q9_BAD-01      gaag-----------------------agaaga-----gacaatcaaaaa
A0A672R7P6_BAD-01      gaag-----------------------agaaga-----gacaatcaatac
A0A671SBB4_BAD-01      gaag-----------------------agaaga-----gacaatcaatac
A0A673I6H5_BAD-01      gaag-----------------------agaaga-----gacaatcaatac
A0A4W4DXF5_BAD-01      caagat--------------------ggtcaga-----gac-------aa
A0A3P8YI30_BAD-01      tggacc--------------------acttagg-----aactacacatta
A0A3P8YI30_BAD-02      tggacc--------------------acttagg-----aactacacatta
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      ctgacc--------------------actcagg-----aaccacacacaa
A0A4W5MZR2_BAD-01      ctgatc--------------------actcagg-----aaccacacacaa
A0A674AVP9_BAD-01      ctgatc--------------------actcagg-----aaccacacacaa
A0A1S3L0Z2_BAD-01      ctgatc--------------------actcagg-----aaccacacgcaa
B5XEF1_BAD-01          ctgatc--------------------actcagg-----aaccacacgcaa
B5X1T1_BAD-01          ctgacc--------------------actcagg-----aaccacacacta
A0A673ZHY7_BAD-01      ctgacc--------------------actcagg-----aaccacacacta
A0A4W5R1T6_BAD-01      ctgacc--------------------actcagg-----aaccacacacta
A0A060W8P9_BAD-01      ctgacc--------------------actcagg-----aaccacacacta
A0A3B1JLM2_BAD-01      caaggt--------------------ggtcaga-----ggc-------ag
A0A3B4DUY7_BAD-01      ccaatt--------------------ggtcaga-----gac-------gg
A0A672V9F8_BAD-01      ccagcgccgccatgagcccggctcccccggcg------gggggtgtc---
A0A674GQ16_BAD-01      gcggctcccct-----cccccctcgccctggg------ggggctccc---
A7MCM4_BAD-01          cctgga--------------taaacacaagag------tgggtcggcaca
Q4V925_BAD-02          cctgga--------------taaacacaagag------tgggtcggcaca
Q4V925_BAD-03          cctgga--------------taaacacaagag------tgggtcggcaca
Q4V925_BAD-01          cctgga--------------taaacacaagag------tgggtcggcaca
Q4V925_BAD-04          cctgga--------------taaacacaagag------tgggtcggcaca
A0A671NP27_BAD-01      cctgac--------------aaaaaataacag------tggatcaccgca
A0A672SAE4_BAD-01      cctgac--------------aaaaaataacag------tggatcaccgca
A0A672SAE4_BAD-02      cctgac--------------aaaaaataacag------tggatcaccgca
A0A673J9C6_BAD-01      cctgac--------------aaaaaataacag------tggatcacagca
A0A672RGH0_BAD-01      ccaggt--------------gaaaaataacag------tggatcaccaca
A0A671RUV0_BAD-01      ccaggc--------------gaaaaataacag------tggatcaccaca
A0A673HRQ3_BAD-01      ccaggt--------------gaaaaataacag------tggatcaccaca
A0A4W4HE29_BAD-01      ccagca--------------aggggacagcaaggaagctgagccttcaca
A0A3B1IH05_BAD-01      ccagcc--------------agaggtcagtaagacagctgagccatcgcg
A0A3B4CPH6_BAD-01      ccagcc--------------agaagccagtaagagagctgagctgtcaca
A0A670YRG7_BAD-01      --------------------------------------tgagacgcc---
A0A670JUY4_BAD-01      --------------------------------------aggactgga---
A0A3P8Y761_BAD-01      ---atg--------------gattg-ccggaca-----ggggaagac---
A0A3P8Y761_BAD-02      cctatg--------------ggctgttctggct-----tagaaacacaca
A0A667ZNC6_BAD-01      caaatc--------------actca-atcatca-----ggagcaga----
A0A6F9CQZ0_BAD-02      caaatc--------------agctg-caggaca-----gggaatgac---
A0A6F9CA11_BAD-02      ccaatc--------------ggcag-ccggaaa-----ggggatgac---
A0A4W5JLL9_BAD-01      ccaatt--------------ggctg-ccggaaa-----ggggatgac---
A0A4W5JLL9_BAD-02      ccaatt--------------ggctg-ccggaaa-----ggggatgac---
A0A1S3N9Q3_BAD-01      ccaatc--------------gtctg-ccggaaa-----ggggatgac---
A0A674DKC6_BAD-01      ccaatc--------------gtctg-ccggaaa-----ggggatgac---
A0A3Q2Y0E4_BAD-01      ggagccgc------------tgaaa-aagagca-----ggagcagtg---
A0A668V3Q4_BAD-01      ccaaca--------------gccag-caggaca-----agatcaaga---
I3K7B6_BAD-01          ccaaca--------------gccag-caggaca-----agatcaaga---
A0A3P9B2E4_BAD-01      ccaaca--------------gtcag-caggaca-----agctcaaga---
A0A3Q4GGN3_BAD-01      ccaaca--------------gtcag-caagaca-----agttcaaga---
A0A3P8QRJ7_BAD-01      ccaaca--------------gtcag-caggaca-----agctcaaga---
A0A3Q3C680_BAD-01      ccaaca--------------gtcag-caggaca-----agctcaaga---
A0A3B4GXJ6_BAD-01      ccaaca--------------gtcag-caggaca-----agctcaaga---
A0A3Q0QNQ2_BAD-01      ttccca--------------ggcca-taggaca-----tgaccagaa---
A0A3Q0QNQ2_BAD-02      tctttt--------------tgatg-tagaaga-----aggacag-----
A0A3Q3WTY4_BAD-01      tcagct--------------acaaa-ctgagca-----agagcagca---
A0A672JQ68_BAD-01      cgaaac--------------accag-c-----------agatcagcg---
A0A3P8WI83_BAD-01      gcattc--------------attga-atgaccc-----agaacaggt---
A0A3P8WI83_BAD-02      gcattc--------------attga-atgaccc-----agaacaggt---
A0A3Q3FKT9_BAD-03      ccaatc--------------atcag-ctgtgga-----agagccgca---
A0A3Q3FKT9_BAD-01      ccaatc--------------atcag-ctgtgga-----agagccgca---
A0A3Q3FKT9_BAD-02      ccaatc--------------atcag-ctgtgga-----agagccgca---
G3Q8B3_BAD-01          ccagtt--------------atcat-cggggca-----agagcagca---
A0A3Q1K1C7_BAD-01      ccagtc--------------accac-cagggca-----agagcagca---
A0A672YF93_BAD-01      tcagcc--------------accga-ctgaaca-----ggagcagca---
A0A3Q3RXS8_BAD-01      gaagtc--------------gtcag-caaggca-----agagcaaca---
A0A3Q3R5S3_BAD-01      ccaatc--------------atcaa-cttcgca-----agaacaaca---
H3D8J8_BAD-01          cagttt--------------ttca--------------------------
A0A674MXC1_BAD-01      tagttc--------------tctaa-gtgagca-----ggagaggca---
A0A674MXC1_BAD-02      tagttc--------------tctaa-gtgagca-----ggagaggca---
A0A674MXC1_BAD-03      tagttc--------------tctaa-gtgagca-----ggagaggca---
A0A674MXC1_BAD-04      tagttc--------------tctaa-gtgagca-----ggagaggca---
A0A3B5BAL2_BAD-01      ccatcc--------------accag-cagaaca-----gccgatgca---
A0A3Q1GWH9_BAD-01      ccattc--------------accag-caacaga-----agccatgcc---
A0A3Q1CPU7_BAD-01      ccattc--------------accag-caacaca-----agccatgcc---
A0A3P8TWH6_BAD-01      ccattc--------------accag-caacaca-----agccatgcc---
A0A2U9BAC9_BAD-01      ccaacc--------------gtgga-ccgggcc-----aggggagca---
A0A671TL42_BAD-01      ccaatc--------------accag-ctgaaga-----agggcagca---
A0A665TUH3_BAD-01      ccagtc--------------att---------------ggagcagga---
A0A4W6EMZ7_BAD-01      ccaatc--------------atcaa-ctgagca-----agagcagca---
A0A4W6EMZ7_BAD-02      ccaatc--------------atcaa-ctgagca-----agagcagca---
A0A3B4VFC5_BAD-01      ccaatc--------------actaa-ctgggca-----agagcagga---
A0A3B4W9T1_BAD-01      ccaatc--------------actaa-ctgggca-----agagcagga---
A0A3B3BQF7_BAD-01      gcagcatcaggaggagaaggaggag-gaggagg-----aggggggca---
A0A3P9HNZ2_BAD-01      ggagcggcaggagg---aggaggag-gaggaga-----aggggagca---
A0A3B3HDU2_BAD-01      ggagcggc------------agcag-gaggaga-----aggggagca---
A0A3P9KSL7_BAD-01      ggagcggc------------agcag-gaggaga-----aggggagca---
A0A3P9KSL7_BAD-02      ggagcggc------------agcag-gaggaga-----aggggagca---
A0A3Q3AEL8_BAD-01      acagcc--------------ggcag-cgggacc-----ggaggacgg---
A0A3Q3AEL8_BAD-02      acagcc--------------ggcag-cgggacc-----ggaggacgg---
A0A1A8AQV0_BAD-01      gcagcc--------------gtcag-cgggtca-----agaggagag---
A0A3Q2QC80_BAD-01      tcagcc--------------agcag-acggaaa-----agtggagcc---
A0A3Q2D5S0_BAD-01      ggagcc--------------aagga-tacgaaacagtgggaaaa------
A0A3B5L9R9_BAD-01      gcagct--------------aatgc-aagaaaa-----ggagaagcc---
A0A3B5Q2N7_BAD-01      gcagct--------------aatgc-aagaaaa-----ggagaagcc---
A0A3P9Q7C3_BAD-01      gcagct--------------aatgc-aagtaaa-----ggagaggcc---
A0A3B3YFR1_BAD-01      gcagct--------------aatgc-aagtaaa-----ggagaggcc---
A0A087X8P8_BAD-01      gcagct--------------aatgc-aagtaaa-----ggagaggcc---
A0A3B3UA11_BAD-01      gcagct--------------aatgc-aagtaaa-----ggagaggcc---
A0A452IFQ4_BAD-01      ccgggg--------------------cgaggga-----agga--ggcgcc
A0A674I2R9_BAD-01      ccgggg--------------------cgaggga-----agga--gtcgcc
A0A3B3QX41_BAD-01      ccatct--------------------ccggcaa-----tgagtcggacac
A0A5F8GA49_BAD-01      -------------------------------ga-----agac--ggctct
G3VRY3_BAD-01          ccgg--------------------------aga-----agac--ccttct
G3VRY3_BAD-02          ccgg--------------------------aga-----agac--ccttct
G3VRY3_BAD-03          ccgg--------------------------aga-----agac--ccttct
A0A4X2KAA5_BAD-01      ccaa--------------------------aga-----agac--ggcttt
A0A6I8NVP2_BAD-01      tctgca--------------------ccccggg-----aggt--gacccc
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          ctagta--------------------ctacaga-----tagg--ggc---
Q61337_BAD-07          ctagtg--------------------ctacaga-----tagg--ggc---
Q61337_BAD-02          ctagtg--------------------ctacaga-----tagg--ggc---
Q61337_BAD-05          ctagtg--------------------ctacaga-----tagg--ggc---
Q61337_BAD-01          ctagtg--------------------ctacaga-----tagg--ggc---
Q61337_BAD-03          ctagtg--------------------ctacaga-----tagg--ggc---
Q61337_BAD-04          ctagtg--------------------ctacaga-----tagg--ggc---
Q61337_BAD-06          ctagtg--------------------ctacaga-----tagg--ggc---
G1P8C5_BAD-01          ccagcc--------------------ctgcaga-----tagg--ggc---
A0A4X1VE31_BAD-01      ccagcc--------------------ctgcaga-----cagg--ggc---
A0A287AEF3_BAD-01      ccagcc--------------------ctgcaga-----cagg--ggc---
A0A4X1VE31_BAD-02      ccagcc--------------------ctgcaga-----cagg--ggc---
A0A4X1VE31_BAD-03      ccagcc--------------------ctgcaga-----cagg--ggc---
F7DN67_BAD-01          ccagcc--------------------ctgcaga-----tagg--ggc---
M3YNE7_BAD-01          ccagcc--------------------ctgcaga-----tagg--ggc---
A0A673V6P8_BAD-01      caagcc--------------------ctacaga-----tagg--ggc---
A0A337SAW2_BAD-01      ccagcc--------------------ctacgga-----tagg--ggc---
A0A667H8Z9_BAD-01      cgagcc--------------------ctacgga-----tagg--ggc---
A0A452RJM6_BAD-01      ccagcc--------------------ctgcaga-----tagg--ggc---
A0A384DJL2_BAD-01      ccagcc--------------------ctgcaga-----tagg--ggc---
Q45KI9_BAD-01          ccagcc--------------------ctgcaaa-----tagg--ggc---
A0A3Q7SWS0_BAD-01      ccagcc--------------------ctgcaaa-----tagg--ggc---
A0A4W2C9A8_BAD-01      ccagcc--------------------ctgcaga-----tagg--ggc---
A0A4W2C9A8_BAD-01      ccagcc--------------------ctgcaga-----tagg--ggc---
F1MUT9_BAD-01          ccagcc--------------------ctgcaga-----tagg--ggc---
Q3SYZ0_BAD-01          ccagcc--------------------gtgcaga-----tagg--ggc---
A0A452ER54_BAD-01      ccagcc--------------------ctgcaga-----tagg--ggc---
A0A452ER54_BAD-02      ccagcc--------------------ctgcaga-----tagg--ggc---
W5P8G9_BAD-01          ccagcc--------------------ctgcaga-----tagg--ggc---
A0A4U1FMC3_BAD-01      ccagcc--------------------ctgcaga-----tagg--ggc---
A0A2Y9EHU3_BAD-01      ccagcc--------------------ctgcaga-----tagg--ggc---
G3TP47_BAD-01          ccaccc--------------------ctgcaga-----cagg--ggc---
A0A2K5E6A6_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5PDB1_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6TG62_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2I2YFH2_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2R8Z674_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
Q92934_BAD-03          ccagct--------------------ctgcaga-----gagg--ggc---
A0A2I3TBK7_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6E7I4_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5M0A7_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5XJR2_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
G5B6Q3_BAD-01          ccagct--------------------ccgaaga-----gagg--gcc---
G5B6Q3_BAD-02          ccagct--------------------ccgaaga-----gagg--gcc---
H0V608_BAD-01          ccagct--------------------ctgaaga-----gagg--ggc---
A0A287CT05_BAD-01      ccagct--------------------ccgcaga-----aggg--ggc---
A0A287CT05_BAD-02      ccagct--------------------ccgcaga-----aggg--ggc---
A0A671ELU4_BAD-01      ccagcc--------------------ctgcaga-----tagg--ggc---
A0A2J8TYJ3_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2R8Z674_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2I2YFH2_BAD-04      ccagct--------------------ctgcaga-----gagg--ggc---
Q92934_BAD-04          ccagct--------------------ctgcaga-----gagg--ggc---
A0A2I3TBK7_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6E7I4_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5M0A7_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5XJR2_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5HKU7_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6N196_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6PUL3_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
H0WVR2_BAD-01          ccagct--------------------cctcaga-----tagg--ggc---
A0A2K5E6A6_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6GWV0_BAD-01      ccagct--------------------ctgcagg-----tagg--ggc---
A0A2K5HKU7_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6N196_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6PUL3_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A0D9R491_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5M0A7_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5XJR2_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6E7I4_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5VCA1_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A1D5QBW1_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6TG62_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K5E6A6_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
U3F2S3_BAD-01          ccagct--------------------ctgcaga-----gagg--ggc---
A0A2J8TYJ3_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2J8TYJ3_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          ccagct--------------------ctgcaga-----gagg--ggc---
A0A2I2YFH2_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2I2YFH2_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2I3TBK7_BAD-02      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2R8Z674_BAD-01      ccagct--------------------ctgcaga-----gagg--ggc---
Q92934_BAD-01          ccagct--------------------ctgcaga-----gagg--ggc---
Q92934_BAD-02          ccagct--------------------ctgcaga-----gagg--ggc---
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
A0A2K6TG62_BAD-03      ccagct--------------------ctgcaga-----gagg--ggc---
                                                                         

C1C3S9_BAD-01          --ctggacacaag-------------------------------------
H3ANP3_BAD-03          ggacagcccccaatctgcagaacc--------------------------
H3ANP3_BAD-01          ggacagcccccaatctgcagaacc--------------------------
H3ANP3_BAD-02          ggacagcccccaatctgcagaacc--------------------------
H3ANP3_BAD-04          ggacagcccccaatctgcagaacc--------------------------
E7FBJ6_BAD-01          ccatggacaac---------------------------------------
A0A672LB88_BAD-01      ccaaggacaac---------------------------------------
A0A671PX91_BAD-01      ccaaggacaac---------------------------------------
A0A673J5Q9_BAD-01      ccaaggacaac---------------------------------------
A0A672R7P6_BAD-01      ccgtggacaac---------------------------------------
A0A671SBB4_BAD-01      ccatggacaac---------------------------------------
A0A673I6H5_BAD-01      ccatggacaac---------------------------------------
A0A4W4DXF5_BAD-01      tcgagagtgatgactcccctcga---------------------------
A0A3P8YI30_BAD-01      cccagaatttcagttct---------------------------------
A0A3P8YI30_BAD-02      cccagaatttcagttct---------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      ctctgaatttcagctcc---------------------------------
A0A4W5MZR2_BAD-01      ctcagaatttcagctcc---------------------------------
A0A674AVP9_BAD-01      ctcagaatttcagctcc---------------------------------
A0A1S3L0Z2_BAD-01      ctcagaattccagctcc---------------------------------
B5XEF1_BAD-01          ctcagaattccagctcc---------------------------------
B5X1T1_BAD-01          cccagaatttcagcgcc---------------------------------
A0A673ZHY7_BAD-01      cccagaatttcagctcc---------------------------------
A0A4W5R1T6_BAD-01      cccagaatttcagctcc---------------------------------
A0A060W8P9_BAD-01      ccccgaatttcagctcc---------------------------------
A0A3B1JLM2_BAD-01      tcaagagtgtcgactccccacag---------------------------
A0A3B4DUY7_BAD-01      tcaagaatggtgactctccacag---------------------------
A0A672V9F8_BAD-01      ---ccccccccggcc---------cccccgcggcaggt--gagacccgcc
A0A674GQ16_BAD-01      ---cctcccccagccagcccgggaccccctccccaggtcagagactcccc
A7MCM4_BAD-01          gaaaaag---cagca-----------------------------------
Q4V925_BAD-02          gaaaaag---cagca-----------------------------------
Q4V925_BAD-03          gaaaaag---cagca-----------------------------------
Q4V925_BAD-01          gaaaaag---cagca-----------------------------------
Q4V925_BAD-04          gaaaaag---cagca-----------------------------------
A0A671NP27_BAD-01      gaaaacaaaccatga-----------------------------------
A0A672SAE4_BAD-01      gaaaacaaaccatga-----------------------------------
A0A672SAE4_BAD-02      gaaaacaaaccatga-----------------------------------
A0A673J9C6_BAD-01      gaaaacaaaccatga-----------------------------------
A0A672RGH0_BAD-01      gagaacg---cagca-----------------------------------
A0A671RUV0_BAD-01      gagaaag---cagca-----------------------------------
A0A673HRQ3_BAD-01      gagaaag---cagca-----------------------------------
A0A4W4HE29_BAD-01      gtctgag---caaca-----------------------------------
A0A3B1IH05_BAD-01      gtctggg---cagca-----------------------------------
A0A3B4CPH6_BAD-01      gtctggg---cagca-----------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      tggaagccgattaggcctctc-----------------------------
A0A3P8Y761_BAD-02      tatccacccactcatcctctg-----------------------------
A0A667ZNC6_BAD-01      --accatcatcttggccacgc-----------------------------
A0A6F9CQZ0_BAD-02      tggaggcccactaggccacac-----------------------------
A0A6F9CA11_BAD-02      tggcggcccactaggccacgc-----------------------------
A0A4W5JLL9_BAD-01      tggcggcccaataggccacgc-----------------------------
A0A4W5JLL9_BAD-02      tggcggcccaataggccacgc-----------------------------
A0A1S3N9Q3_BAD-01      tggcggtccaataggccacgc-----------------------------
A0A674DKC6_BAD-01      tggcggtccaataggccacac-----------------------------
A0A3Q2Y0E4_BAD-01      ---cctccgccaaggcctccg-----------------------------
A0A668V3Q4_BAD-01      ---aa---gcaagccccagac-----------------------------
I3K7B6_BAD-01          ---aa---gcaagccccagac-----------------------------
A0A3P9B2E4_BAD-01      ---aa---gcaagccccagac-----------------------------
A0A3Q4GGN3_BAD-01      ---aa---gcaagccccagac-----------------------------
A0A3P8QRJ7_BAD-01      ---aa---gcaagccccagac-----------------------------
A0A3Q3C680_BAD-01      ---aa---gcaagccccagac-----------------------------
A0A3B4GXJ6_BAD-01      ---aa---gcaagccccagac-----------------------------
A0A3Q0QNQ2_BAD-01      ---cact-tcacccatgaggc-----------------------------
A0A3Q0QNQ2_BAD-02      --------tcacccttcagag-----------------------------
A0A3Q3WTY4_BAD-01      ---ggtttttcaacgtcacac-----------------------------
A0A672JQ68_BAD-01      ---tgtccgtcggcgtcttga-----------------------------
A0A3P8WI83_BAD-01      ---tgtacctcaccggcacaa-----------------------------
A0A3P8WI83_BAD-02      ---tgtacctcaccggcacaa-----------------------------
A0A3Q3FKT9_BAD-03      ---tgttccccaacgacacag-----------------------------
A0A3Q3FKT9_BAD-01      ---tgttccccaacgacacag-----------------------------
A0A3Q3FKT9_BAD-02      ---tgttccccaacgacacag-----------------------------
G3Q8B3_BAD-01          ---gcgtcttcaacgtcacac-----------------------------
A0A3Q1K1C7_BAD-01      ---agtttttccacgccacac-----------------------------
A0A672YF93_BAD-01      ---gatttcttacagccactc-----------------------------
A0A3Q3RXS8_BAD-01      ---ggtttctcagcgccacgc-----------------------------
A0A3Q3R5S3_BAD-01      ---ggttcctccatgccacag-----------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      ---ggttcttcagcggcacac-----------------------------
A0A674MXC1_BAD-02      ---ggttcttcagcggcacac-----------------------------
A0A674MXC1_BAD-03      ---ggttcttcagcggcacac-----------------------------
A0A674MXC1_BAD-04      ---ggttcttcagcggcacac-----------------------------
A0A3B5BAL2_BAD-01      ---tgtcttcgagcgccgcaa-----------------------------
A0A3Q1GWH9_BAD-01      ---tgtcttcgcccgccgcaa-----------------------------
A0A3Q1CPU7_BAD-01      ---tgttttcgcccgccgcaa-----------------------------
A0A3P8TWH6_BAD-01      ---tgttttcgcccgccgcaa-----------------------------
A0A2U9BAC9_BAD-01      ---ggttcctccgcgccacac-----------------------------
A0A671TL42_BAD-01      ---ggtgtctcagcgccacgc-----------------------------
A0A665TUH3_BAD-01      ---ggtttttcaacgccacaa-----------------------------
A0A4W6EMZ7_BAD-01      ---gattcctcaacgcaacac-----------------------------
A0A4W6EMZ7_BAD-02      ---gattcctcaacgcaacac-----------------------------
A0A3B4VFC5_BAD-01      ---gctttctcaacgccacac-----------------------------
A0A3B4W9T1_BAD-01      ---gctttctcaacgccacac-----------------------------
A0A3B3BQF7_BAD-01      ---ccttcatgatcgacatgc-----------------------------
A0A3P9HNZ2_BAD-01      ---ccttcatgatcgacattc-----------------------------
A0A3B3HDU2_BAD-01      ---ccttcatgatcgacattc-----------------------------
A0A3P9KSL7_BAD-01      ---ccttcatgatcgacattc-----------------------------
A0A3P9KSL7_BAD-02      ---ccttcatgatcgacattc-----------------------------
A0A3Q3AEL8_BAD-01      ---cgtccgccagcgcctcac-----------------------------
A0A3Q3AEL8_BAD-02      ---cgtccgccagcgcctcac-----------------------------
A0A1A8AQV0_BAD-01      ---cgttcgcc-----cacac-----------------------------
A0A3Q2QC80_BAD-01      ---gctccgccagcgccacgc-----------------------------
A0A3Q2D5S0_BAD-01      ----------------cacat-----------------------------
A0A3B5L9R9_BAD-01      ---gctcagtcaacgccacac-----------------------------
A0A3B5Q2N7_BAD-01      ---gctcagtcaacgccacac-----------------------------
A0A3P9Q7C3_BAD-01      ---gctcagtcaacgccacac-----------------------------
A0A3B3YFR1_BAD-01      ---gctcagtcaacgccacac-----------------------------
A0A087X8P8_BAD-01      ---gctcagtcaacgccacac-----------------------------
A0A3B3UA11_BAD-01      ---gctcagtcaacgccacac-----------------------------
A0A452IFQ4_BAD-01      tgctccccccgagtcgcagcgggg-------------------acacacg
A0A674I2R9_BAD-01      tcttccccccgagtcgcagcgggg-------------------acacacg
A0A3B3QX41_BAD-01      ttctgaatccgacac----------------------------accagat
A0A5F8GA49_BAD-01      gagcgggcgccgg------------------------------ggcagcc
G3VRY3_BAD-01          gcct----------------------------------------------
G3VRY3_BAD-02          gcct----------------------------------------------
G3VRY3_BAD-03          gcct----------------------------------------------
A0A4X2KAA5_BAD-01      gcctatgccccgg------------------------------gggagtc
A0A6I8NVP2_BAD-01      agccaggccccagcgggaccggggggcctgggtcgccacacccacacctc
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --ctgggccctagcctcactgagg-------------------accagcc
Q61337_BAD-07          --ctgggccctagcctcactgagg-------------------accagcc
Q61337_BAD-02          --ctgggccctagcctcactgagg-------------------accagcc
Q61337_BAD-05          --ctgggccctagcctcactgagg-------------------accagcc
Q61337_BAD-01          --ctgggccctagcctcactgagg-------------------accagcc
Q61337_BAD-03          --ctgggccctagcctcactgagg-------------------accagcc
Q61337_BAD-04          --ctgggccctagcctcactgagg-------------------accagcc
Q61337_BAD-06          --ctgggccctagcctcactgagg-------------------accagcc
G1P8C5_BAD-01          --ctgggcccctgccccacagggg-------------------accagcc
A0A4X1VE31_BAD-01      --ctgggccccagccccacagggg-------------------acagacc
A0A287AEF3_BAD-01      --ctgggccccagccccaca-ggg-------------------acagacc
A0A4X1VE31_BAD-02      --ctgggccccagccccacagggg-------------------acagacc
A0A4X1VE31_BAD-03      --ctgggccccagccccacagggg-------------------acagacc
F7DN67_BAD-01          --ctgggccccagccctacggggg-------------------actggcc
M3YNE7_BAD-01          --ctgggccccagccccacagggg-------------------atcaacc
A0A673V6P8_BAD-01      --ctgggccccagccccacagggg-------------------accggcc
A0A337SAW2_BAD-01      --ctgggccccagccccacagggg-------------------accggcc
A0A667H8Z9_BAD-01      --ctgggccccagccccacagggg-------------------accggcc
A0A452RJM6_BAD-01      --ctgggccccagccccacagggg-------------------accagcc
A0A384DJL2_BAD-01      --ctgggccccagccccacagggg-------------------accagcc
Q45KI9_BAD-01          --ttgggccccagccccacagggg-------------------accggcc
A0A3Q7SWS0_BAD-01      --ttgggccccagccccacagggg-------------------accggc-
A0A4W2C9A8_BAD-01      --ctgggccccagccccacagggg-------------------acaggcc
A0A4W2C9A8_BAD-01      --ctgggccccagccccacagggg-------------------acaggcc
F1MUT9_BAD-01          --ctgggccccagccccacagggg-------------------acaggcc
Q3SYZ0_BAD-01          --ctgggccccagccccacagggg-------------------acaggcc
A0A452ER54_BAD-01      --ctgggccccagccccacagggg-------------------acaggcc
A0A452ER54_BAD-02      --ctgggccccagccccacagggg-------------------acaggcc
W5P8G9_BAD-01          --ctgggccccagccccacagggg-------------------acaggcc
A0A4U1FMC3_BAD-01      --ctgggccccagccccacagggg-------------------acaggcc
A0A2Y9EHU3_BAD-01      --ctgggccccagccccacagggg-------------------acaagcc
G3TP47_BAD-01          --ctgggccccagccccgaagggt-------------------actggcc
A0A2K5E6A6_BAD-02      --ctgagccccagcaccgcagggg-------------------acaggcc
A0A2K5PDB1_BAD-02      --ctgaaccccagcaccgcagggg-------------------acagccc
A0A2K6TG62_BAD-02      --ctgagccccagcaccgcagggg-------------------acagccc
A0A2I2YFH2_BAD-03      --ctgggccccagccccgcagggg-------------------acgggcc
A0A2R8Z674_BAD-02      --ctgggccccagccccgcagggg-------------------acgggcc
Q92934_BAD-03          --ctgggccccagccccgcagggg-------------------acgggcc
A0A2I3TBK7_BAD-01      --ctgggccccagccccgcagggg-------------------acgggcc
A0A2K6E7I4_BAD-02      --ctgggccccagccccgcggggg-------------------acaggcc
A0A2K5M0A7_BAD-02      --ctgggccccagtctcgcggggg-------------------acaggcc
A0A2K5XJR2_BAD-02      --ctgggccccagcctcgcggggg-------------------acaggcc
G5B6Q3_BAD-01          --ctgggccccacccccacagggg-------------------accggct
G5B6Q3_BAD-02          --ctgggccccacccccacagggg-------------------accggct
H0V608_BAD-01          --ctgggccccagccccacagggg-------------------acgagct
A0A287CT05_BAD-01      --ctgggccccagccccgcagggg-------------------accggcc
A0A287CT05_BAD-02      --ctgggccccagccccgcagggg-------------------accggcc
A0A671ELU4_BAD-01      --ctgggccccagccccacaggag-------------------accagcc
A0A2J8TYJ3_BAD-01      --ctgggccccagccccgcagggg-------------------acaggcc
A0A2R8Z674_BAD-03      --ctgggccccagccccgcagggg-------------------acgggcc
A0A2I2YFH2_BAD-04      --ctgggccccagccccgcagggg-------------------acgggcc
Q92934_BAD-04          --ctgggccccagccccgcagggg-------------------acgggcc
A0A2I3TBK7_BAD-03      --ctgggccccagccccgcagggg-------------------acgggcc
A0A2K6E7I4_BAD-03      --ctgggccccagccccgcggggg-------------------acaggcc
A0A2K5M0A7_BAD-03      --ctgggccccagtctcgcggggg-------------------acaggcc
A0A2K5XJR2_BAD-03      --ctgggccccagcctcgcggggg-------------------acaggcc
A0A2K5HKU7_BAD-02      --ctgggccccagcccggcagggg-------------------acaggcc
A0A2K6N196_BAD-02      --ctgggccccagcccggcagggg-------------------acaggcc
A0A2K6PUL3_BAD-02      --ctgggccccagcccggcagggg-------------------acaggcc
H0WVR2_BAD-01          --ctgggccccagcccctcagggg-------------------accagcc
A0A2K5E6A6_BAD-03      --ctgagccccagcaccgcagggg-------------------acaggcc
A0A2K6GWV0_BAD-01      --ctgggccccagcccctcagggg-------------------accggcc
A0A2K5HKU7_BAD-01      --ctgggccccagcccggcagggg-------------------acaggcc
A0A2K6N196_BAD-01      --ctgggccccagcccggcagggg-------------------acaggcc
A0A2K6PUL3_BAD-01      --ctgggccccagcccggcagggg-------------------acaggcc
A0A0D9R491_BAD-01      --ctgggccccagccccgcaggga-------------------acaggcc
A0A2K5M0A7_BAD-01      --ctgggccccagtctcgcggggg-------------------acaggcc
A0A2K5XJR2_BAD-01      --ctgggccccagcctcgcggggg-------------------acaggcc
A0A2K6E7I4_BAD-01      --ctgggccccagccccgcggggg-------------------acaggcc
A0A2K5VCA1_BAD-01      --ctgggccccagccccgcgggga-------------------acaggcc
A0A1D5QBW1_BAD-01      --ctgggccccagccccgcggggg-------------------acaggcc
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --ctgaaccccagcaccgcagggg-------------------acagccc
A0A2K6TG62_BAD-01      --ctgagccccagcaccgcagggg-------------------acagccc
A0A2K5E6A6_BAD-01      --ctgagccccagcaccgcagggg-------------------acaggcc
U3F2S3_BAD-01          --ctgagccccagcaccgcagggg-------------------acaggcc
A0A2J8TYJ3_BAD-02      --ctgggccccagccccgcagggg-------------------acaggcc
A0A2J8TYJ3_BAD-03      --ctgggccccagccccgcagggg-------------------acaggcc
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --ctgggccccagccccgcagggg-------------------acgggcc
A0A2I2YFH2_BAD-01      --ctgggccccagccccgcagggg-------------------acgggcc
A0A2I2YFH2_BAD-02      --ctgggccccagccccgcagggg-------------------acgggcc
A0A2I3TBK7_BAD-02      --ctgggccccagccccgcagggg-------------------acgggcc
A0A2R8Z674_BAD-01      --ctgggccccagccccgcagggg-------------------acgggcc
Q92934_BAD-01          --ctgggccccagccccgcagggg-------------------acgggcc
Q92934_BAD-02          --ctgggccccagccccgcagggg-------------------acgggcc
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --ctgaaccccagcaccgcagggg-------------------acagccc
A0A2K6TG62_BAD-03      --ctgagccccagcaccgcagggg-------------------acagccc
                                                                         

C1C3S9_BAD-01          ---------------------------------------------agttc
H3ANP3_BAD-03          -----------------------------------------cgggacctc
H3ANP3_BAD-01          -----------------------------------------cgggacctc
H3ANP3_BAD-02          -----------------------------------------cgggacctc
H3ANP3_BAD-04          -----------------------------------------cgggacctc
E7FBJ6_BAD-01          ---------------------------------------------atcag
A0A672LB88_BAD-01      ---------------------------------------------atcag
A0A671PX91_BAD-01      ---------------------------------------------atcag
A0A673J5Q9_BAD-01      ---------------------------------------------atcag
A0A672R7P6_BAD-01      ---------------------------------------------atcag
A0A671SBB4_BAD-01      ---------------------------------------------atcag
A0A673I6H5_BAD-01      ---------------------------------------------atcag
A0A4W4DXF5_BAD-01      -----------------------------------------atcagcaat
A0A3P8YI30_BAD-01      ---------------------------------------------gtaat
A0A3P8YI30_BAD-02      ---------------------------------------------gtaat
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      ---------------------------------------------a---t
A0A4W5MZR2_BAD-01      ---------------------------------------------a---t
A0A674AVP9_BAD-01      ---------------------------------------------a---t
A0A1S3L0Z2_BAD-01      ---------------------------------------------a---t
B5XEF1_BAD-01          ---------------------------------------------a---t
B5X1T1_BAD-01          ---------------------------------------------attat
A0A673ZHY7_BAD-01      ---------------------------------------------attat
A0A4W5R1T6_BAD-01      ---------------------------------------------atact
A0A060W8P9_BAD-01      ---------------------------------------------ataat
A0A3B1JLM2_BAD-01      -----------------------------------------acggacagc
A0A3B4DUY7_BAD-01      -----------------------------------------ctggacagt
A0A672V9F8_BAD-01      ccc-----------------------------------------cccccc
A0A674GQ16_BAD-01      cccacccaa--------------------------------aatcccccc
A7MCM4_BAD-01          -----------------------------------------cctcactgt
Q4V925_BAD-02          -----------------------------------------cctcactgt
Q4V925_BAD-03          -----------------------------------------cctcactgt
Q4V925_BAD-01          -----------------------------------------cctcactgt
Q4V925_BAD-04          -----------------------------------------cctcactgt
A0A671NP27_BAD-01      -----------------------------------------tctggctgt
A0A672SAE4_BAD-01      -----------------------------------------tctcgctgt
A0A672SAE4_BAD-02      -----------------------------------------tctcgctgt
A0A673J9C6_BAD-01      -----------------------------------------tctcgctgt
A0A672RGH0_BAD-01      -----------------------------------------tctcgctgt
A0A671RUV0_BAD-01      -----------------------------------------tctcgctgt
A0A673HRQ3_BAD-01      -----------------------------------------tctcgctgt
A0A4W4HE29_BAD-01      -----------------------------------------cctacacgt
A0A3B1IH05_BAD-01      -----------------------------------------catcactgt
A0A3B4CPH6_BAD-01      -----------------------------------------cccacttgt
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      -----------------------------------------ccttggcct
A0A3P8Y761_BAD-01      -----------------------------------------ccttaac--
A0A3P8Y761_BAD-02      -----------------------------------------ctctttt--
A0A667ZNC6_BAD-01      -----------------------------------------cctcaccac
A0A6F9CQZ0_BAD-02      -----------------------------------------cctcactgt
A0A6F9CA11_BAD-02      -----------------------------------------cctcacc--
A0A4W5JLL9_BAD-01      -----------------------------------------cctcactgt
A0A4W5JLL9_BAD-02      -----------------------------------------cctcactgt
A0A1S3N9Q3_BAD-01      -----------------------------------------cctcactgt
A0A674DKC6_BAD-01      -----------------------------------------cctcactgt
A0A3Q2Y0E4_BAD-01      -----------------------------------------cctcacctt
A0A668V3Q4_BAD-01      -----------------------------------------acttgccct
I3K7B6_BAD-01          -----------------------------------------acttgccct
A0A3P9B2E4_BAD-01      -----------------------------------------gctttccct
A0A3Q4GGN3_BAD-01      -----------------------------------------gctctccct
A0A3P8QRJ7_BAD-01      -----------------------------------------actttccct
A0A3Q3C680_BAD-01      -----------------------------------------gctttccct
A0A3B4GXJ6_BAD-01      -----------------------------------------gctttccct
A0A3Q0QNQ2_BAD-01      -----------------------------------------a--------
A0A3Q0QNQ2_BAD-02      -----------------------------------------aaggctcat
A0A3Q3WTY4_BAD-01      -----------------------------------------cctcaccct
A0A672JQ68_BAD-01      -----------------------------------------cctcagctt
A0A3P8WI83_BAD-01      -----------------------------------------cctcaccct
A0A3P8WI83_BAD-02      -----------------------------------------cctcaccct
A0A3Q3FKT9_BAD-03      -----------------------------------------cttaaccct
A0A3Q3FKT9_BAD-01      -----------------------------------------cttaaccct
A0A3Q3FKT9_BAD-02      -----------------------------------------cttaaccct
G3Q8B3_BAD-01          -----------------------------------------cctcacctt
A0A3Q1K1C7_BAD-01      -----------------------------------------ccttacctt
A0A672YF93_BAD-01      -----------------------------------------cctcactct
A0A3Q3RXS8_BAD-01      -----------------------------------------ccttgcctt
A0A3Q3R5S3_BAD-01      -----------------------------------------ccttacctt
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      -----------------------------------------cctgactct
A0A674MXC1_BAD-02      -----------------------------------------cctgactct
A0A674MXC1_BAD-03      -----------------------------------------cctgactct
A0A674MXC1_BAD-04      -----------------------------------------cctgactct
A0A3B5BAL2_BAD-01      -----------------------------------------cctcgcctt
A0A3Q1GWH9_BAD-01      -----------------------------------------catggcctt
A0A3Q1CPU7_BAD-01      -----------------------------------------catggcctt
A0A3P8TWH6_BAD-01      -----------------------------------------catggcctt
A0A2U9BAC9_BAD-01      -----------------------------------------cctcgccct
A0A671TL42_BAD-01      -----------------------------------------cctcaccct
A0A665TUH3_BAD-01      -----------------------------------------tctcacctt
A0A4W6EMZ7_BAD-01      -----------------------------------------cgtcaccct
A0A4W6EMZ7_BAD-02      -----------------------------------------cgtcaccct
A0A3B4VFC5_BAD-01      -----------------------------------------cctcacctt
A0A3B4W9T1_BAD-01      -----------------------------------------cctcacctt
A0A3B3BQF7_BAD-01      -----------------------------------------cctcaccct
A0A3P9HNZ2_BAD-01      -----------------------------------------cctcaccct
A0A3B3HDU2_BAD-01      -----------------------------------------cctcaccct
A0A3P9KSL7_BAD-01      -----------------------------------------cctcacact
A0A3P9KSL7_BAD-02      -----------------------------------------cctcacact
A0A3Q3AEL8_BAD-01      -----------------------------------------c------ct
A0A3Q3AEL8_BAD-02      -----------------------------------------c------ct
A0A1A8AQV0_BAD-01      -----------------------------------------cccaac-ct
A0A3Q2QC80_BAD-01      -----------------------------------------cctcaccct
A0A3Q2D5S0_BAD-01      -----------------------------------------c--------
A0A3B5L9R9_BAD-01      -----------------------------------------cctcacgct
A0A3B5Q2N7_BAD-01      -----------------------------------------cctcacgct
A0A3P9Q7C3_BAD-01      -----------------------------------------cctcacgct
A0A3B3YFR1_BAD-01      -----------------------------------------cctcacgct
A0A087X8P8_BAD-01      -----------------------------------------cctcacgct
A0A3B3UA11_BAD-01      -----------------------------------------cctcacgct
A0A452IFQ4_BAD-01      cccggctcc--aagcagccagacac----------------ccccacagc
A0A674I2R9_BAD-01      cccggctcc--aagcagccagacac----------------ccccacagc
A0A3B3QX41_BAD-01      gtca-------cagcaaat----------------------tcacag---
A0A5F8GA49_BAD-01      cggggggcc--aggcagacgcagctccgcag----------cc-------
G3VRY3_BAD-01          -------------------------ccactg----------cccccagcc
G3VRY3_BAD-02          -------------------------ccactg----------cccccagcc
G3VRY3_BAD-03          -------------------------ccactg----------cccccagcc
A0A4X2KAA5_BAD-01      cagggggct--gggcaagcacagcgccactg----------cccccagct
A0A6I8NVP2_BAD-01      ccccgacctagcgtcgcacctccccggacggaggccgccgcccgcggccc
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          ---aggtcc--ctac------------ctgg----------ccccaggtc
Q61337_BAD-07          ---aggtcc--ctac------------ctgg----------ccccaggtc
Q61337_BAD-02          ---aggtcc--ctac------------ctgg----------ccccaggtc
Q61337_BAD-05          ---aggtcc--ctac------------ctgg----------ccccaggtc
Q61337_BAD-01          ---aggtcc--ctac------------ctgg----------ccccaggtc
Q61337_BAD-03          ---aggtcc--ctac------------ctgg----------ccccaggtc
Q61337_BAD-04          ---aggtcc--ctac------------ctgg----------ccccaggtc
Q61337_BAD-06          ---aggtcc--ctac------------ctgg----------ccccaggtc
G1P8C5_BAD-01          cccaggcct--caacaagcactggagtacgg----------tcccaggtc
A0A4X1VE31_BAD-01      cccaggccc--cagcaagccctggcgcacgg----------ccccaggcc
A0A287AEF3_BAD-01      ccc-------------agccctggcgcacgg----------ccccaggcc
A0A4X1VE31_BAD-02      cccaggccc--cagcaagccctggcgcacgg----------ccccaggcc
A0A4X1VE31_BAD-03      cccaggccc--cagcaagccctggcgcacgg----------ccccaggcc
F7DN67_BAD-01          ctcagaccc--ggtcaggcaccagcggacag----------ccccaggcc
M3YNE7_BAD-01          cccaggcct--tggcaagcacctgcagacgg----------ccccaggcc
A0A673V6P8_BAD-01      ctcaggcct--tggcaagcaccagcggacgg----------ccccgggcc
A0A337SAW2_BAD-01      ccgcggccc--tggcaagcaccagcggacga----------ccccaggcc
A0A667H8Z9_BAD-01      ccgcggccc--tggcaagcaccagcggacgg----------ccccaggcc
A0A452RJM6_BAD-01      cccaggccc--tggcaagcaccggcagacag----------ccccaggcc
A0A384DJL2_BAD-01      cccaggccc--tggcaagcaccggcagacag----------ccccaggcc
Q45KI9_BAD-01          cccaagccc--tggcaagcaccagcagacgg----------ccccaggcc
A0A3Q7SWS0_BAD-01      -----------------------------------------ccccaggcc
A0A4W2C9A8_BAD-01      cccaggtct--cagcaagcactggctaacag----------ccccaggcc
A0A4W2C9A8_BAD-01      cccaggtct--cagcaagcactggctaacag----------ccccaggcc
F1MUT9_BAD-01          cccaggtct--cagcaagcactggctaacag----------ccccaggcc
Q3SYZ0_BAD-01          cccaggtct--cagcaagcactggctaacag----------ccccaggcc
A0A452ER54_BAD-01      cccaggtct--ca----------------------------ccccgggcc
A0A452ER54_BAD-02      cccaggtct--cagcaagcactggctaacag----------ccccgggcc
W5P8G9_BAD-01          cccaggtct--cagcaagcactggctaacag----------ccccgggcc
A0A4U1FMC3_BAD-01      cccaggtcc--cagcaagcaccggcaaacgg----------ccccaggcc
A0A2Y9EHU3_BAD-01      cccaggtcc--cagcaagcaccggcaaacgg----------ccccaggcc
G3TP47_BAD-01          ttcaggccc--cagcgaccgccaccgtgtgg----------ccccaggct
A0A2K5E6A6_BAD-02      cccaggctc--tggcaagcatccacgccagg----------ccccaggcc
A0A2K5PDB1_BAD-02      cccaggctc--tggcaagcatcgacgccagg----------ccccaggcc
A0A2K6TG62_BAD-02      cccaggctc--tggcaagcatcgacgccagg----------ccccaggcc
A0A2I2YFH2_BAD-03      ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2R8Z674_BAD-02      ctcgggctc--cagcaagcatcatcgccagg----------ccccaggcc
Q92934_BAD-03          ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2I3TBK7_BAD-01      ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K6E7I4_BAD-02      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K5M0A7_BAD-02      ctcagactg--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K5XJR2_BAD-02      ctcagactg--cggcaagcatcatcgccagg----------ccccaggcc
G5B6Q3_BAD-01          ---aggccc--cagt--------tcaccagg--------------aggct
G5B6Q3_BAD-02          ---aggccc--cagt--------tcaccagg--------------aggct
H0V608_BAD-01          ---aggcag--cagc------------ccag----------caggaggct
A0A287CT05_BAD-01      ---aggctg--cggc------------ttgg----------ctccaggcc
A0A287CT05_BAD-02      ---aggctg--cggc------------ttgg----------ctccaggcc
A0A671ELU4_BAD-01      cccaggccc--aggcaagcacctgtgtacgg----------ccccgggcc
A0A2J8TYJ3_BAD-01      ctcaggctc--cagcaagcatcatcgccagg----------ccccaggcc
A0A2R8Z674_BAD-03      ctcgggctc--cagcaagcatcatcgccagg----------ccccaggcc
A0A2I2YFH2_BAD-04      ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
Q92934_BAD-04          ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2I3TBK7_BAD-03      ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K6E7I4_BAD-03      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K5M0A7_BAD-03      ctcagactg--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K5XJR2_BAD-03      ctcagactg--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K5HKU7_BAD-02      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K6N196_BAD-02      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K6PUL3_BAD-02      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
H0WVR2_BAD-01          cctaggccc--cggcaagaaccgctgcacga----------ctccaagtc
A0A2K5E6A6_BAD-03      cccaggctc--tggcaagcatccacgccagg----------ccccaggcc
A0A2K6GWV0_BAD-01      ctcaggccc--cggcaagcatccctgcacgg----------ctccaagct
A0A2K5HKU7_BAD-01      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K6N196_BAD-01      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K6PUL3_BAD-01      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A0D9R491_BAD-01      ctcagactc--cggcaagcatcatcaccagg----------ccccaggcc
A0A2K5M0A7_BAD-01      ctcagactg--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K5XJR2_BAD-01      ctcagactg--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K6E7I4_BAD-01      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2K5VCA1_BAD-01      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
A0A1D5QBW1_BAD-01      ctcagactc--cggcaagcatcatcgccagg----------ccccaggcc
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      cccaggctc--tggcaagcatcgacgccagg----------ccccaggcc
A0A2K6TG62_BAD-01      cccaggctc--tggcaagcatcgacgccagg----------ccccaggcc
A0A2K5E6A6_BAD-01      cccaggctc--tggcaagcatccacgccagg----------ccccaggcc
U3F2S3_BAD-01          cccaggctc--tggcaagcatcgacgccagg----------ccccaggcc
A0A2J8TYJ3_BAD-02      ctcaggctc--cagcaagcatcatcgccagg----------ccccaggcc
A0A2J8TYJ3_BAD-03      ctcaggctc--cagcaagcatcatcgccagg----------ccccaggcc
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2I2YFH2_BAD-01      ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2I2YFH2_BAD-02      ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2I3TBK7_BAD-02      ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
A0A2R8Z674_BAD-01      ctcgggctc--cagcaagcatcatcgccagg----------ccccaggcc
Q92934_BAD-01          ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
Q92934_BAD-02          ctcaggctc--cggcaagcatcatcgccagg----------ccccaggcc
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      cccaggctc--tggcaagcatcgacgccagg----------ccccaggcc
A0A2K6TG62_BAD-03      cccaggctc--tggcaagcatcgacgccagg----------ccccaggcc
                                                                         

C1C3S9_BAD-01          ccctaacttgagacgaataaaa----------------------------
H3ANP3_BAD-03          accagagccaccccccttctcacacaggtgtatacggttggg--------
H3ANP3_BAD-01          accagagccaccccccttctcac------------------a--------
H3ANP3_BAD-02          accagagccaccccccttctcac------------------a--------
H3ANP3_BAD-04          accagagccaccccccttctcacacagttttttggggattta--------
E7FBJ6_BAD-01          gatcgaacatcggccaacatttctcctcaa------------ggg-----
A0A672LB88_BAD-01      gatcaaaccttgccaaacatttctcctcaa------------ggg-----
A0A671PX91_BAD-01      gatcaaaccttgccaaacatttctcctcaa------------ggg-----
A0A673J5Q9_BAD-01      gatcaaaccttgccaaacatttctcctcaa------------ggg-----
A0A672R7P6_BAD-01      gatcaaaccttgccaaacatttctcctcaa------------gga-----
A0A671SBB4_BAD-01      gatcaaaccttgccaaacatttctcctcaa------------gga-----
A0A673I6H5_BAD-01      gatcaaacctcgccaaacatttctcctcaa------------gga-----
A0A4W4DXF5_BAD-01      catcacatcatgccaaacaacacagcaaca--------------------
A0A3P8YI30_BAD-01      acctccactaatacaagcaatagaacacta------ccaggtgta-----
A0A3P8YI30_BAD-02      acctccactaatacaagcaatagaacacta------ccaggtgta-----
A0A6F9BAV3_BAD-01      ------------atgagcaccagaccacga------ccaggtggg-----
A0A060W8W7_BAD-01      gtctcaactacaatgagcaacagaccaaga------ccaggtgag-----
A0A4W5MZR2_BAD-01      gtctcaactacaatgagcaccagaccaaga------ccaggtgag-----
A0A674AVP9_BAD-01      gtctcaactacaatgagcaacagaccaaga------ccaggtgag-----
A0A1S3L0Z2_BAD-01      gtctcaactacaatgagcaacagaccaaga------ccaggtgag-----
B5XEF1_BAD-01          gtctcaactacaatgagcaacagaccaaga------ccaggtgag-----
B5X1T1_BAD-01          gtctccactaggacgggcatcagaccacga------ccaggtggg-----
A0A673ZHY7_BAD-01      gtctccactaggacgagcatcagaccacga------ccaggtgag-----
A0A4W5R1T6_BAD-01      gtctccactacgacgagcaccagaccacga------ccaggtggg-----
A0A060W8P9_BAD-01      gtctccactacgacgagcatcagaccacga------ccaggtggg-----
A0A3B1JLM2_BAD-01      gggcccagcatgtacagggacacatca---------tcagacgagctgtt
A0A3B4DUY7_BAD-01      cagcacagcatggcaagcaacatatcaccagcttccccagacgaactgtc
A0A672V9F8_BAD-01      ccc-----------------------------------agcc--------
A0A674GQ16_BAD-01      cccggggggaccccaaaaccccccggggggaccccaaaagcc--------
A7MCM4_BAD-01          tcctgatag----------gct----------------------------
Q4V925_BAD-02          tcctgatag----------gct----------------------------
Q4V925_BAD-03          tcctgatag----------gct----------------------------
Q4V925_BAD-01          tcctgatag----------gct----------------------------
Q4V925_BAD-04          tcctgatag----------gct----------------------------
A0A671NP27_BAD-01      gcctgatag----------gct----------------------------
A0A672SAE4_BAD-01      gcctgatag----------gct----------------------------
A0A672SAE4_BAD-02      gcctgatag----------gct----------------------------
A0A673J9C6_BAD-01      gcctgatag----------gct----------------------------
A0A672RGH0_BAD-01      gcctggtag----------gct----------------------------
A0A671RUV0_BAD-01      gcctgatag----------gct----------------------------
A0A673HRQ3_BAD-01      gcctgatag----------gct----------------------------
A0A4W4HE29_BAD-01      acctaatac----------act----------------------------
A0A3B1IH05_BAD-01      tccggagaa----------act----------------------------
A0A3B4CPH6_BAD-01      tccagagag----------att----------------------------
A0A670YRG7_BAD-01      ---------------------------------gcattgggt--------
A0A670JUY4_BAD-01      t-------------------------------------------------
A0A3P8Y761_BAD-01      -------------cta---cca-----------ggcgagggc--------
A0A3P8Y761_BAD-02      -------------ttt---ata-----------ggcgagggc--------
A0A667ZNC6_BAD-01      acctgagctgagaatg---tca-----------gcaagtggc--------
A0A6F9CQZ0_BAD-02      acctgagatgagactg---gca-----------ggagagggt--------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      gcctgagatgagactg---gca-----------ggagagggt--------
A0A4W5JLL9_BAD-02      gcctgagatgagactg---gca-----------ggagagggt--------
A0A1S3N9Q3_BAD-01      gcctgagatgagactg---gca-----------ggagagggt--------
A0A674DKC6_BAD-01      gcctgagatgagactg---gca-----------ggagagggt--------
A0A3Q2Y0E4_BAD-01      gccggagctcccaatggaagca-----------atgtcgggg--------
A0A668V3Q4_BAD-01      tcctgtaatcaaaacg---aca-----------ggtgctgga--------
I3K7B6_BAD-01          tcctgtaatcaaaacg---aca-----------ggtgctgga--------
A0A3P9B2E4_BAD-01      tcctgtaaccaaaacg---aca-----------gctgctgga--------
A0A3Q4GGN3_BAD-01      tcctgtaatcaaaacg---aca-----------gctgctgga--------
A0A3P8QRJ7_BAD-01      tcctgtaaccaaaacg---aca-----------gctgctgga--------
A0A3Q3C680_BAD-01      tcctgtaatcaaaacg---aca-----------gctgctgga--------
A0A3B4GXJ6_BAD-01      tcctgtaatcaaaacg---aca-----------gctgctgga--------
A0A3Q0QNQ2_BAD-01      tcct-----------------------------actgccagg--------
A0A3Q0QNQ2_BAD-02      ttct-----------------------------actgct-----------
A0A3Q3WTY4_BAD-01      acctgagctcaggatg---gca-----------------ggt--------
A0A672JQ68_BAD-01      aaatgaattcaacctg---aca-----------gcgactggt--------
A0A3P8WI83_BAD-01      acctgagctcagggtg---gca-----------ggaagtcgt--------
A0A3P8WI83_BAD-02      acctgagctcagggtg---gca-----------ggaagtcgt--------
A0A3Q3FKT9_BAD-03      accagagctcagactg---gca-----------gggactggt--------
A0A3Q3FKT9_BAD-01      accagagctcagactg---gca-----------gggactggt--------
A0A3Q3FKT9_BAD-02      accagagctcagactg---gca-----------gggactggt--------
G3Q8B3_BAD-01          acctgagctcagattg---tca-----------------ggt--------
A0A3Q1K1C7_BAD-01      accggaactcag---------a-----------gctagtggt--------
A0A672YF93_BAD-01      acctgagctcagaatg---gca-----------ggggccggg--------
A0A3Q3RXS8_BAD-01      acctgagctcagaaca---aca-----------gcctccaat--------
A0A3Q3R5S3_BAD-01      acctgagctcagaatg---gca-----------gcaaccagt--------
H3D8J8_BAD-01          -------------------aca-----------ag---cggt--------
A0A674MXC1_BAD-01      acctgaactcagactg---aca-----------ggtaccagt--------
A0A674MXC1_BAD-02      acctgaactcagactg---aca-----------ggtaccagt--------
A0A674MXC1_BAD-03      acctgaactcagactg---aca-----------ggtaccagt--------
A0A674MXC1_BAD-04      acctgaactcagactg---aca-----------ggtaccagt--------
A0A3B5BAL2_BAD-01      acctgaactcagaacc---cca-----------gccgccggc--------
A0A3Q1GWH9_BAD-01      acctgaactcagaacc---cca-----------gcatctggt--------
A0A3Q1CPU7_BAD-01      acctgaactcagaact---cca-----------gcatctggt--------
A0A3P8TWH6_BAD-01      acctgaactcagaact---cca-----------gcatctggt--------
A0A2U9BAC9_BAD-01      ccctgagctgcgaatg---gca-----------gcaaccggt--------
A0A671TL42_BAD-01      acctgagctcaggatg---gca-----------------ggt--------
A0A665TUH3_BAD-01      acctgagatccgtact---gca-----------ggggctggc--------
A0A4W6EMZ7_BAD-01      ccctgagctcagactg---cca-----------gtgcccggt--------
A0A4W6EMZ7_BAD-02      ccctgagctcagactg---cca-----------gtgcccggt--------
A0A3B4VFC5_BAD-01      gcctgaactccgaggg---gca-----------gcgaccggt--------
A0A3B4W9T1_BAD-01      gcctgaactccgaggg---gca-----------gcgaccggt--------
A0A3B3BQF7_BAD-01      gccagagcttcgactt---aca-----------agtaacggg--------
A0A3P9HNZ2_BAD-01      gccagagcttcgactc---aca-----------agtaacggg--------
A0A3B3HDU2_BAD-01      gccagagcttcgactc---aca-----------agtaacggg--------
A0A3P9KSL7_BAD-01      gccagagcttcgactc---aca-----------agtaacggg--------
A0A3P9KSL7_BAD-02      gccagagcttcgactc---aca-----------agtaacggg--------
A0A3Q3AEL8_BAD-01      gcccgagctcaggcat---tca-----------aagaacggc--------
A0A3Q3AEL8_BAD-02      gcccgagctcaggcat---tca-----------aagaacggc--------
A0A1A8AQV0_BAD-01      gcctgagctcaggctc---ccg-----------ttgaatggt--------
A0A3Q2QC80_BAD-01      tcctgagctcaga------tca-----------gggcatggc--------
A0A3Q2D5S0_BAD-01      ----------------------------------------gt--------
A0A3B5L9R9_BAD-01      tcctgagctccga------tct-----------acaa-------------
A0A3B5Q2N7_BAD-01      tcctgagctccga------tct-----------acaacaggt--------
A0A3P9Q7C3_BAD-01      tcctgagctccga------tct-----------acaacaggt--------
A0A3B3YFR1_BAD-01      tcctgagctccga------tct-----------acaacaggt--------
A0A087X8P8_BAD-01      tcctgagctccga------tct-----------acaacaggt--------
A0A3B3UA11_BAD-01      tcctgagctccga------tct-----------acaacaggt--------
A0A452IFQ4_BAD-01      tgaggtgcgaagccgg---ata-----------gggtcagac--------
A0A674I2R9_BAD-01      tgaggtgcgaagccgg---ata-----------gggtcagac--------
A0A3B3QX41_BAD-01      -cttggaaataacc----------tcaaaaatacgaaaa------atcca
A0A5F8GA49_BAD-01      ----------------------------------------------cctg
G3VRY3_BAD-01          tc-------gccccgc---tcaggccaggaccccgagcagc----acctg
G3VRY3_BAD-02          tc-------gccccgc---tcaggccaggaccccgagcagc----acctg
G3VRY3_BAD-03          tc-------gccccgc---tcaggccaggaccccgagcagc----acctg
A0A4X2KAA5_BAD-01      tg-------gccccag---tcaggcctggacccagacccgc----acctg
A0A6I8NVP2_BAD-01      acctcagtgaagcccc---tcctttcagct---ggcttcccccccgcctc
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          tcctggggagcatcgt---tca--gcagcagccgggacaggc---agcca
Q61337_BAD-07          tcctggggagcaacat---tca--tcagca---gggacgggc---agcca
Q61337_BAD-02          tcctggggagcaacat---tca--tcagca---gggacgggc---agcca
Q61337_BAD-05          tcctggggagcaacat---tca--tcagca---gggacgggc---agcca
Q61337_BAD-01          tcctggggagcaacat---tca--tcagca---gggacgggc---agcca
Q61337_BAD-03          tcctggggagcaacat---tca--tcagca---gggacgggc---agcca
Q61337_BAD-04          tcctggggagcaacat---tca--tcagca---gggacgggc---agcca
Q61337_BAD-06          tcctggggagcaacat---tca--tcagca---gggacgggc---agcca
G1P8C5_BAD-01          tcctgggggaagctgg---tca--ccagca---gggccagcc---ggcca
A0A4X1VE31_BAD-01      acctgggggaagctgg---tca--ccagca---ggggcagcc---ggcca
A0A287AEF3_BAD-01      acctgggggaagctgg---tca--ccagca---ggggcagcc---ggcca
A0A4X1VE31_BAD-02      acctgggggaagctgg---tca--ccagca---ggggcagcc---ggcca
A0A4X1VE31_BAD-03      acctgggggaagctgg---tca--ccagca---ggggcagcc---ggcca
F7DN67_BAD-01          tcctgggggaagctgg---tca--ccagca---ggggcagcc---ggcca
M3YNE7_BAD-01          tcctaggggaagctgg---tca--ccagca---ggggcagcc---ggcca
A0A673V6P8_BAD-01      tccttggggaagctgg---tcc--ccagca---ggggcagcc---ggcca
A0A337SAW2_BAD-01      tcctcggggaagctgg---tca--ccagca---ggggcagcc---cgcca
A0A667H8Z9_BAD-01      tcctcggggaagctgg---tca--ccagca---ggggcagcc---cgcca
A0A452RJM6_BAD-01      tcctaggggaagctgc---tca--acccca---ggggcagcc---ggcca
A0A384DJL2_BAD-01      tcctaggggaagctgc---tca--ccccca---ggggcagcc---ggcca
Q45KI9_BAD-01          tcctaggggaagctgg---tca--ccagca---ggggcagcc---agcca
A0A3Q7SWS0_BAD-01      tcctaggggaagctgg---tca--ccagca---ggggcagcc---agcca
A0A4W2C9A8_BAD-01      tcctgggggaagctgg---tca--ccagca---ggggcagcc---ggccg
A0A4W2C9A8_BAD-01      tcctgggggaagctgg---tca--ccagca---ggggcagcc---ggccg
F1MUT9_BAD-01          tcctgggggaagctgg---tca--ccagca---ggggcagcc---ggccg
Q3SYZ0_BAD-01          tcctgggggaagctgg---tca--ccagca---ggggcagcc---ggccg
A0A452ER54_BAD-01      tcctgggggaagctgg---tca--ccagca---ggggcagcc---ggccg
A0A452ER54_BAD-02      tcctgggggaagctgg---tca--ccagca---ggggcagcc---ggccg
W5P8G9_BAD-01          tcctgggggaagctgg---tca--ccagca---ggggcagcc---ggccg
A0A4U1FMC3_BAD-01      tcctgggggaagctgg---tca--ccagca---ggggcagcc---agcca
A0A2Y9EHU3_BAD-01      tcctgggggaagctgg---tca--ccagca---ggggcagcc---agcca
G3TP47_BAD-01          tcctgcgggactccag---tca--ccagca---ggggcagcc---gacca
A0A2K5E6A6_BAD-02      tcccaggggacgccag---tca--ccagca---gggacagcc---aacca
A0A2K5PDB1_BAD-02      tcccgggggacgccag---tca--ccagca---gggacagcc---aacca
A0A2K6TG62_BAD-02      tcccgggggacgccag---tca--ccagca---gggacagcc---aacca
A0A2I2YFH2_BAD-03      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2R8Z674_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
Q92934_BAD-03          tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2I3TBK7_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K6E7I4_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K5M0A7_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K5XJR2_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
G5B6Q3_BAD-01          tcctgggagacatcag---tca--ccagca---gaggcagct---gatca
G5B6Q3_BAD-02          tcctgggagacatcag---tca--ccagca---gaggcagct---gatca
H0V608_BAD-01          tcctgggggacaccag---tca--ccagca---gaggcagctgagaagca
A0A287CT05_BAD-01      tccccagggacacggg---tca--ccagca---gtggcaggc---aacca
A0A287CT05_BAD-02      tccccagggacacggg---tca--ccagca---gtggcaggc---aacca
A0A671ELU4_BAD-01      tcctgggggaagctgg---tca--ccaaca---gggacagcc---agcca
A0A2J8TYJ3_BAD-01      tcctgcgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2R8Z674_BAD-03      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2I2YFH2_BAD-04      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
Q92934_BAD-04          tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2I3TBK7_BAD-03      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K6E7I4_BAD-03      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K5M0A7_BAD-03      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K5XJR2_BAD-03      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K5HKU7_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcaggc---aacca
A0A2K6N196_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K6PUL3_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
H0WVR2_BAD-01          tcctgggggacgccag---tca--cctgca---ggggcagcc---ggcca
A0A2K5E6A6_BAD-03      tcccaggggacgccag---tca--ccagca---gggacagcc---aacca
A0A2K6GWV0_BAD-01      tcctgggggacgccag---tca--ccagca---ggggcagcc---cagca
A0A2K5HKU7_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcaggc---aacca
A0A2K6N196_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K6PUL3_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A0D9R491_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K5M0A7_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K5XJR2_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K6E7I4_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2K5VCA1_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A1D5QBW1_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      tcccgggggacgccag---tca--ccagca---gggacagcc---aacca
A0A2K6TG62_BAD-01      tcccgggggacgccag---tca--ccagca---gggacagcc---aacca
A0A2K5E6A6_BAD-01      tcccaggggacgccag---tca--ccagca---gggacagcc---aacca
U3F2S3_BAD-01          tcccgggggacgccag---tca--ccagca---gggacagtc---aacca
A0A2J8TYJ3_BAD-02      tcctgcgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2J8TYJ3_BAD-03      tcctgcgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2I2YFH2_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2I2YFH2_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2I3TBK7_BAD-02      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
A0A2R8Z674_BAD-01      tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
Q92934_BAD-01          tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
Q92934_BAD-02          tcctgtgggacgccag---tca--ccagca---ggagcagcc---aacca
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      tcccgggggacgccag---tca--ccagca---gggacagcc---aacca
A0A2K6TG62_BAD-03      tcccgggggacgccag---tca--ccagca---gggacagcc---aacca
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      -gaggtcgggggt-------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      ggaggtggggggt-------------------------------------
A0A3B4DUY7_BAD-01      agaggttgggtgt-------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      -------acccca-------------------------------------
A0A674I2R9_BAD-01      -------ccccca-------------------------------------
A0A3B3QX41_BAD-01      ggagaggc------------------------------------------
A0A5F8GA49_BAD-01      gagcccagcgcca-------------------------------------
G3VRY3_BAD-01          gagcccaccacca-------------------------------------
G3VRY3_BAD-02          gagcccaccacca-------------------------------------
G3VRY3_BAD-03          gagcccaccacca-------------------------------------
A0A4X2KAA5_BAD-01      gagcccaccacca-------------------------------------
A0A6I8NVP2_BAD-01      cccccggccac---------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          ataacagtcatca-------------------------------------
Q61337_BAD-07          ccaacagtcatca-------------------------------------
Q61337_BAD-02          ccaacagtcatca-------------------------------------
Q61337_BAD-05          ccaacagtcatca-------------------------------------
Q61337_BAD-01          ccaacagtcatca-------------------------------------
Q61337_BAD-03          ccaacagtcatca-------------------------------------
Q61337_BAD-04          ccaacagtcatca-------------------------------------
Q61337_BAD-06          ccaacagtcatca-------------------------------------
G1P8C5_BAD-01          gcagcagccacca-------------------------------------
A0A4X1VE31_BAD-01      gcagcagccacca-------------------------------------
A0A287AEF3_BAD-01      gcagcagccacca-------------------------------------
A0A4X1VE31_BAD-02      gcagcagccacca-------------------------------------
A0A4X1VE31_BAD-03      gcagcagccacca-------------------------------------
F7DN67_BAD-01          gcagcagccacca-------------------------------------
M3YNE7_BAD-01          gcagcagccacca-------------------------------------
A0A673V6P8_BAD-01      gcagcagccgcca-------------------------------------
A0A337SAW2_BAD-01      gcagcaaccacca-------------------------------------
A0A667H8Z9_BAD-01      gcagcaaccacca-------------------------------------
A0A452RJM6_BAD-01      gcagcaaccacca-------------------------------------
A0A384DJL2_BAD-01      gcagcaaccacca-------------------------------------
Q45KI9_BAD-01          gccgcaaacacca-------------------------------------
A0A3Q7SWS0_BAD-01      gccgcaaacacca-------------------------------------
A0A4W2C9A8_BAD-01      gcagcagccacca-------------------------------------
A0A4W2C9A8_BAD-01      gcagcagccacca-------------------------------------
F1MUT9_BAD-01          gcagcagccacca-------------------------------------
Q3SYZ0_BAD-01          gcagcagccacca-------------------------------------
A0A452ER54_BAD-01      gcagcagccacca-------------------------------------
A0A452ER54_BAD-02      gcagcagccacca-------------------------------------
W5P8G9_BAD-01          gcagcagccacca-------------------------------------
A0A4U1FMC3_BAD-01      gcagcagccacca-------------------------------------
A0A2Y9EHU3_BAD-01      gcagcagccacca-------------------------------------
G3TP47_BAD-01          gcagcggccacca-------------------------------------
A0A2K5E6A6_BAD-02      gcagcagccacca-------------------------------------
A0A2K5PDB1_BAD-02      gcagcagccacca-------------------------------------
A0A2K6TG62_BAD-02      gcagcagccacca-------------------------------------
A0A2I2YFH2_BAD-03      gcagcagccatca-------------------------------------
A0A2R8Z674_BAD-02      gcagcagccatca-------------------------------------
Q92934_BAD-03          gcagcagccatca-------------------------------------
A0A2I3TBK7_BAD-01      gcagcagccatca-------------------------------------
A0A2K6E7I4_BAD-02      gcagcagccatca-------------------------------------
A0A2K5M0A7_BAD-02      gcagcagccatca-------------------------------------
A0A2K5XJR2_BAD-02      gcagcagccatca-------------------------------------
G5B6Q3_BAD-01          gcagcagacacca-------------------------------------
G5B6Q3_BAD-02          gcagcagacacca-------------------------------------
H0V608_BAD-01          gcaggagccacca-------------------------------------
A0A287CT05_BAD-01      gcagcagcaacca-------------------------------------
A0A287CT05_BAD-02      gcagcagcaacca-------------------------------------
A0A671ELU4_BAD-01      gcagcagccacca-------------------------------------
A0A2J8TYJ3_BAD-01      gcagcagccatcatggagggagaacttggtattctccttcttgggaatct
A0A2R8Z674_BAD-03      gcagcagccatcatggagggagaacttcgtattctccttcttgggaatct
A0A2I2YFH2_BAD-04      gcagcagccatcatggagggagaacttcgtattctccttcttgggaatct
Q92934_BAD-04          gcagcagccatcatggagggagaacttcgtattctccttcttgggaatct
A0A2I3TBK7_BAD-03      gcagcagccatcatggagggagaacttcgtattctccttcttgggaatct
A0A2K6E7I4_BAD-03      gcagcagccatcatggagggagagcttggtattctccttcttgggaatct
A0A2K5M0A7_BAD-03      gcagcagccatcatggagggggagcttggtattctccttcttgggaatct
A0A2K5XJR2_BAD-03      gcagcagccatcatggagggggagcttggtattctccttcttgggaatct
A0A2K5HKU7_BAD-02      gcagcagccatcatggagggagagcttggtattctccttct---gaatct
A0A2K6N196_BAD-02      gcagcagccatcatggagggagagcttggtattatcctgct---gaatct
A0A2K6PUL3_BAD-02      gcagcagccatcatggagggagagcttggtattatcctgct---gaatct
H0WVR2_BAD-01          gcaacacccacca-------------------------------------
A0A2K5E6A6_BAD-03      gcagcagccaccatggaggtgagtactccacttgtgcctct------gct
A0A2K6GWV0_BAD-01      gcagcagccacca-------------------------------------
A0A2K5HKU7_BAD-01      gcagcagccatca-------------------------------------
A0A2K6N196_BAD-01      gcagcagccatca-------------------------------------
A0A2K6PUL3_BAD-01      gcagcagccatca-------------------------------------
A0A0D9R491_BAD-01      gcagcagccatca-------------------------------------
A0A2K5M0A7_BAD-01      gcagcagccatca-------------------------------------
A0A2K5XJR2_BAD-01      gcagcagccatca-------------------------------------
A0A2K6E7I4_BAD-01      gcagcagccatca-------------------------------------
A0A2K5VCA1_BAD-01      gcagcagccatca-------------------------------------
A0A1D5QBW1_BAD-01      gcagcagccatca-------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      gcagcagccacca-------------------------------------
A0A2K6TG62_BAD-01      gcagcagccacca-------------------------------------
A0A2K5E6A6_BAD-01      gcagcagccacca-------------------------------------
U3F2S3_BAD-01          gcagcagccacca-------------------------------------
A0A2J8TYJ3_BAD-02      gcagcagccatca-------------------------------------
A0A2J8TYJ3_BAD-03      gcagcagccatca-------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          gcagcagccatca-------------------------------------
A0A2I2YFH2_BAD-01      gcagcagccatca-------------------------------------
A0A2I2YFH2_BAD-02      gcagcagccatca-------------------------------------
A0A2I3TBK7_BAD-02      gcagcagccatca-------------------------------------
A0A2R8Z674_BAD-01      gcagcagccatca-------------------------------------
Q92934_BAD-01          gcagcagccatca-------------------------------------
Q92934_BAD-02          gcagcagccatca-------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      gcagcagccaccatgga---------------------------------
A0A2K6TG62_BAD-03      gcagcagccaccatgga---------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      gaggactctgaaaatcccagtgcagggatgctcgcggaagcatcagcagg
A0A2R8Z674_BAD-03      gaggactctgaaaatcccagtgcagggatgctcgcggaagcatcagcagg
A0A2I2YFH2_BAD-04      gaggactctgaaaatcccagtgcagggatgctcgcggaagcatcagcagg
Q92934_BAD-04          gaggactctgaaaatcccagtgcagggatgctcgcggaagcatcagcagg
A0A2I3TBK7_BAD-03      gaggactctgaaaatcccagtgcagggatgcttgcggaagcatcagcagg
A0A2K6E7I4_BAD-03      gaggactctgaaaatcccagtgcaaggatgctcgcggaagcatcagcacg
A0A2K5M0A7_BAD-03      gaggactctgaaaatcccagtgcaaggatgctcgcggaagcatcagcacg
A0A2K5XJR2_BAD-03      gaggactctgaaaatcccagtgcaaggatgctcgcggaagcatcagcacg
A0A2K5HKU7_BAD-02      gaggactctgaaaatcccagtgcaaggatgctcacggaagcatcagcagg
A0A2K6N196_BAD-02      gaggactctgaaaatcccagtgcaaggatgctcgcggaagcatcagcagg
A0A2K6PUL3_BAD-02      gaggactctgaaaatcccagtgcaaggatgctcgcggaagcatcagcagg
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      tcctcatctgagaatcccagtgcaaggatgctctcgaaagcatcagcagg
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      ---------gagaatcccagtgcaaggatgctctcgaaaacatcagcagg
A0A2K6TG62_BAD-03      ---------gagaatcccagtgcaaagatgctctcgaaagcatcagcagg
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
A0A672LB88_BAD-01      --------------------------------------------------
A0A671PX91_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
A0A672R7P6_BAD-01      --------------------------------------------------
A0A671SBB4_BAD-01      --------------------------------------------------
A0A673I6H5_BAD-01      --------------------------------------------------
A0A4W4DXF5_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-01      --------------------------------------------------
A0A3P8YI30_BAD-02      --------------------------------------------------
A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A060W8W7_BAD-01      --------------------------------------------------
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
A0A1S3L0Z2_BAD-01      --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------
A0A060W8P9_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A671NP27_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-01      --------------------------------------------------
A0A672SAE4_BAD-02      --------------------------------------------------
A0A673J9C6_BAD-01      --------------------------------------------------
A0A672RGH0_BAD-01      --------------------------------------------------
A0A671RUV0_BAD-01      --------------------------------------------------
A0A673HRQ3_BAD-01      --------------------------------------------------
A0A4W4HE29_BAD-01      --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-02      --------------------------------------------------
A0A667ZNC6_BAD-01      --------------------------------------------------
A0A6F9CQZ0_BAD-02      --------------------------------------------------
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      --------------------------------------------------
A0A668V3Q4_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      --------------------------------------------------
A0A3P8QRJ7_BAD-01      --------------------------------------------------
A0A3Q3C680_BAD-01      --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-01      --------------------------------------------------
A0A3Q0QNQ2_BAD-02      --------------------------------------------------
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-01      --------------------------------------------------
A0A3P8WI83_BAD-02      --------------------------------------------------
A0A3Q3FKT9_BAD-03      --------------------------------------------------
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3Q1K1C7_BAD-01      --------------------------------------------------
A0A672YF93_BAD-01      --------------------------------------------------
A0A3Q3RXS8_BAD-01      --------------------------------------------------
A0A3Q3R5S3_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
A0A674MXC1_BAD-01      --------------------------------------------------
A0A674MXC1_BAD-02      --------------------------------------------------
A0A674MXC1_BAD-03      --------------------------------------------------
A0A674MXC1_BAD-04      --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A3Q1GWH9_BAD-01      --------------------------------------------------
A0A3Q1CPU7_BAD-01      --------------------------------------------------
A0A3P8TWH6_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A671TL42_BAD-01      --------------------------------------------------
A0A665TUH3_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-01      --------------------------------------------------
A0A4W6EMZ7_BAD-02      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
A0A3Q3AEL8_BAD-01      --------------------------------------------------
A0A3Q3AEL8_BAD-02      --------------------------------------------------
A0A1A8AQV0_BAD-01      --------------------------------------------------
A0A3Q2QC80_BAD-01      --------------------------------------------------
A0A3Q2D5S0_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
A0A3P9Q7C3_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A5F8GA49_BAD-01      --------------------------------------------------
G3VRY3_BAD-01          --------------------------------------------------
G3VRY3_BAD-02          --------------------------------------------------
G3VRY3_BAD-03          --------------------------------------------------
A0A4X2KAA5_BAD-01      --------------------------------------------------
A0A6I8NVP2_BAD-01      --------------------------------------------------
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
Q61337_BAD-04          --------------------------------------------------
Q61337_BAD-06          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
A0A4X1VE31_BAD-01      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A673V6P8_BAD-01      --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
A0A667H8Z9_BAD-01      --------------------------------------------------
A0A452RJM6_BAD-01      --------------------------------------------------
A0A384DJL2_BAD-01      --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
A0A3Q7SWS0_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
A0A4W2C9A8_BAD-01      --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
A0A452ER54_BAD-01      --------------------------------------------------
A0A452ER54_BAD-02      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
A0A4U1FMC3_BAD-01      --------------------------------------------------
A0A2Y9EHU3_BAD-01      --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
A0A287CT05_BAD-01      --------------------------------------------------
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-01      gatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaa
A0A2R8Z674_BAD-03      gatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaa
A0A2I2YFH2_BAD-04      gatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaa
Q92934_BAD-04          gatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaa
A0A2I3TBK7_BAD-03      gatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaa
A0A2K6E7I4_BAD-03      gatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaa
A0A2K5M0A7_BAD-03      gatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaa
A0A2K5XJR2_BAD-03      gatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaa
A0A2K5HKU7_BAD-02      gatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaa
A0A2K6N196_BAD-02      gatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaa
A0A2K6PUL3_BAD-02      gatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaa
H0WVR2_BAD-01          --------------------------------------------------
A0A2K5E6A6_BAD-03      gatgtccgccccagccactgactcagaa---------------aatgtaa
A0A2K6GWV0_BAD-01      --------------------------------------------------
A0A2K5HKU7_BAD-01      --------------------------------------------------
A0A2K6N196_BAD-01      --------------------------------------------------
A0A2K6PUL3_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-01      --------------------------------------------------
A0A2K5VCA1_BAD-01      --------------------------------------------------
A0A1D5QBW1_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6A6_BAD-01      --------------------------------------------------
U3F2S3_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I2YFH2_BAD-01      --------------------------------------------------
A0A2I2YFH2_BAD-02      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      gatgtcttccccagccactgactcagaagcccaacacacagagaatgtaa
A0A2K6TG62_BAD-03      gatgtctgccccagccactgactcagaagcccaacacacagagaatgtaa
                                                                         

C1C3S9_BAD-01          -------------------ggaaaag------------------------
H3ANP3_BAD-03          ---taaaacttaggaagcgaaataacatggagattctggggcg------t
H3ANP3_BAD-01          ---c---------------agataacatggagattctggggcg------t
H3ANP3_BAD-02          ---c---------------agataacatggagattctggggcg------t
H3ANP3_BAD-04          ---c---------------agataacatggagattctggggcg------t
E7FBJ6_BAD-01          ---c---------------gtgtgcg-----------------------g
A0A672LB88_BAD-01      ---c---------------gtgtgcg-----------------------g
A0A671PX91_BAD-01      ---c---------------gtgtgcg-----------------------g
A0A673J5Q9_BAD-01      ---c---------------gtgtgcg-----------------------g
A0A672R7P6_BAD-01      ---c---------------gtgtgcg-----------------------g
A0A671SBB4_BAD-01      ---c---------------gtgtgcg-----------------------g
A0A673I6H5_BAD-01      ---c---------------gtgtgcg-----------------------g
A0A4W4DXF5_BAD-01      ---c---------------gtgtgcg-----------------------g
A0A3P8YI30_BAD-01      ---c---------------gcgtccg-----------------------g
A0A3P8YI30_BAD-02      ---c---------------gcgtccg-----------------------g
A0A6F9BAV3_BAD-01      ---c---------------gtgtccg-----------------------g
A0A060W8W7_BAD-01      ---c---------------gagtccg-----------------------g
A0A4W5MZR2_BAD-01      ---c---------------gagtccg-----------------------g
A0A674AVP9_BAD-01      ---c---------------gagtccg-----------------------g
A0A1S3L0Z2_BAD-01      ---c---------------gagtccg-----------------------g
B5XEF1_BAD-01          ---c---------------gagtccg-----------------------g
B5X1T1_BAD-01          ---c---------------gagtgcg-----------------------g
A0A673ZHY7_BAD-01      ---c---------------gagtccg-----------------------g
A0A4W5R1T6_BAD-01      ---c---------------gagtccg-----------------------g
A0A060W8P9_BAD-01      ---c---------------gagctcg-----------------------g
A0A3B1JLM2_BAD-01      ---c---------------gagtgag-----------------------g
A0A3B4DUY7_BAD-01      ---c---------------gtgttcg-----------------------g
A0A672V9F8_BAD-01      ---c---------------gttatggggttgtccccgccccccgtgcttt
A0A674GQ16_BAD-01      ---a---------------tttttgggggtcccctgacgcccctcccccc
A7MCM4_BAD-01          ---g---------------aaaggag-----------------------a
Q4V925_BAD-02          ---g---------------aaaggag-----------------------a
Q4V925_BAD-03          ---g---------------aaaggag-----------------------a
Q4V925_BAD-01          ---g---------------aaaggag-----------------------a
Q4V925_BAD-04          ---g---------------aaaggag-----------------------a
A0A671NP27_BAD-01      ---g---------------aaaggag-----------------------a
A0A672SAE4_BAD-01      ---g---------------aaaggag-----------------------a
A0A672SAE4_BAD-02      ---g---------------aaaggag-----------------------a
A0A673J9C6_BAD-01      ---g---------------aaaggag-----------------------a
A0A672RGH0_BAD-01      ---g---------------aaaggag-----------------------a
A0A671RUV0_BAD-01      ---g---------------aaaggag-----------------------a
A0A673HRQ3_BAD-01      ---g---------------aaaggag-----------------------a
A0A4W4HE29_BAD-01      ---c---------------agaggag-----------------------a
A0A3B1IH05_BAD-01      ---c---------------agagtag-----------------------a
A0A3B4CPH6_BAD-01      ---c---------------ag---ag-----------------------a
A0A670YRG7_BAD-01      ---c---------------ggaccaa------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      ---c---------------ggataag-----------------------g
A0A3P8Y761_BAD-02      ---c---------------ggataag-----------------------g
A0A667ZNC6_BAD-01      ---c---------------gggtcag-----------------------g
A0A6F9CQZ0_BAD-02      ---c---------------ggttgag-----------------------g
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      ---c---------------ggttgag-----------------------g
A0A4W5JLL9_BAD-02      ---c---------------ggttgag-----------------------g
A0A1S3N9Q3_BAD-01      ---c---------------ggttgag-----------------------g
A0A674DKC6_BAD-01      ---c---------------ggttgag-----------------------g
A0A3Q2Y0E4_BAD-01      ---c---------------ggatccg-----------------------g
A0A668V3Q4_BAD-01      ---a---------------ggctcag-----------------------g
I3K7B6_BAD-01          ---a---------------ggctcag-----------------------g
A0A3P9B2E4_BAD-01      ---a---------------ggctcag-----------------------g
A0A3Q4GGN3_BAD-01      ---a---------------ggctcag-----------------------g
A0A3P8QRJ7_BAD-01      ---a---------------ggctcag-----------------------g
A0A3Q3C680_BAD-01      ---a---------------ggctcag-----------------------g
A0A3B4GXJ6_BAD-01      ---a---------------ggctcag-----------------------g
A0A3Q0QNQ2_BAD-01      ---a---------------ggatcag-----------------------g
A0A3Q0QNQ2_BAD-02      ---t---------------gtatctg------------------------
A0A3Q3WTY4_BAD-01      ---a---------------ggac---------------------------
A0A672JQ68_BAD-01      ---c---------------ggatcag-----------------------g
A0A3P8WI83_BAD-01      ---c---------------ggatcag-----------------------g
A0A3P8WI83_BAD-02      ---c---------------ggatcag-----------------------g
A0A3Q3FKT9_BAD-03      ---c---------------ggatcag-----------------------g
A0A3Q3FKT9_BAD-01      ---c---------------ggatcag-----------------------g
A0A3Q3FKT9_BAD-02      ---c---------------ggatcag-----------------------g
G3Q8B3_BAD-01          ---a---------------gga----------------------------
A0A3Q1K1C7_BAD-01      ---c---------------gaatcag-----------------------g
A0A672YF93_BAD-01      ---c---------------gactcag-----------------------g
A0A3Q3RXS8_BAD-01      ---c---------------gaatcag-----------------------g
A0A3Q3R5S3_BAD-01      ---c---------------gaaacag-----------------------g
H3D8J8_BAD-01          ---c---------------ggatcag-----------------------g
A0A674MXC1_BAD-01      ---c---------------ggaccag-----------------------g
A0A674MXC1_BAD-02      ---c---------------ggaccag-----------------------g
A0A674MXC1_BAD-03      ---c---------------ggaccag-----------------------g
A0A674MXC1_BAD-04      ---c---------------ggaccag-----------------------g
A0A3B5BAL2_BAD-01      ---c---------------ggatcag-----------------------g
A0A3Q1GWH9_BAD-01      ---c---------------ggatcag-----------------------g
A0A3Q1CPU7_BAD-01      ---c---------------ggctcag-----------------------g
A0A3P8TWH6_BAD-01      ---c---------------ggctcag-----------------------g
A0A2U9BAC9_BAD-01      ---c---------------gaatccg-----------------------g
A0A671TL42_BAD-01      ---c---------------gaatcag-----------------------g
A0A665TUH3_BAD-01      ---c---------------gaaccag-----------------------g
A0A4W6EMZ7_BAD-01      ---c---------------gaatcag-----------------------g
A0A4W6EMZ7_BAD-02      ---c---------------gaatcag-----------------------g
A0A3B4VFC5_BAD-01      ---c---------------gaacgag-----------------------g
A0A3B4W9T1_BAD-01      ---c---------------gaacgag-----------------------g
A0A3B3BQF7_BAD-01      ---c---------------gtaccag-----------------------g
A0A3P9HNZ2_BAD-01      ---c---------------gtaccag-----------------------g
A0A3B3HDU2_BAD-01      ---c---------------gtaccag-----------------------g
A0A3P9KSL7_BAD-01      ---c---------------gtaccag-----------------------g
A0A3P9KSL7_BAD-02      ---c---------------gtaccag-----------------------g
A0A3Q3AEL8_BAD-01      ---c---------------ggctcag-----------------------g
A0A3Q3AEL8_BAD-02      ---c---------------ggctcag-----------------------g
A0A1A8AQV0_BAD-01      ---c---------------ggatcag-----------------------g
A0A3Q2QC80_BAD-01      ---c---------------ggatcag-----------------------a
A0A3Q2D5S0_BAD-01      ---c---------------ggatcag-----------------------a
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      ---c---------------gggtgag-----------------------a
A0A3P9Q7C3_BAD-01      ---c---------------gggtgag-----------------------a
A0A3B3YFR1_BAD-01      ---c---------------gggtgag-----------------------a
A0A087X8P8_BAD-01      ---c---------------gggtgag-----------------------a
A0A3B3UA11_BAD-01      ---c---------------gggtgag-----------------------a
A0A452IFQ4_BAD-01      -------------------------------tctctggagc---------
A0A674I2R9_BAD-01      -------------------------------tctctggagc---------
A0A3B3QX41_BAD-01      ---t---------------gg---aggtcgtgtacggatgcgg------t
A0A5F8GA49_BAD-01      ---c---------------ga---gg-----gcgcggg------------
G3VRY3_BAD-01          ---t---------------ga---gg-----gcgccggcgcgg-------
G3VRY3_BAD-02          ---t---------------ga---gg-----gcgccggcgcgg-------
G3VRY3_BAD-03          ---t---------------ga---gg-----gcgccggcgcgg-------
A0A4X2KAA5_BAD-01      ---t---------------ga---gg-----gcgcaggcgcaggcgccgg
A0A6I8NVP2_BAD-01      ------------------------ag-----gtcccagagcaa------a
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          ---t---------------gg---ag-----gt-----------------
Q61337_BAD-07          ---t---------------gg---ag-----gcgcaggggcta------t
Q61337_BAD-02          ---t---------------gg---ag-----gcgcaggggcta------t
Q61337_BAD-05          ---t---------------gg---ag-----gcgcaggggcta------t
Q61337_BAD-01          ---t---------------gg---ag-----gcgcaggggcta------t
Q61337_BAD-03          ---t---------------gg---ag-----gcgcaggggcta------t
Q61337_BAD-04          ---t---------------gg---ag-----gcgcaggggcta------t
Q61337_BAD-06          ---t---------------gg---ag-----gcgcaggggcta------t
G1P8C5_BAD-01          ---t---------------ga---cg-----gcgctgggtctg------t
A0A4X1VE31_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A287AEF3_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A4X1VE31_BAD-02      ---t---------------gg---ag-----gcgctggggctg------t
A0A4X1VE31_BAD-03      ---t---------------gg---ag-----gcgctggggctg------t
F7DN67_BAD-01          ---t---------------gg---ag-----gcgctggggcgg------t
M3YNE7_BAD-01          ---t---------------gg---ag-----gcgctggggctg------t
A0A673V6P8_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A337SAW2_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A667H8Z9_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A452RJM6_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A384DJL2_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
Q45KI9_BAD-01          ---t---------------gg---ag-----gcgctggggct--------
A0A3Q7SWS0_BAD-01      ---t---------------gg---ag-----gcgctggggct--------
A0A4W2C9A8_BAD-01      ---t---------------gg---ag-----gcactggggctg------t
A0A4W2C9A8_BAD-01      ---t---------------gg---ag-----gcactggggctg------t
F1MUT9_BAD-01          ---t---------------gg---ag-----gcactggggctg------t
Q3SYZ0_BAD-01          ---t---------------gg---ag-----gcactggggctg------t
A0A452ER54_BAD-01      ---t---------------gg---ag-----gcactggggctg------t
A0A452ER54_BAD-02      ---t---------------gg---ag-----gcactggggctg------t
W5P8G9_BAD-01          ---t---------------gg---ag-----gcactggggctg------t
A0A4U1FMC3_BAD-01      ---t---------------gg---ag-----gcactggggctg------t
A0A2Y9EHU3_BAD-01      ---t---------------gg---ag-----gcactggtgctg------t
G3TP47_BAD-01          ---t---------------gg---ag-----gtgctgcggctg------t
A0A2K5E6A6_BAD-02      ---t---------------gg---ag-----g------------------
A0A2K5PDB1_BAD-02      ---t---------------gg---ag-----g------------------
A0A2K6TG62_BAD-02      ---t---------------gg---ag-----g------------------
A0A2I2YFH2_BAD-03      ---t---------------ggagaag-----g------------------
A0A2R8Z674_BAD-02      ---t---------------ggagaag-----g------------------
Q92934_BAD-03          ---t---------------ggagaag-----g------------------
A0A2I3TBK7_BAD-01      ---t---------------ggagaag-----g------------------
A0A2K6E7I4_BAD-02      ---t---------------gg---ag-----g------------------
A0A2K5M0A7_BAD-02      ---t---------------gg---ag-----g------------------
A0A2K5XJR2_BAD-02      ---t---------------gg---ag-----g------------------
G5B6Q3_BAD-01          ---t---------------gg---ag-----gcactggggcta------c
G5B6Q3_BAD-02          ---t---------------gg---ag-----gcactggggcta------c
H0V608_BAD-01          ---t---------------gg---ag-----gcactgtggcta------t
A0A287CT05_BAD-01      ---t---------------gg---ag-----gcgctggggcta------c
A0A287CT05_BAD-02      ---t---------------gg---ag-----gcgctggggcta------c
A0A671ELU4_BAD-01      ---t---------------gg---ag-----gcgctgggtctg------t
A0A2J8TYJ3_BAD-01      agct---------------gg---ag-----gcgctggggctg------t
A0A2R8Z674_BAD-03      agct---------------ag---ag-----gcgctggggctg------t
A0A2I2YFH2_BAD-04      agct---------------ag---ag-----gcgctggggctg------t
Q92934_BAD-04          agct---------------ag---ag-----gcgctggggctg------t
A0A2I3TBK7_BAD-03      agct---------------ag---ag-----gcgctggggctg------t
A0A2K6E7I4_BAD-03      agct---------------ga---ag-----gcgctggggctg------t
A0A2K5M0A7_BAD-03      agct---------------ga---ag-----gcgctggggctg------t
A0A2K5XJR2_BAD-03      agct---------------ga---ag-----gcgctggggctg------t
A0A2K5HKU7_BAD-02      agct---------------gg---ag-----gcgctggggctg------t
A0A2K6N196_BAD-02      agct---------------gg---ag-----gcgctggggctg------t
A0A2K6PUL3_BAD-02      agct---------------gg---ag-----gcgctggggctg------t
H0WVR2_BAD-01          ---t---------------ggagcag-----gacctggggcag------t
A0A2K5E6A6_BAD-03      agct---------------gg---ag-----gtgccttg-----------
A0A2K6GWV0_BAD-01      ---t---------------gg---ag-----gagctgggtctg------t
A0A2K5HKU7_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A2K6N196_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A2K6PUL3_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A0D9R491_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A2K5M0A7_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A2K5XJR2_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A2K6E7I4_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A2K5VCA1_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A1D5QBW1_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A2K6TG62_BAD-01      ---t---------------gg---ag-----gcgctggagccg------t
A0A2K5E6A6_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
U3F2S3_BAD-01          ---t---------------gg---ag-----gcgctggggctg------t
A0A2J8TYJ3_BAD-02      ---t---------------gg---ag-----gcgctggggctg------t
A0A2J8TYJ3_BAD-03      ---t---------------gg---ag-----gcgctggggctg------t
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          ---t---------------gg---ag-----gcgctggggctg------t
A0A2I2YFH2_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
A0A2I2YFH2_BAD-02      ---t---------------gg---ag-----gcgctggggctg------t
A0A2I3TBK7_BAD-02      ---t---------------gg---ag-----gcgctggggctg------t
A0A2R8Z674_BAD-01      ---t---------------gg---ag-----gcgctggggctg------t
Q92934_BAD-01          ---t---------------gg---ag-----gcgctggggctg------t
Q92934_BAD-02          ---t---------------gg---ag-----gcgctggggctg------t
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      agct---------------gg---ag-----gcgctggggctg------t
A0A2K6TG62_BAD-03      agct---------------gg---ag-----gcgctggagccg------t
                                                                         

C1C3S9_BAD-01          --aaactcggcaacggacagaatctgcttc--------------------
H3ANP3_BAD-03          ccaagttccgagtccca---------------------------------
H3ANP3_BAD-01          ccaagttccgagtccca---------------------------------
H3ANP3_BAD-02          ccaagttccgagtccca---------------------------------
H3ANP3_BAD-04          ccaagttccgagtccca---------------------------------
E7FBJ6_BAD-01          ctctattcggaatctcaagtgta---taca--------------------
A0A672LB88_BAD-01      ctctattcggagtctcaggtgta---tacg--------------------
A0A671PX91_BAD-01      ctctattcggagtctcaggtgta---tacg--------------------
A0A673J5Q9_BAD-01      ctctattcggagtctcaggtgta---tacg--------------------
A0A672R7P6_BAD-01      ctctattcggagtctcaggtgta---tatg--------------------
A0A671SBB4_BAD-01      ttctattcggagtctcaggtgta---tatg--------------------
A0A673I6H5_BAD-01      ctctattcggagtctcaggtgta---tatg--------------------
A0A4W4DXF5_BAD-01      ctctactccgagtcccaggcata---caca--------------------
A0A3P8YI30_BAD-01      ctctactcggaatcccaggtgtgttcccag--------------------
A0A3P8YI30_BAD-02      ctctactcggaatcccaggtgtgttcccag--------------------
A0A6F9BAV3_BAD-01      ctctactcagagtcccaggtgtgctcccag--------------------
A0A060W8W7_BAD-01      ctctactcagagtcccaggtgtgctcccag--------------------
A0A4W5MZR2_BAD-01      ctctactcagagtcccaggtgtgctcccag--------------------
A0A674AVP9_BAD-01      ctctactcagagtcccaggtgtgctcccag--------------------
A0A1S3L0Z2_BAD-01      ctctactcagagtcccaggtgtgctcccag--------------------
B5XEF1_BAD-01          ctctactcagagtcccaggtgcgctcccag--------------------
B5X1T1_BAD-01          ctctactccgagtcccaggtgtgctcccag--------------------
A0A673ZHY7_BAD-01      ctctactccgagtcccaggtgtgctcccag--------------------
A0A4W5R1T6_BAD-01      ctctactccgagtcccaggtgttctcccac--------------------
A0A060W8P9_BAD-01      ctctactccgagtcccaggtgtgctcccag--------------------
A0A3B1JLM2_BAD-01      ctctactcagagtcccaagtgta---caac--------------------
A0A3B4DUY7_BAD-01      ctgtactctgagtcccaggtgta---cacg--------------------
A0A672V9F8_BAD-01      gtgggggggggggttcag-----------g--------------------
A0A674GQ16_BAD-01      gcagaggcgcggccccggctgctgtcggag--------------------
A7MCM4_BAD-01          gcaactgggcagacagaggaacctctcgat--------------------
Q4V925_BAD-02          gcaactgggcagacagaggaacctctcgat--------------------
Q4V925_BAD-03          gcaactgggcagacagaggaacctctcgat--------------------
Q4V925_BAD-01          gcaactgggcagacagaggaacctctcgat--------------------
Q4V925_BAD-04          gcaactgggcagacagaggaacctctcgat--------------------
A0A671NP27_BAD-01      acaactagggagacacaggaatctttcgat--------------------
A0A672SAE4_BAD-01      acaactagggagacacaggaatctttcgat--------------------
A0A672SAE4_BAD-02      acaactagggagacacaggaatctttcgat--------------------
A0A673J9C6_BAD-01      acaactagggagacacaggaatctttcgat--------------------
A0A672RGH0_BAD-01      acaactagggagacaccggaatctttccat--------------------
A0A671RUV0_BAD-01      acaactagggagacaccggaatctttccat--------------------
A0A673HRQ3_BAD-01      acaactagggagacaccggaatctttccat--------------------
A0A4W4HE29_BAD-01      atggacggcgaggcagaggaatcactcaat--------------------
A0A3B1IH05_BAD-01      gc------ccaggcaaaggaatttttctat--------------------
A0A3B4CPH6_BAD-01      gt------caaggcagaggaatcactctat--------------------
A0A670YRG7_BAD-01      ctcgattcggagacctc---------------------------------
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      ttaaactctgaatctca--ggtcttcgcta----catctggtggggaga-
A0A3P8Y761_BAD-02      ttaaactctgaatctca--ggtcttcgcta----catctggtggggaga-
A0A667ZNC6_BAD-01      ctgaactctgaatccca--cgtctccactg----tctcc---------a-
A0A6F9CQZ0_BAD-02      ttgaattcagagtccca--ggccttctcta----cgtcccgtgggaaga-
A0A6F9CA11_BAD-02      --------------------gccc--------------------------
A0A4W5JLL9_BAD-01      atgaactcagagtccca--ggccc--------------------------
A0A4W5JLL9_BAD-02      atgaactcagagtccca--ggccc--------------------------
A0A1S3N9Q3_BAD-01      atgaactcagagtccca--ggccc--------------------------
A0A674DKC6_BAD-01      atgaactcagagtccca--ggccc--------------------------
A0A3Q2Y0E4_BAD-01      ctcaactcggagtccca--cgctttggcag----tgtcc---------c-
A0A668V3Q4_BAD-01      ctaaactcagagtccca--cacttcctcag----ttgcc---------a-
I3K7B6_BAD-01          ctaaactcagagtccca--cacttcctcag----ttgcc---------a-
A0A3P9B2E4_BAD-01      gtgaactcagagtccca--cacttcctcaa----ttgcc---------a-
A0A3Q4GGN3_BAD-01      gtgaactcagagtccca--cacttcctcaa----ttgcc---------a-
A0A3P8QRJ7_BAD-01      gtgaactcagagtccca--cacttcctcaa----ttgcc---------a-
A0A3Q3C680_BAD-01      gtgaactcagagtccca--cacttcctcaa----ttgcc---------a-
A0A3B4GXJ6_BAD-01      gtgaactcagagtccca--cacttcctcaa----ttgcc---------a-
A0A3Q0QNQ2_BAD-01      atgaactcagagtccca--cacttcctcag----tctcc---------a-
A0A3Q0QNQ2_BAD-02      -tgatctcrttcttttggtcactacccaaagctttctcc---------a-
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      cttaactcggagtcaat--cgcttccacag----tctcc---------a-
A0A3P8WI83_BAD-01      ctaaattcagagtcaca--tgcttcaacca----tttcc---------a-
A0A3P8WI83_BAD-02      ctaaattcagagtcaca--tgcttcaacca----tttcc---------a-
A0A3Q3FKT9_BAD-03      ttgaactcagagtccca--cgcttacaccg----tctcc---------a-
A0A3Q3FKT9_BAD-01      ttgaactcagagtccca--cgcttacaccg----tctcc---------a-
A0A3Q3FKT9_BAD-02      ttgaactcagagtccca--cgcttacaccg----tctcc---------a-
G3Q8B3_BAD-01          --aatctcaaag-------------aattg----tggaa---------a-
A0A3Q1K1C7_BAD-01      ctgaactcagagtctca--cgcttccaccg----tctac---------a-
A0A672YF93_BAD-01      ctgaactctgagtccca--agtttccaatg----tcacc---------a-
A0A3Q3RXS8_BAD-01      ctgagttcggagtcc------------cag------tcc---------a-
A0A3Q3R5S3_BAD-01      gtgagctcggagtccaa--tgcttccactg------tcc---------a-
H3D8J8_BAD-01          gtcaactcggaatccca--agcatccgccg----tctcc---------a-
A0A674MXC1_BAD-01      gtcagctcggagtccca--ggcgtccacct----tctcc---------a-
A0A674MXC1_BAD-02      gtcagctcggagtccca--ggcgtccacct----tctcc---------a-
A0A674MXC1_BAD-03      gtcagctcggagtccca--ggcgtccacct----tctcc---------a-
A0A674MXC1_BAD-04      gtcagctcggagtccca--ggcgtccacct----tctcc---------a-
A0A3B5BAL2_BAD-01      ctgaactcagagtccca--cgcgaccacgg----tctcc---------a-
A0A3Q1GWH9_BAD-01      ctgaactcggagtccca--cgcctccacgc----tctcc---------a-
A0A3Q1CPU7_BAD-01      ctgaactcggagtccca--cgcctccacgc----tctcc---------a-
A0A3P8TWH6_BAD-01      ctgaactcggagtccca--cgcctccacgc----tctcc---------a-
A0A2U9BAC9_BAD-01      ctgaactcggagtccaa--cgcttccactc----tctca---------c-
A0A671TL42_BAD-01      ctgaactcagagtccca--cgcttccaccg----tctcc---------a-
A0A665TUH3_BAD-01      ctgaattcagagtccca--cacttccactg----gctcc---------a-
A0A4W6EMZ7_BAD-01      ctgaactcagagtccca--cgcttccactg----cctcc---------a-
A0A4W6EMZ7_BAD-02      ctgaactcagagtccca--cgcttccactg----cctcc---------a-
A0A3B4VFC5_BAD-01      ctgaactcagagtccca--cacttccactg----tctcc---------a-
A0A3B4W9T1_BAD-01      ctgaactcagagtccca--cacttccactg----tctcc---------a-
A0A3B3BQF7_BAD-01      ctgaattcagagtccac--cgtttcgacgt----actcc---------a-
A0A3P9HNZ2_BAD-01      ctgaattcagagtccac--cgcttccacgt----actcc---------a-
A0A3B3HDU2_BAD-01      ctgaattcagagtccac--cgcttccacgt----actcc---------a-
A0A3P9KSL7_BAD-01      ctgaattcagagtccac--cgcttccacgt----actcc---------a-
A0A3P9KSL7_BAD-02      ctgaattcagagtccac--cgcttccacgt----actcc---------a-
A0A3Q3AEL8_BAD-01      gtgaactcggagtcgct--ctcctccacca----gctcc---------a-
A0A3Q3AEL8_BAD-02      gtgaactcggagtcgct--ctcctccacca----gctcc---------a-
A0A1A8AQV0_BAD-01      ctcaactcggagtccca--cgtttccaacg----tctcc---------a-
A0A3Q2QC80_BAD-01      ctgaactcggagtccca--cgcctccacca----tctcc---------a-
A0A3Q2D5S0_BAD-01      ctgagctcggagtctca--cgctttca----------cc---------a-
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      ctgaactcggagtccat--cgcttccacca----tctcc---------a-
A0A3P9Q7C3_BAD-01      ctgaactcggagtccat--cgcttccacca----tctcc---------a-
A0A3B3YFR1_BAD-01      ctgaactcggagtccat--cgcttccacca----tctcc---------a-
A0A087X8P8_BAD-01      ctgaactcggagtccat--cgcttccacca----tctcc---------a-
A0A3B3UA11_BAD-01      ctgaactcggagtccat--cgcttccacca----tctcc---------a-
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      ccgaatcccaggtttcttcgattcgaa-----------------------
A0A5F8GA49_BAD-01      ggacaggcggccccgcctgatctcctaccc------------------cc
G3VRY3_BAD-01          -----ggaggcctcgcctgatctcctaccc------------------cc
G3VRY3_BAD-02          -----ggaggcctcgcctgatctcctaccc------------------cc
G3VRY3_BAD-03          -----ggaggcctcgcctgatctcctaccc------------------cc
A0A4X2KAA5_BAD-01      ggacagaaggccccgcctgatctcctaccc------------------cc
A0A6I8NVP2_BAD-01      ggagccgtccggacgcctgaactcggaacc------------------c-
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          ggagactcggagtcgccacagttcgtaccc------------------a-
Q61337_BAD-02          ggagactcggagtcgccacagttcgtaccc------------------a-
Q61337_BAD-05          ggagactcggagtcgccacagttcgtaccc------------------a-
Q61337_BAD-01          ggagactcggagtcgccacagttcgtaccc------------------a-
Q61337_BAD-03          ggagactcggagtcgccacagttcgtaccc------------------a-
Q61337_BAD-04          ggagactcggagtcgccacagttcgtaccc------------------a-
Q61337_BAD-06          ggagactcggagtcgccacagttcgtaccc------------------a-
G1P8C5_BAD-01          ggagccgcggagtcgccacagctcgtaccc------------------c-
A0A4X1VE31_BAD-01      ggagacccggagtcgccacagctcttaccc------------------a-
A0A287AEF3_BAD-01      ggagacccggagtcgccacagctcttaccc------------------a-
A0A4X1VE31_BAD-02      ggagacccggagtcgccacagctcttaccc------------------a-
A0A4X1VE31_BAD-03      ggagacccggagtcgccacagctcttaccc------------------a-
F7DN67_BAD-01          ggagacccggagtcgccatagctcgtaccc------------------c-
M3YNE7_BAD-01          ggagacgcggagtcgccacagctcgtaccc------------------c-
A0A673V6P8_BAD-01      ggagacacggagtcgtcacagctcgtaccc------------------c-
A0A337SAW2_BAD-01      ggagacccggagtcgccacagctcgtaccc------------------c-
A0A667H8Z9_BAD-01      ggagacccggagtcgccacagctcgtaccc------------------c-
A0A452RJM6_BAD-01      ggagccccggagtcgccacagctcgtaccc------------------c-
A0A384DJL2_BAD-01      ggagccccggagtcgccacagctcgtaccc------------------c-
Q45KI9_BAD-01          -gagacccggagtcgccacagctcgttccc------------------c-
A0A3Q7SWS0_BAD-01      -gagacccggagtcgccacagctcgttccc------------------c-
A0A4W2C9A8_BAD-01      ggagacccggagtcgtcacagctcctaccg------------------c-
A0A4W2C9A8_BAD-01      ggagacccggagtcgtcacagctcctaccg------------------c-
F1MUT9_BAD-01          ggagacccggagtcgtcacagctcctaccg------------------c-
Q3SYZ0_BAD-01          ggagacccggagtcgtcacagctcctaccg------------------c-
A0A452ER54_BAD-01      ggagacccggagtcgtcacagctcctaccc------------------c-
A0A452ER54_BAD-02      ggagacccggagtcgtcacagctcctaccc------------------c-
W5P8G9_BAD-01          ggagacccggagtcgtcacagctcctaccc------------------c-
A0A4U1FMC3_BAD-01      ggagacccggagtcgccacagctcctactc------------------c-
A0A2Y9EHU3_BAD-01      ggacacccggagtcgccacagctcctactc------------------c-
G3TP47_BAD-01          ggagacccggagtcgccacagctcataccc------------------c-
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          ggagacccggagtcgccacagctcataccc------------------c-
G5B6Q3_BAD-02          ggagacccggagtcgccacagctcataccc------------------c-
H0V608_BAD-01          ggagacccggagtcgccaccggtcttatcc------------------t-
A0A287CT05_BAD-01      ggagacccggagtcgccacagctcgtaccc------------------c-
A0A287CT05_BAD-02      ggagacccggagtcgccacagctcgtaccc------------------c-
A0A671ELU4_BAD-01      ggagccccggagtcgccacagctcgtaccc------------------c-
A0A2J8TYJ3_BAD-01      ggagatccggagtcgccacagctcctaccc------------------c-
A0A2R8Z674_BAD-03      ggagatccggagtcgccacagctcctaccc------------------c-
A0A2I2YFH2_BAD-04      ggagatccggagtcgccacagctcctaccc------------------c-
Q92934_BAD-04          ggagatccggagtcgccacagctcctaccc------------------c-
A0A2I3TBK7_BAD-03      ggagatccggagtcgccacagctcctaccc------------------c-
A0A2K6E7I4_BAD-03      ggagacccgcagtcgccacagctcctaccc------------------c-
A0A2K5M0A7_BAD-03      ggagacccggagtcgccacagctcctaccc------------------c-
A0A2K5XJR2_BAD-03      ggagacccggagtcgccacagctcctaccc------------------c-
A0A2K5HKU7_BAD-02      ggagacccggagtcgccacagctcccaccc------------------c-
A0A2K6N196_BAD-02      ggagacccggagtcgccacagctcctaccc------------------c-
A0A2K6PUL3_BAD-02      ggagacccggagtcgccacagctcctaccc------------------c-
H0WVR2_BAD-01          ggagacccggagtcgccacagctcgtaccc------------------g-
A0A2K5E6A6_BAD-03      -------ctgggtcgccacagctcctaccc------------------c-
A0A2K6GWV0_BAD-01      ggagacccggagtcgccacagctcgtaccc------------------c-
A0A2K5HKU7_BAD-01      ggagacccggagtcgccacagctcccaccc------------------c-
A0A2K6N196_BAD-01      ggagacccggagtcgccacagctcctaccc------------------c-
A0A2K6PUL3_BAD-01      ggagacccggagtcgccacagctcctaccc------------------c-
A0A0D9R491_BAD-01      ggagacccggagtcgccacagctcctaccc------------------c-
A0A2K5M0A7_BAD-01      ggagacccggagtcgccacagctcctaccc------------------c-
A0A2K5XJR2_BAD-01      ggagacccggagtcgccacagctcctaccc------------------c-
A0A2K6E7I4_BAD-01      ggagacccgcagtcgccacagctcctaccc------------------c-
A0A2K5VCA1_BAD-01      ggagacccggagtcgccacagctcctaccc------------------c-
A0A1D5QBW1_BAD-01      ggagacccggagtcgccacagctcctaccc------------------c-
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      ggagacccggagtcgccacagatcgtaccc------------------c-
A0A2K6TG62_BAD-01      ggagacacggagtcgccacagctcgtaccc------------------c-
A0A2K5E6A6_BAD-01      ggagacccgaagtcgccacagctcctaccc------------------c-
U3F2S3_BAD-01          ggagacccggagtcgccacagctcgtaccc------------------c-
A0A2J8TYJ3_BAD-02      ggagatccggagtcgccacagctcctaccc------------------c-
A0A2J8TYJ3_BAD-03      ggagatccggagtcgccacagctcctaccc------------------c-
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          ggagatccggagtcgccacagctcctaccc------------------c-
A0A2I2YFH2_BAD-01      ggagatccggagtcgccacagctcctaccc------------------c-
A0A2I2YFH2_BAD-02      ggagatccggagtcgccacagctcctaccc------------------c-
A0A2I3TBK7_BAD-02      ggagatccggagtcgccacagctcctaccc------------------c-
A0A2R8Z674_BAD-01      ggagatccggagtcgccacagctcctaccc------------------c-
Q92934_BAD-01          ggagatccggagtcgccacagctcctaccc------------------c-
Q92934_BAD-02          ggagatccggagtcgccacagctcctaccc------------------c-
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      ggagacccggagtcgccacagatcgtaccc------------------c-
A0A2K6TG62_BAD-03      ggagacacggagtcgccacagctcgtaccc------------------c-
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
E7FBJ6_BAD-01          ----------------------------gtcagccgctggcagga-----
A0A672LB88_BAD-01      ----------------------------gtgagccgctggcagga-----
A0A671PX91_BAD-01      ----------------------------gtgagccgctggcagga-----
A0A673J5Q9_BAD-01      ----------------------------gtgagccgctggcagga-----
A0A672R7P6_BAD-01      ----------------------------gtcagccgctggcagga-----
A0A671SBB4_BAD-01      ----------------------------gtcagccgctggcagga-----
A0A673I6H5_BAD-01      ----------------------------gtcagccgctggcagga-----
A0A4W4DXF5_BAD-01      ----------------------------gtgagccactgggaaga-----
A0A3P8YI30_BAD-01      ----------------------------gttggcagacaggacaa-----
A0A3P8YI30_BAD-02      ----------------------------gttggcagacaggacaa-----
A0A6F9BAV3_BAD-01      ----------------------------gttggcaaaagggaaga-----
A0A060W8W7_BAD-01      ----------------------------gttggaaaaagggaaga-----
A0A4W5MZR2_BAD-01      ----------------------------gttggcaaaagggaaaa-----
A0A674AVP9_BAD-01      ----------------------------gttggcaaaagggaaga-----
A0A1S3L0Z2_BAD-01      ----------------------------gttggcaaaagggaaga-----
B5XEF1_BAD-01          ----------------------------gttggcaaaagggaaga-----
B5X1T1_BAD-01          ----------------------------gttggcagaagggacaa-----
A0A673ZHY7_BAD-01      ----------------------------gttggcagaagggaaga-----
A0A4W5R1T6_BAD-01      ----------------------------gttggcagaagggacga-----
A0A060W8P9_BAD-01      ----------------------------gttggcagaagggatga-----
A0A3B1JLM2_BAD-01      ----------------------------atcaaccgctgggagga-----
A0A3B4DUY7_BAD-01      ----------------------------gtcagccgctggcagga-----
A0A672V9F8_BAD-01      --------------------------------------------------
A0A674GQ16_BAD-01      --------------------------------------------------
A7MCM4_BAD-01          ---------------------------------------gaatga-----
Q4V925_BAD-02          ---------------------------------------gaatga-----
Q4V925_BAD-03          ---------------------------------------gaatga-----
Q4V925_BAD-01          ---------------------------------------gaatga-----
Q4V925_BAD-04          ---------------------------------------gaatga-----
A0A671NP27_BAD-01      ---------------------------------------gaatga-----
A0A672SAE4_BAD-01      ---------------------------------------gaatga-----
A0A672SAE4_BAD-02      ---------------------------------------gaatga-----
A0A673J9C6_BAD-01      ---------------------------------------gaatga-----
A0A672RGH0_BAD-01      ---------------------------------------gaatga-----
A0A671RUV0_BAD-01      ---------------------------------------gaatga-----
A0A673HRQ3_BAD-01      ---------------------------------------gaatga-----
A0A4W4HE29_BAD-01      ---------------------------------------gaatga-----
A0A3B1IH05_BAD-01      ---------------------------------------gaatga-----
A0A3B4CPH6_BAD-01      ---------------------------------------gaatga-----
A0A670YRG7_BAD-01      --------------------------------------------------
A0A670JUY4_BAD-01      -----------------------------------------gggc-----
A0A3P8Y761_BAD-01      -----------------------------------------ggag-----
A0A3P8Y761_BAD-02      -----------------------------------------ggag-----
A0A667ZNC6_BAD-01      -----------------------------------------aaga-----
A0A6F9CQZ0_BAD-02      -----------------------------------------ggaa-----
A0A6F9CA11_BAD-02      --------------------------------------------------
A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      --------------------------------------------------
A0A1S3N9Q3_BAD-01      --------------------------------------------------
A0A674DKC6_BAD-01      --------------------------------------------------
A0A3Q2Y0E4_BAD-01      -----------------------------------------gaga-----
A0A668V3Q4_BAD-01      -----------------------------------------ggga-----
I3K7B6_BAD-01          -----------------------------------------ggga-----
A0A3P9B2E4_BAD-01      -----------------------------------------ggga-----
A0A3Q4GGN3_BAD-01      -----------------------------------------ggga-----
A0A3P8QRJ7_BAD-01      -----------------------------------------ggga-----
A0A3Q3C680_BAD-01      -----------------------------------------ggga-----
A0A3B4GXJ6_BAD-01      -----------------------------------------ggga-----
A0A3Q0QNQ2_BAD-01      -----------------------------------------ggga-----
A0A3Q0QNQ2_BAD-02      -----------------------------------------ggga-----
A0A3Q3WTY4_BAD-01      --------------------------------------------------
A0A672JQ68_BAD-01      -----------------------------------------gaga-----
A0A3P8WI83_BAD-01      -----------------------------------------gaga-----
A0A3P8WI83_BAD-02      -----------------------------------------gaga-----
A0A3Q3FKT9_BAD-03      -----------------------------------------ggga-----
A0A3Q3FKT9_BAD-01      -----------------------------------------ggga-----
A0A3Q3FKT9_BAD-02      -----------------------------------------ggga-----
G3Q8B3_BAD-01          -----------------------------------------aaga-----
A0A3Q1K1C7_BAD-01      -----------------------------------------gaga-----
A0A672YF93_BAD-01      -----------------------------------------gaga-----
A0A3Q3RXS8_BAD-01      -----------------------------------------ggg------
A0A3Q3R5S3_BAD-01      -----------------------------------------gga------
H3D8J8_BAD-01          -----------------------------------------gaga-----
A0A674MXC1_BAD-01      -----------------------------------------gaga-----
A0A674MXC1_BAD-02      -----------------------------------------gaga-----
A0A674MXC1_BAD-03      -----------------------------------------gaga-----
A0A674MXC1_BAD-04      -----------------------------------------gaga-----
A0A3B5BAL2_BAD-01      -----------------------------------------gaga-----
A0A3Q1GWH9_BAD-01      -----------------------------------------gaga-----
A0A3Q1CPU7_BAD-01      -----------------------------------------gaga-----
A0A3P8TWH6_BAD-01      -----------------------------------------gaga-----
A0A2U9BAC9_BAD-01      -----------------------------------------gaga-----
A0A671TL42_BAD-01      -----------------------------------------gaga-----
A0A665TUH3_BAD-01      -----------------------------------------gaga-----
A0A4W6EMZ7_BAD-01      -----------------------------------------gaga-----
A0A4W6EMZ7_BAD-02      -----------------------------------------gaga-----
A0A3B4VFC5_BAD-01      -----------------------------------------gaga-----
A0A3B4W9T1_BAD-01      -----------------------------------------gaga-----
A0A3B3BQF7_BAD-01      -----------------------------------------gaga-----
A0A3P9HNZ2_BAD-01      -----------------------------------------gaga-----
A0A3B3HDU2_BAD-01      -----------------------------------------gaga-----
A0A3P9KSL7_BAD-01      -----------------------------------------gaga-----
A0A3P9KSL7_BAD-02      -----------------------------------------gaga-----
A0A3Q3AEL8_BAD-01      --------------------------------------gggggga-----
A0A3Q3AEL8_BAD-02      --------------------------------------gggggga-----
A0A1A8AQV0_BAD-01      -----------------------------------------gaga-----
A0A3Q2QC80_BAD-01      -----------------------------------------gaga-----
A0A3Q2D5S0_BAD-01      -----------------------------------------gaga-----
A0A3B5L9R9_BAD-01      --------------------------------------------a-----
A0A3B5Q2N7_BAD-01      -----------------------------------------gaga-----
A0A3P9Q7C3_BAD-01      -----------------------------------------gaga-----
A0A3B3YFR1_BAD-01      -----------------------------------------gaga-----
A0A087X8P8_BAD-01      -----------------------------------------gaga-----
A0A3B3UA11_BAD-01      -----------------------------------------gaga-----
A0A452IFQ4_BAD-01      --------------------------------------------------
A0A674I2R9_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------gcgaggatctcg
A0A5F8GA49_BAD-01      cactccgggaggggccggcggtggaggtgggtcccgaggccggag-----
G3VRY3_BAD-01          cgctaagggagggctc--ccg-ggaggcgagccccgaagcggagg-----
G3VRY3_BAD-02          cgctaagggagggctc--ccg-ggaggcgagccccgaagcggagg-----
G3VRY3_BAD-03          cgctaagggagggctc--ccg-ggaggcgagccccgaagcggagg-----
A0A4X2KAA5_BAD-01      cacttcgggaggggcc--cgg-ggaggcgagtcccgaagcggagg-----
A0A6I8NVP2_BAD-01      --------------------------------------ccggatt-----
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          --------------------------------------gcgggga-----
Q61337_BAD-02          --------------------------------------gcgggga-----
Q61337_BAD-05          --------------------------------------gcgggga-----
Q61337_BAD-01          --------------------------------------gcgggga-----
Q61337_BAD-03          --------------------------------------gcgggga-----
Q61337_BAD-04          --------------------------------------gcgggga-----
Q61337_BAD-06          --------------------------------------gcgggga-----
G1P8C5_BAD-01          --------------------------------------acgggga-----
A0A4X1VE31_BAD-01      --------------------------------------gagggga-----
A0A287AEF3_BAD-01      --------------------------------------gagggga-----
A0A4X1VE31_BAD-02      --------------------------------------gagggga-----
A0A4X1VE31_BAD-03      --------------------------------------gagggga-----
F7DN67_BAD-01          --------------------------------------gagggga-----
M3YNE7_BAD-01          --------------------------------------gcgggga-----
A0A673V6P8_BAD-01      --------------------------------------gccggga-----
A0A337SAW2_BAD-01      --------------------------------------gccggga-----
A0A667H8Z9_BAD-01      --------------------------------------gccggga-----
A0A452RJM6_BAD-01      --------------------------------------gcgggga-----
A0A384DJL2_BAD-01      --------------------------------------gcgggga-----
Q45KI9_BAD-01          --------------------------------------gcgggga-----
A0A3Q7SWS0_BAD-01      --------------------------------------gcgggga-----
A0A4W2C9A8_BAD-01      --------------------------------------gcggggc-----
A0A4W2C9A8_BAD-01      --------------------------------------gcggggc-----
F1MUT9_BAD-01          --------------------------------------gcggggc-----
Q3SYZ0_BAD-01          --------------------------------------gcggggc-----
A0A452ER54_BAD-01      --------------------------------------gcggggc-----
A0A452ER54_BAD-02      --------------------------------------gcggggc-----
W5P8G9_BAD-01          --------------------------------------gcggggc-----
A0A4U1FMC3_BAD-01      --------------------------------------gcgggga-----
A0A2Y9EHU3_BAD-01      --------------------------------------gcgggga-----
G3TP47_BAD-01          --------------------------------------gcagggt-----
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------acgggga-----
G5B6Q3_BAD-02          --------------------------------------acgggga-----
H0V608_BAD-01          --------------------------------------gcaggga-----
A0A287CT05_BAD-01      --------------------------------------gcagata-----
A0A287CT05_BAD-02      --------------------------------------gcagata-----
A0A671ELU4_BAD-01      --------------------------------------gcgggga-----
A0A2J8TYJ3_BAD-01      --------------------------------------gcgggga-----
A0A2R8Z674_BAD-03      --------------------------------------gcgggga-----
A0A2I2YFH2_BAD-04      --------------------------------------gcgggga-----
Q92934_BAD-04          --------------------------------------gcgggga-----
A0A2I3TBK7_BAD-03      --------------------------------------gcgggga-----
A0A2K6E7I4_BAD-03      --------------------------------------gcgggga-----
A0A2K5M0A7_BAD-03      --------------------------------------gcgggga-----
A0A2K5XJR2_BAD-03      --------------------------------------gcgggga-----
A0A2K5HKU7_BAD-02      --------------------------------------gcgggga-----
A0A2K6N196_BAD-02      --------------------------------------gcgggga-----
A0A2K6PUL3_BAD-02      --------------------------------------gcgggga-----
H0WVR2_BAD-01          --------------------------------------gcaggga-----
A0A2K5E6A6_BAD-03      --------------------------------------gcaggga-----
A0A2K6GWV0_BAD-01      --------------------------------------gcgggga-----
A0A2K5HKU7_BAD-01      --------------------------------------gcgggga-----
A0A2K6N196_BAD-01      --------------------------------------gcgggga-----
A0A2K6PUL3_BAD-01      --------------------------------------gcgggga-----
A0A0D9R491_BAD-01      --------------------------------------gcgggga-----
A0A2K5M0A7_BAD-01      --------------------------------------gcgggga-----
A0A2K5XJR2_BAD-01      --------------------------------------gcgggga-----
A0A2K6E7I4_BAD-01      --------------------------------------gcgggga-----
A0A2K5VCA1_BAD-01      --------------------------------------gcgggga-----
A0A1D5QBW1_BAD-01      --------------------------------------gcgggga-----
Q2PG01_BAD-01          --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------gcaggga-----
A0A2K6TG62_BAD-01      --------------------------------------gcaggga-----
A0A2K5E6A6_BAD-01      --------------------------------------gcaggga-----
U3F2S3_BAD-01          --------------------------------------gcaggga-----
A0A2J8TYJ3_BAD-02      --------------------------------------gcgggga-----
A0A2J8TYJ3_BAD-03      --------------------------------------gcgggga-----
A0A2I3H4B2_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------gcgggga-----
A0A2I2YFH2_BAD-01      --------------------------------------gcgggga-----
A0A2I2YFH2_BAD-02      --------------------------------------gcgggga-----
A0A2I3TBK7_BAD-02      --------------------------------------gcgggga-----
A0A2R8Z674_BAD-01      --------------------------------------gcgggga-----
Q92934_BAD-01          --------------------------------------gcgggga-----
Q92934_BAD-02          --------------------------------------gcgggga-----
Q92934_BAD-05          --------------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------gcaggga-----
A0A2K6TG62_BAD-03      --------------------------------------gcaggga-----
                                                                         

C1C3S9_BAD-01          ------------------------agaagcctcagagacggacagtgttg
H3ANP3_BAD-03          ----------------------------gatctcagactcagaatcactg
H3ANP3_BAD-01          ----------------------------gatctcagactcagaatcactg
H3ANP3_BAD-02          ----------------------------gatctcagactcagaatcactg
H3ANP3_BAD-04          ----------------------------gatctcagactcagaatcactg
E7FBJ6_BAD-01          ----------------------cacagagacccaggatggagcatcggtg
A0A672LB88_BAD-01      ----------------------agcagagccccaggatggagcattggtg
A0A671PX91_BAD-01      ----------------------agcagagccccaggatggagcattggcg
A0A673J5Q9_BAD-01      ----------------------agcagagccccaggatggagcattggcg
A0A672R7P6_BAD-01      ----------------------agctgagccccaggatggagcatcggcg
A0A671SBB4_BAD-01      ----------------------agcagagccccaggatggagcatcggcg
A0A673I6H5_BAD-01      ----------------------agcggtgccccaggatggagcatcggcg
A0A4W4DXF5_BAD-01      ----------------------cactgagtcccaagatggagtgtcagca
A0A3P8YI30_BAD-01      ----------------------cacagagtttcaggttgcaatgactcct
A0A3P8YI30_BAD-02      ----------------------cacagagtttcaggttgcaatgactcct
A0A6F9BAV3_BAD-01      ----------------------cacagagtttcaggatgtgatgactcct
A0A060W8W7_BAD-01      ----------------------cacagagtttcaggatgtgatgactcct
A0A4W5MZR2_BAD-01      ----------------------cacagagtttcaggatgtgatgactcct
A0A674AVP9_BAD-01      ----------------------cacagagtttcaggatgtgatgactcct
A0A1S3L0Z2_BAD-01      ----------------------cacagagtttcaggatgtgatgactcct
B5XEF1_BAD-01          ----------------------cacagagtttcaggatgtgatgactcct
B5X1T1_BAD-01          ----------------------cacagagtttcaggatgtgatgactcct
A0A673ZHY7_BAD-01      ----------------------cacagagtttcaggatgtgatgactcct
A0A4W5R1T6_BAD-01      ----------------------cacagagtttcaggatgcaatgactcct
A0A060W8P9_BAD-01      ----------------------cacagagtttcaggatgcaataactcct
A0A3B1JLM2_BAD-01      ----------------------caatgagaaccaggatg---gcgcttca
A0A3B4DUY7_BAD-01      ----------------------caatg------aggatg---ggctttta
A0A672V9F8_BAD-01      ----------------------cgcgggcgcggctggggtcagaggggg-
A0A674GQ16_BAD-01      ----------------------cggggggggggcggggggcggcggggac
A7MCM4_BAD-01          ----------------------ggaggacttgctggaaactggagttgca
Q4V925_BAD-02          ----------------------ggaggacttgctggaaactggagttgca
Q4V925_BAD-03          ----------------------ggaggacttgctggaaactggagttgca
Q4V925_BAD-01          ----------------------ggaggacttgctggaaactggagttgca
Q4V925_BAD-04          ----------------------ggaggacttgctggaaactggagttgca
A0A671NP27_BAD-01      ----------------------tgagaacctgctggagactggggcagca
A0A672SAE4_BAD-01      ----------------------tgaggacctgctggagactggggctgca
A0A672SAE4_BAD-02      ----------------------tgaggacctgctggagactggggctgca
A0A673J9C6_BAD-01      ----------------------tgaggacctgctggagactggggcagca
A0A672RGH0_BAD-01      ----------------------tgaggacctgctggagaccggggcagca
A0A671RUV0_BAD-01      ----------------------tgaggacctgctggagaccggggcagca
A0A673HRQ3_BAD-01      ----------------------tgaggacctgctggagaccggggcagca
A0A4W4HE29_BAD-01      ----------------------ggcggagcttcaggactcaggagctgag
A0A3B1IH05_BAD-01      ----------------------agaggctctgcaggagtctggtgctggg
A0A3B4CPH6_BAD-01      ----------------------ggatgcccttcaggaatctggggctgtg
A0A670YRG7_BAD-01      ----------------------cgatgaggt------------ggggg--
A0A670JUY4_BAD-01      --------------------------------------------------
A0A3P8Y761_BAD-01      ----------------------cggggagctccagggttt---ggggcaa
A0A3P8Y761_BAD-02      ----------------------cggggagctccagggttt---ggggcaa
A0A667ZNC6_BAD-01      ----------------------cgaggagctcctggccag---gggggaa
A0A6F9CQZ0_BAD-02      ----------------------tggggagctccagggaag---ggggcca
A0A6F9CA11_BAD-02      ------------------------aggagctccagggtag---tgggcca
A0A4W5JLL9_BAD-01      ------------------------aggagctccagggtag---ggggcca
A0A4W5JLL9_BAD-02      ------------------------aggagctccagggtag---ggggcca
A0A1S3N9Q3_BAD-01      ------------------------aggagctccagggtag---ggggcca
A0A674DKC6_BAD-01      ------------------------aggagctccagggtag---ggggcca
A0A3Q2Y0E4_BAD-01      ----------------------ggaggagttccaggccag---ggtggac
A0A668V3Q4_BAD-01      ----------------------tgaggacctcatggctag---aggggag
I3K7B6_BAD-01          ----------------------tgaggacctcatggctag---aggggag
A0A3P9B2E4_BAD-01      ----------------------tgaggagctcatggctag---aggggag
A0A3Q4GGN3_BAD-01      ----------------------tgaggagctcatggctag---aggggag
A0A3P8QRJ7_BAD-01      ----------------------tgaggagctcatggctag---aggggag
A0A3Q3C680_BAD-01      ----------------------tgaggagctcatggctag---aggggag
A0A3B4GXJ6_BAD-01      ----------------------tgaggagctcatggctag---aggggag
A0A3Q0QNQ2_BAD-01      ----------------------tgaggagctcgtcgtcag---aggggag
A0A3Q0QNQ2_BAD-02      ----------------------tgaggagctcgtcgtcag---aggggag
A0A3Q3WTY4_BAD-01      ----------------------------actgcaggttaa---gggggaa
A0A672JQ68_BAD-01      ----------------------cgaggagctccaggccag---ggccgaa
A0A3P8WI83_BAD-01      ----------------------ggaagccttccagtcctg---gggggag
A0A3P8WI83_BAD-02      ----------------------ggaagccttccagtcctg---gggggag
A0A3Q3FKT9_BAD-03      ----------------------cgaagagctccaggccag---gggggaa
A0A3Q3FKT9_BAD-01      ----------------------cgaagagctccaggccag---gggggaa
A0A3Q3FKT9_BAD-02      ----------------------cgaagagctccaggccag---gggggaa
G3Q8B3_BAD-01          ----------------------agaggagct------------gtggcta
A0A3Q1K1C7_BAD-01      ----------------------cgaagaactccaggccaa---ggcagat
A0A672YF93_BAD-01      ----------------------cgaggagctccagatgag---gggggaa
A0A3Q3RXS8_BAD-01      ----------------------------------tg-----------gat
A0A3Q3R5S3_BAD-01      ----------------------------------tgccaa---gtcagat
H3D8J8_BAD-01          ----------------------cgaggagctccagggcaa---cggggac
A0A674MXC1_BAD-01      ----------------------ggaagagcttcaggggaa---cggggag
A0A674MXC1_BAD-02      ----------------------ggaagagcttcaggggaa---cggggag
A0A674MXC1_BAD-03      ----------------------ggaagagcttcaggggaa---cggggag
A0A674MXC1_BAD-04      ----------------------ggaagagcttcaggggaa---cggggag
A0A3B5BAL2_BAD-01      ----------------------cgaggagctccaggccag---gggggaa
A0A3Q1GWH9_BAD-01      ----------------------tgaggagctccaggcaaa---gggggaa
A0A3Q1CPU7_BAD-01      ----------------------tgaggagctccaggcgag---gggggaa
A0A3P8TWH6_BAD-01      ----------------------tgaggagctccaggcgag---gggggaa
A0A2U9BAC9_BAD-01      ----------------------cgaggagctcctgaccag---gtgggac
A0A671TL42_BAD-01      ----------------------cgtggagctccaggcgag---gggtgaa
A0A665TUH3_BAD-01      ----------------------cgaggatttcctggccag---gggggat
A0A4W6EMZ7_BAD-01      ----------------------cgaggggctccaggtaag---gggggaa
A0A4W6EMZ7_BAD-02      ----------------------cgaggggctccaggtaag---gggggaa
A0A3B4VFC5_BAD-01      ----------------------cgaagagttccaggccag---gggggag
A0A3B4W9T1_BAD-01      ----------------------tgaggagttccaggccag---gggggag
A0A3B3BQF7_BAD-01      ----------------------tgaagacctccc---------gcgggaa
A0A3P9HNZ2_BAD-01      ----------------------tgaggacctcgc---------gcgggaa
A0A3B3HDU2_BAD-01      ----------------------tgaggacctcgc---------gcgggaa
A0A3P9KSL7_BAD-01      ----------------------tgaggacctcgc---------gcgggaa
A0A3P9KSL7_BAD-02      ----------------------tgaggacctcgc---------gcgggaa
A0A3Q3AEL8_BAD-01      ----------------------ggaggagctcccggcgcg---ggcagac
A0A3Q3AEL8_BAD-02      ----------------------ggaggagctcccggcgcg---ggcagac
A0A1A8AQV0_BAD-01      ----------------------tgaggatctcctggccagggtggcggag
A0A3Q2QC80_BAD-01      ----------------------ggaggagctgcagggcag---ggcggag
A0A3Q2D5S0_BAD-01      ----------------------ggagg------aggccag---gggggag
A0A3B5L9R9_BAD-01      ----------------------ggtggagctgcaggccag---gggggaa
A0A3B5Q2N7_BAD-01      ----------------------ggtggagctgcaggcaag---gggggaa
A0A3P9Q7C3_BAD-01      ----------------------ggaggagctgcaggccag---gggggaa
A0A3B3YFR1_BAD-01      ----------------------ggaggagctgcaggccag---gggggaa
A0A087X8P8_BAD-01      ----------------------ggaggagctgcaggccag---gggggaa
A0A3B3UA11_BAD-01      ----------------------ggaggagctgcaggccag---gggggaa
A0A452IFQ4_BAD-01      ---------------------cagaagtgcaggatgagcc---aggtggg
A0A674I2R9_BAD-01      ---------------------cagaagtgcaggatgagcc---aggtggg
A0A3B3QX41_BAD-01      attttggtgaaggaggtgcatctgaggagggcggaggcgt---gtgcccc
A0A5F8GA49_BAD-01      ---------------------cccaggcagagcgggccga---ggcggag
G3VRY3_BAD-01          ---------------------ccgaggcagagcagtccga---gggggag
G3VRY3_BAD-02          ---------------------ccgaggcagagcagtccga---gggggag
G3VRY3_BAD-03          ---------------------ccgaggcagagcagtccga---gggggag
A0A4X2KAA5_BAD-01      ---------------------ccgaggccgacttcttcga---gggggag
A0A6I8NVP2_BAD-01      ---------------------ccga---------------------ggcg
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          ---------------------ccgaggaggatgaagggat------ggag
Q61337_BAD-02          ---------------------ccgaggaggatgaagggat------ggag
Q61337_BAD-05          ---------------------ccgaggaggatgaagggat------ggag
Q61337_BAD-01          ---------------------ccgaggaggatgaagggat------ggag
Q61337_BAD-03          ---------------------ccgaggaggatgaagggat------ggag
Q61337_BAD-04          ---------------------ccgaggaggatgaagggat------ggag
Q61337_BAD-06          ---------------------ccgaggaggatgaagggat------ggag
G1P8C5_BAD-01          ---------------------ccgaggaggatgacgacac---cgaggag
A0A4X1VE31_BAD-01      ---------------------ccgaggaggatgaagggac---tgaggat
A0A287AEF3_BAD-01      ---------------------ccgaggaggatgaagggac---tgaggat
A0A4X1VE31_BAD-02      ---------------------ccgaggaggatgaagggac---tgaggat
A0A4X1VE31_BAD-03      ---------------------ccgaggaggatgaagggac---tgaggat
F7DN67_BAD-01          ---------------------cc---gaggatgaagggat---ggaaggg
M3YNE7_BAD-01          ---------------------ccgaggaagatgaggggat---ggaggaa
A0A673V6P8_BAD-01      ---------------------ccgaggaggatgaagggac---ggaggag
A0A337SAW2_BAD-01      ---------------------ccgaggaggatgaagggac---ggaggag
A0A667H8Z9_BAD-01      ---------------------ccgaggaggatgaagggac---ggaggag
A0A452RJM6_BAD-01      ---------------------ccgaagaggatgaagggtt---ggaggag
A0A384DJL2_BAD-01      ---------------------ccgaagaggatgaagggtt---ggaggag
Q45KI9_BAD-01          ---------------------ccgacgaggatgaaggaat---ggaggaa
A0A3Q7SWS0_BAD-01      ---------------------ccgacgaggatgaaggaat---ggaggaa
A0A4W2C9A8_BAD-01      ---------------------cagaggataatgaagagac---ggaggag
A0A4W2C9A8_BAD-01      ---------------------cagaggataatgaagagac---ggaggag
F1MUT9_BAD-01          ---------------------cagaggataatgaagagac---ggaggag
Q3SYZ0_BAD-01          ---------------------cagaggataatgaagagac---ggaggag
A0A452ER54_BAD-01      ---------------------cagaggatgatgaagggac---ggaggag
A0A452ER54_BAD-02      ---------------------cagaggatgatgaagggac---ggaggag
W5P8G9_BAD-01          ---------------------cagaggatgacgaagggac---ggaggag
A0A4U1FMC3_BAD-01      ---------------------cggaggatgaagaagggac---ggaggag
A0A2Y9EHU3_BAD-01      ---------------------cggaggatgacgaagggac---ggaggag
G3TP47_BAD-01          ---------------------ctgatgaggctgaagggct------ggag
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          ---------------------tggaggaggaggcggggat------gaag
G5B6Q3_BAD-02          ---------------------tggaggaggaggcggggat------gaag
H0V608_BAD-01          ---------------------ctgaggaggaggaagggat------ggag
A0A287CT05_BAD-01      ---------------------ccgatttggatgaagggat------ggaa
A0A287CT05_BAD-02      ---------------------ccgatttggatgaagggat------ggaa
A0A671ELU4_BAD-01      ---------------------ccgaggaagatgaagagat---ggaggag
A0A2J8TYJ3_BAD-01      ---------------------cggaggacgacgaagggat------gggg
A0A2R8Z674_BAD-03      ---------------------cggaggacgacgaagggat------gggg
A0A2I2YFH2_BAD-04      ---------------------cggaggacgacgaagggat------gggg
Q92934_BAD-04          ---------------------cggaggacgacgaagggat------gggg
A0A2I3TBK7_BAD-03      ---------------------cggaggacgacgaagggat------gggg
A0A2K6E7I4_BAD-03      ---------------------cggaggaggacgaagggat------ggag
A0A2K5M0A7_BAD-03      ---------------------cggaggaggacgaagggat------ggag
A0A2K5XJR2_BAD-03      ---------------------cggaggaggacgaagggat------ggag
A0A2K5HKU7_BAD-02      ---------------------cggaggaggacgaagggat------ggag
A0A2K6N196_BAD-02      ---------------------cggaggaggacgaagggat------ggag
A0A2K6PUL3_BAD-02      ---------------------cggaggaggacgaagggat------ggag
H0WVR2_BAD-01          ---------------------cagaggaggatgaagggat---------t
A0A2K5E6A6_BAD-03      ---------------------cggaggaggacgaagggat------ggag
A0A2K6GWV0_BAD-01      ---------------------cagaagaggatgaagggat------ggag
A0A2K5HKU7_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A2K6N196_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A2K6PUL3_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A0D9R491_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A2K5M0A7_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A2K5XJR2_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A2K6E7I4_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A2K5VCA1_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A1D5QBW1_BAD-01      ---------------------cggaggaggacgaagggat------ggag
Q2PG01_BAD-01          --------------------------------------at------ggag
A0A2K5PDB1_BAD-01      ---------------------cggaggaggacgaagggat------ggag
A0A2K6TG62_BAD-01      ---------------------cggagggggacgaagggat------ggag
A0A2K5E6A6_BAD-01      ---------------------cggaggaggacgaagggat------ggag
U3F2S3_BAD-01          ---------------------cggaggaggacgaagggat------ggag
A0A2J8TYJ3_BAD-02      ---------------------cggaggacgacgaagggat------gggg
A0A2J8TYJ3_BAD-03      ---------------------cggaggacgacgaagggat------gggg
A0A2I3H4B2_BAD-01      --------------------------------------at------gggg
B4DZQ9_BAD-01          ---------------------cggaggacgacgaagggat------gggg
A0A2I2YFH2_BAD-01      ---------------------cggaggacgacgaagggat------gggg
A0A2I2YFH2_BAD-02      ---------------------cggaggacgacgaagggat------gggg
A0A2I3TBK7_BAD-02      ---------------------cggaggacgacgaagggat------gggg
A0A2R8Z674_BAD-01      ---------------------cggaggacgacgaagggat------gggg
Q92934_BAD-01          ---------------------cggaggacgacgaagggat------gggg
Q92934_BAD-02          ---------------------cggaggacgacgaagggat------gggg
Q92934_BAD-05          --------------------------------------at------gggg
Q92934_BAD-06          --------------------------------------at------gggg
A0A2K5PDB1_BAD-03      ---------------------cggaggaggacgaagggat------ggag
A0A2K6TG62_BAD-03      ---------------------cggagggggacgaagggat------ggag
                                                                         

C1C3S9_BAD-01          gagagcttcaa-------------------cattt------ccgctcacg
H3ANP3_BAD-03          gatgagcttggc------------------ccttt------caggacaag
H3ANP3_BAD-01          gatgagcttggc------------------ccttt------caggacaag
H3ANP3_BAD-02          gatgagcttggc------------------ccttt------caggacaag
H3ANP3_BAD-04          gatgagcttggc------------------ccttt------caggacaag
E7FBJ6_BAD-01          gaggagaac---------ggagatggacttccatt------caggggtcg
A0A672LB88_BAD-01      gaggagaacggaggaacgggagatggacttccatt------cagaggtcg
A0A671PX91_BAD-01      gaggagaacggaggaacgggagatggacttccatt------cagaggtcg
A0A673J5Q9_BAD-01      gaggagaacggaggaacgggagatggacttccatt------cagaggtcg
A0A672R7P6_BAD-01      gaggagaacggaggaacgggagatggacttccatt------cagaggtcg
A0A671SBB4_BAD-01      gaggagaacggaggaacgggagatggacttccatt------cagaggtcg
A0A673I6H5_BAD-01      gaggagaacggaggaacgggagatgggcttccatt------cagaggtcg
A0A4W4DXF5_BAD-01      gaagagggtggaggagcttgtgaaggagccccatt------ccgtggccg
A0A3P8YI30_BAD-01      acggaggagagtggg---ggcgatgcagcaccgtt------ccggggccg
A0A3P8YI30_BAD-02      acggaggagagtggg---ggcgatgcagcaccgtt------ccggggccg
A0A6F9BAV3_BAD-01      actgaggagggcggg---ggtgatggggcttcatt------ccgagggcg
A0A060W8W7_BAD-01      actgaggatggcggg---ggtgatggggcttcatt------ccgaggccg
A0A4W5MZR2_BAD-01      actgaggagggcgga---ggtgatggggcttcatt------ccgaggccg
A0A674AVP9_BAD-01      actgaggagggtggg---ggtgatggggcttcatt------ccgaggccg
A0A1S3L0Z2_BAD-01      actgaggagggtggg---ggtgatggggcttcatt------ccgaggtcg
B5XEF1_BAD-01          actgaggagggtggg---ggtgatggggcttcatt------ccgaggtcg
B5X1T1_BAD-01          actgaggagggcggt---ggcgatggggctccttt------ccgaagccg
A0A673ZHY7_BAD-01      actgaggagggcggt---ggcgatggggctccttt------ccgaagccg
A0A4W5R1T6_BAD-01      actgaggagggcggg---ggcgatggggctccttt------ccgaagccg
A0A060W8P9_BAD-01      actgaggagggcggg---ggcgatggggctccttt------ccgaagccg
A0A3B1JLM2_BAD-01      gcagaggacggtggtgtcggtgacggagcaccatt------ccgaggccg
A0A3B4DUY7_BAD-01      gcggaggacggtggagcaggggatggagctccatt------ccgaggccg
A0A672V9F8_BAD-01      ----aacgcgg------ccccggggagccccccccgggggtccggggccg
A0A674GQ16_BAD-01      ccccaaatcggggccccccccggggaccccccccc---ggcccgcggccg
A7MCM4_BAD-01          gaagatcctcatatgcttggg------gatccttt------caggccgag
Q4V925_BAD-02          gaagatcctcatatgcttggg------gatccttt------caggccgag
Q4V925_BAD-03          gaagatcctcatatgcttggg------gatccttt------caggccgag
Q4V925_BAD-01          gaagatcctcatatgcttggg------gatccttt------caggccgag
Q4V925_BAD-04          gaagatcctcatatgcttggg------gatccttt------caggccgag
A0A671NP27_BAD-01      gatgaaggcgatttggttggaagt---gatccatt------caggcctag
A0A672SAE4_BAD-01      gatgaaggcgatttggttggaggt---gatccatt------caggcctag
A0A672SAE4_BAD-02      gatgaaggcgatttggttggaggt---gatccatt------caggcctag
A0A673J9C6_BAD-01      gatgaaggtgatttggttggaggt---gatccatt------caggcctag
A0A672RGH0_BAD-01      gatgaaggcgatttggttggaggt---gatccttt------caggcctag
A0A671RUV0_BAD-01      gatgaaggcgatttggttggaggt---gatccttt------caggcctag
A0A673HRQ3_BAD-01      gatgaaggcgatttggttggaggt---gatccttt------caggcctag
A0A4W4HE29_BAD-01      ------------------------------tcttt------ccgtcgtcg
A0A3B1IH05_BAD-01      agacacgaagatggagctcgagatggagattcatt------ccgacgccg
A0A3B4CPH6_BAD-01      agacatggagatggagctgcagatggagactcttt------ccgccgtcg
A0A670YRG7_BAD-01      -------------------------------cttt------ccgggcccg
A0A670JUY4_BAD-01      ------------------------------acttt------ccgggcacg
A0A3P8Y761_BAD-01      gggttgaactgtgtggccacagaaggactaccttt------tagggtccg
A0A3P8Y761_BAD-02      gggttgaactgtgtggccacagaaggactaccttt------tagggtccg
A0A667ZNC6_BAD-01      ggagaggatggt---------gacggagctccttt------ccggggtcg
A0A6F9CQZ0_BAD-02      ggggtggacggcattcccacagatggagcaccttt------tcgggttcg
A0A6F9CA11_BAD-02      ggggtggacggcgtgcccacagacggagcatcttt------ccgggttcg
A0A4W5JLL9_BAD-01      ggggtggaaggcatgcccacagacggagcatcttt------ccgggttcg
A0A4W5JLL9_BAD-02      ggggtggaaggcatgcccacagacggagcatcttt------ccgggttcg
A0A1S3N9Q3_BAD-01      ggggtggaaggcatgcccacagatggagcatcttt------ccggggtcg
A0A674DKC6_BAD-01      ggggtggaaggcgtgcccacagacggagcatcttt------ccggggtcg
A0A3Q2Y0E4_BAD-01      gaggaggtcggcacacccaccgacggggcgccgtt------ccgggggcg
A0A668V3Q4_BAD-01      gatgaggtctgtactcccacagagggagacccatt------caggcgaag
I3K7B6_BAD-01          gatgaggtctgtactcccacagagggagacccatt------caggcgaag
A0A3P9B2E4_BAD-01      gatgaggtctgtactcccacagagggagacccatt------caggcgaag
A0A3Q4GGN3_BAD-01      gatgaggtctgtactcccacagagggagacccatt------caggcgaag
A0A3P8QRJ7_BAD-01      gatgaggtctgtactcccacagagggagacccatt------caggcgaag
A0A3Q3C680_BAD-01      gatgaggtctgtactcccacagagggagacccatt------caggcgaag
A0A3B4GXJ6_BAD-01      gatgaggtttgtactcccacagagggagacccatt------caggcgaag
A0A3Q0QNQ2_BAD-01      gacgagatctgtactcccacagagggagatccatt------caggcgaag
A0A3Q0QNQ2_BAD-02      gacgagatctgtactcccacagagggagatccatt------caggcgaag
A0A3Q3WTY4_BAD-01      gacgaggctgggacgcccaccgatggagctccgtt------caggggcag
A0A672JQ68_BAD-01      gaggaggtgggcacacccacagagggcgctccgtt------cagggggcg
A0A3P8WI83_BAD-01      gaagaagccggaacgcccacagaaggagctccttt------caggggacg
A0A3P8WI83_BAD-02      gaagaagccggaacgcccacagaaggagctccttt------caggggacg
A0A3Q3FKT9_BAD-03      gaagaggctggcacccccacggaaggagcgccatt------caggggacg
A0A3Q3FKT9_BAD-01      gaagaggctggcacccccacggaaggagcgccatt------caggggacg
A0A3Q3FKT9_BAD-02      gaagaggctggcacccccacggaaggagcgccatt------caggggacg
G3Q8B3_BAD-01          gacgagaccgggacgcccactgagggggctccatt------ccgggtacg
A0A3Q1K1C7_BAD-01      gaggaagctggtacgcccacagatggagctccatt------cagggcacg
A0A672YF93_BAD-01      gatgaagccagcactcccacggaaggagccccatt------cagggcacg
A0A3Q3RXS8_BAD-01      gaggaggctggtacgcccacagacggagctccatt------taggggaag
A0A3Q3R5S3_BAD-01      gaggaggctggtacacccacagacggagctccatt------ccggggacg
H3D8J8_BAD-01          gacgaggccgggacgcccaccgacggagccccgtt------cagggggag
A0A674MXC1_BAD-01      gatgaggccgggacgcccacggaaggagccccgtt------cagaggaag
A0A674MXC1_BAD-02      gatgaggccgggacgcccacggaaggagccccgtt------cagaggaag
A0A674MXC1_BAD-03      gatgaggccgggacgcccacggaaggagccccgtt------cagaggaag
A0A674MXC1_BAD-04      gatgaggccgggacgcccacggaaggagccccgtt------cagaggaag
A0A3B5BAL2_BAD-01      gaggaggccggcacgcccactgacggagctccgtt------caggggacg
A0A3Q1GWH9_BAD-01      gaggaagccggcacgcccacagagggagctccgtt------cagggcacg
A0A3Q1CPU7_BAD-01      gaggaagccggcacgcccacagacggagctccgtt------cagggcacg
A0A3P8TWH6_BAD-01      gaggaagccggcacgcccacagacggagctccgtt------cagggcacg
A0A2U9BAC9_BAD-01      gaggaagccggtacgcccaccgacggagctccatt------ccgggggag
A0A671TL42_BAD-01      gacgaggctggaacgcccaccgacggagcgccgtt------cagggggcg
A0A665TUH3_BAD-01      gacgaagccggtacacctactgatggagctccatt------ccggggacg
A0A4W6EMZ7_BAD-01      gaggaagccgggacgcccaccgagggagctccatt------ccggggacg
A0A4W6EMZ7_BAD-02      gaggaagccgggacgcccaccgagggagctccatt------ccggggacg
A0A3B4VFC5_BAD-01      gaggaagccggcacgcccaccgaaggagctccatt------caggggacg
A0A3B4W9T1_BAD-01      gaggaagccggcacgcccaccgaaggagctccatt------caggggacg
A0A3B3BQF7_BAD-01      gacgaggctggaacccccaccgacgggttggcctt------caggggccg
A0A3P9HNZ2_BAD-01      gacgaggccggaacccccactgatgggttggcctt------caggggcag
A0A3B3HDU2_BAD-01      gacgaggccggaacccccactgatgggttggcctt------caggggcag
A0A3P9KSL7_BAD-01      gacgaggccggaacccccactgatgggttggcctt------caggggcag
A0A3P9KSL7_BAD-02      gacgaggccggaacccccactgatgggttggcctt------caggggcag
A0A3Q3AEL8_BAD-01      gacgagcccgggacccccaccgaggggtatccgtt------cagggggcg
A0A3Q3AEL8_BAD-02      gacgagcccgggacccccaccgaggggtatccgtt------cagggggcg
A0A1A8AQV0_BAD-01      gaggagcctgggacccctacagaggggttcccatt------cagagggag
A0A3Q2QC80_BAD-01      gaggaggccgggacccccaccgaggggcttccatt------caggaaccg
A0A3Q2D5S0_BAD-01      gaggaggtcgggacccccactgagggctatccatt------caggggccg
A0A3B5L9R9_BAD-01      gaggaggtcgggacccccactgagggctttccatt------caggggccg
A0A3B5Q2N7_BAD-01      gaggaggttgggacccccactgagggctttccatt------caggggccg
A0A3P9Q7C3_BAD-01      gaggaggtcgggaccccaactgagggctttccatt------cagggtccg
A0A3B3YFR1_BAD-01      gaggaggtcgggacccccactgagggctttccatt------caggggccg
A0A087X8P8_BAD-01      gaggaagtcgggacccccactgagggctttccatt------caggggccg
A0A3B3UA11_BAD-01      gaggaagtcgggacccccactgagggctttccatt------caggggccg
A0A452IFQ4_BAD-01      g------------------------------catt------ccgggcacg
A0A674I2R9_BAD-01      g------------------------------catt------ccgggcacg
A0A3B3QX41_BAD-01      ggggatggcact------------------ccttt------tcgaggacg
A0A5F8GA49_BAD-01      gaggaccggggc------------------ctgtt------ccggagccg
G3VRY3_BAD-01          gaagagcgcggc------------------ctctt------ccggggccg
G3VRY3_BAD-02          gaagagcgcggc------------------ctctt------ccggggccg
G3VRY3_BAD-03          gaagagcgcggc------------------ctctt------ccggggccg
A0A4X2KAA5_BAD-01      gaggaacgcagc------------------ctgtt------ccggagccg
A0A6I8NVP2_BAD-01      gaggaacacagc------------------ccgtt------taggggtcg
Q61337_BAD-09          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------aggttc
Q61337_BAD-07          gaggagcttagc------------------ccttt------tcgaggacg
Q61337_BAD-02          gaggagcttagc------------------ccttt------tcgaggacg
Q61337_BAD-05          gaggagcttagc------------------ccttt------tcgaggacg
Q61337_BAD-01          gaggagcttagc------------------ccttt------tcgaggacg
Q61337_BAD-03          gaggagcttagc------------------ccttt------tcgaggacg
Q61337_BAD-04          gaggagcttagc------------------ccttt------tcgaggacg
Q61337_BAD-06          gaggagcttagc------------------ccttt------tcgaggacg
G1P8C5_BAD-01          ggggagcccagc------------------ccctt------ccgcggccg
A0A4X1VE31_BAD-01      gaggagctcagc------------------ccctt------ccgcggccg
A0A287AEF3_BAD-01      gaggagctcagc------------------ccctt------ccgcggccg
A0A4X1VE31_BAD-02      gaggagctcagc------------------ccctt------ccgcggccg
A0A4X1VE31_BAD-03      gaggagctcagc------------------ccctt------ccgcggccg
F7DN67_BAD-01          gaggagcccggc------------------ccctt------ccggggccg
M3YNE7_BAD-01          gaagagcttagc------------------ccttt------ccgggggcg
A0A673V6P8_BAD-01      gaagagcccagc------------------ccttt------ccggggtcg
A0A337SAW2_BAD-01      gaagagcccagc------------------ccttt------ccggggtcg
A0A667H8Z9_BAD-01      gaagagcctagc------------------ccttt------ccggggtcg
A0A452RJM6_BAD-01      gaagagctcagc------------------ccttt------ccgggggcg
A0A384DJL2_BAD-01      gaagagctcagc------------------ccttt------ccgggggcg
Q45KI9_BAD-01          gaagagctcagc------------------ccttt------ccgggggcg
A0A3Q7SWS0_BAD-01      gaagagctcagc------------------ccttt------ccgggggcg
A0A4W2C9A8_BAD-01      gaggatctcggc------------------ccctt------taggggccg
A0A4W2C9A8_BAD-01      gaggatctcggc------------------ccctt------taggggccg
F1MUT9_BAD-01          gaggatctcggc------------------ccctt------taggggccg
Q3SYZ0_BAD-01          gaggatctcggc------------------ccctt------taggggccg
A0A452ER54_BAD-01      gaggatctcggc------------------ccctt------taggggccg
A0A452ER54_BAD-02      gaggatctcggc------------------ccctt------taggggccg
W5P8G9_BAD-01          gaggatctcggc------------------ccctt------taggggccg
A0A4U1FMC3_BAD-01      gaggagcccagc------------------ccctt------ccggggccg
A0A2Y9EHU3_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
G3TP47_BAD-01          gaggatcccagc------------------ccctt------tcggggtcg
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          gaggagcccagt------------------ccatt------ccggggccg
G5B6Q3_BAD-02          gaggagcccagt------------------ccatt------ccggggccg
H0V608_BAD-01          gaggagctcagt------------------ccatt------ccggggccg
A0A287CT05_BAD-01      gaggagcccagc------------------ccctt------ccgcggccg
A0A287CT05_BAD-02      gaggagcccagc------------------ccctt------ccgcggccg
A0A671ELU4_BAD-01      gaggagcccagc------------------ccctt------ccggggccg
A0A2J8TYJ3_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A2R8Z674_BAD-03      gaggagcccagc------------------ccctt------tcggggccg
A0A2I2YFH2_BAD-04      gaggagcccagc------------------ccctt------tcggggccg
Q92934_BAD-04          gaggagcccagc------------------ccctt------tcggggccg
A0A2I3TBK7_BAD-03      gaggagcccagc------------------ccctt------tcggggccg
A0A2K6E7I4_BAD-03      gaggagcccagc------------------ccctt------tcggggccg
A0A2K5M0A7_BAD-03      gaggagcccagc------------------ccctt------tcggggccg
A0A2K5XJR2_BAD-03      gaggagcccagc------------------ccctt------tcggggccg
A0A2K5HKU7_BAD-02      gaggagcccagc------------------ccctt------tcggggccg
A0A2K6N196_BAD-02      gaggagcccagc------------------ccctt------tcggggccg
A0A2K6PUL3_BAD-02      gaggagcccagc------------------ccctt------tcggggccg
H0WVR2_BAD-01          gaagagcccagc------------------ccctt------ccggggccg
A0A2K5E6A6_BAD-03      gaggagcccagc------------------ccctt------tcggggccg
A0A2K6GWV0_BAD-01      gaagagcccagc------------------ccctt------ccggggccg
A0A2K5HKU7_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A2K6N196_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A2K6PUL3_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A0D9R491_BAD-01      gaggagcccagc------------------ccctt------ccggggccg
A0A2K5M0A7_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A2K5XJR2_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A2K6E7I4_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A2K5VCA1_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A1D5QBW1_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
Q2PG01_BAD-01          gaggagcccagc------------------ccctt------tcggggccg
A0A2K5PDB1_BAD-01      gaggagcccagc------------------acctt------tcggggccg
A0A2K6TG62_BAD-01      gaggagcccagc------------------ccttt------tcggggccg
A0A2K5E6A6_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
U3F2S3_BAD-01          gaggagcccagc------------------ccctt------tcggggccg
A0A2J8TYJ3_BAD-02      gaggagcccagc------------------ccctt------tcggggccg
A0A2J8TYJ3_BAD-03      gaggagcccagc------------------ccctt------tcggggccg
A0A2I3H4B2_BAD-01      gaggagcccagc------------------ccttt------tcgcggccg
B4DZQ9_BAD-01          gaggagcccagc------------------ccctt------tcggggccg
A0A2I2YFH2_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
A0A2I2YFH2_BAD-02      gaggagcccagc------------------ccctt------tcggggccg
A0A2I3TBK7_BAD-02      gaggagcccagc------------------ccctt------tcggggccg
A0A2R8Z674_BAD-01      gaggagcccagc------------------ccctt------tcggggccg
Q92934_BAD-01          gaggagcccagc------------------ccctt------tcggggccg
Q92934_BAD-02          gaggagcccagc------------------ccctt------tcggggccg
Q92934_BAD-05          gaggagcccagc------------------ccctt------tcggggccg
Q92934_BAD-06          gaggagcccagc------------------ccctt------tcggggccg
A0A2K5PDB1_BAD-03      gaggagcccagc------------------acctt------tcggggccg
A0A2K6TG62_BAD-03      gaggagcccagc------------------ccttt------tcggggccg
                                                                         

C1C3S9_BAD-01          ttcccgctctgctccatcttctctaatggttgcagctcgatatggacgag
H3ANP3_BAD-03          gtctcgttccgcaccacctaacttctgggccgcaaggaagtacgggcaag
H3ANP3_BAD-01          gtctcgttccgcaccacctaacttctgggccgcaaggaagtacgggcaag
H3ANP3_BAD-02          gtctcgttccgcaccacctaacttctgggccgcaaggaagtacgggcaag
H3ANP3_BAD-04          gtctcgttccgcaccacctaacttctgggccgcaaggaagtacgggcaag
E7FBJ6_BAD-01          ttctcaatcagcacctgctgcactgtggaaagcaaaaaagtatggccgtc
A0A672LB88_BAD-01      ttctcagtctgctcctgctgctctgtggaaagcaaagaagtacgggcgac
A0A671PX91_BAD-01      ttctcaatctgctcctgctgcgctgtggaaagcaaagaagtacgggcgac
A0A673J5Q9_BAD-01      ttctcaatctgctcctgctgtgctgtggaaagcgaagaagtacgggcgac
A0A672R7P6_BAD-01      ttctcagtctgctcctgctgcgctgtggaaagcaaagaagtacggacggc
A0A671SBB4_BAD-01      ttctcaatctgctcctgctgcgctgtggaaagcaaagaagtacggacggc
A0A673I6H5_BAD-01      ttctcaatctgctcctgctgcgctgtggaaagcaaagaagtacggacggc
A0A4W4DXF5_BAD-01      atcccagtctgctcctgctgcactatggaaagccaagaaatatggacggc
A0A3P8YI30_BAD-01      gtcacagtctgctccccctgcgctgtgggctgcaaaaaaatatggctgcc
A0A3P8YI30_BAD-02      gtcacagtctgctccccctgcgctgtgggctgcaaaaaaatatggctgcc
A0A6F9BAV3_BAD-01      atcacagtctgctcctcctgcactgtgggctgcaaagaaatatggttgcc
A0A060W8W7_BAD-01      atcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgcc
A0A4W5MZR2_BAD-01      atcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgcc
A0A674AVP9_BAD-01      atcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgcc
A0A1S3L0Z2_BAD-01      atcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgcc
B5XEF1_BAD-01          atcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgcc
B5X1T1_BAD-01          atcacagtctgctcctcctacactgtgggctgcaaagaaatatggccgcc
A0A673ZHY7_BAD-01      atcacagtctgctcctccgacactgtgggctgcaaagaaatatggccgcc
A0A4W5R1T6_BAD-01      atcacagtctgctcctcctgcactgtgggctgcaaagaaatatggccgcc
A0A060W8P9_BAD-01      atcacagtctgctcctcctacactgtgggctgcaaagaaatatggccgcc
A0A3B1JLM2_BAD-01      atcccagtcagctcctgctgcgctatggaaagccaagaaatatggacggc
A0A3B4DUY7_BAD-01      atcccagtcggctcctgctgcactgtggaaagccaagaaatatgggcggc
A0A672V9F8_BAD-01      gtcgcgctccgccccccccgcgctctgggcggcgcgaaggttcgggcggc
A0A674GQ16_BAD-01      ctcccgctccgccccccccgtgctctgggcagcgcagcgctacgggcggc
A7MCM4_BAD-01          atcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaac
Q4V925_BAD-02          atcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaac
Q4V925_BAD-03          atcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaac
Q4V925_BAD-01          atcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaac
Q4V925_BAD-04          atcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaac
A0A671NP27_BAD-01      atctcgctcggctcctcctgctttgtgggcagctaagaaatatggtcgac
A0A672SAE4_BAD-01      atctcgctcggctcctcctgctttgtgggcagctaagaaatatggtcgac
A0A672SAE4_BAD-02      atctcgctcggctcctcctgctttgtgggcagctaagaaatatggtcgac
A0A673J9C6_BAD-01      atctcgctcggctcctcctgctttgtgggcagctaagaaatatggtcgac
A0A672RGH0_BAD-01      atcccgctcggctcctcctgctttgtgggcagctaagaaatatggccaac
A0A671RUV0_BAD-01      atctcgctcggctcctcctgctttgtgggcagctaagaaatatggccaac
A0A673HRQ3_BAD-01      atctcgctcggctcctcctgctttgtgggcagctaagaaatatggccaac
A0A4W4HE29_BAD-01      ttcccgttcagctcccccaattctgtgggcagccaagaaatatggcagac
A0A3B1IH05_BAD-01      cagccgctcagctcccccttctctgtgggcagccaagaaatatggccgac
A0A3B4CPH6_BAD-01      ctgtcgctcggctccccctgctctgtgggcagcaaagaaatatggcagac
A0A670YRG7_BAD-01      ctcacgctctgcccctcccattttgtgggccgcgcaacgatacggccgag
A0A670JUY4_BAD-01      ctcacgctctgcccctcccatcctgtgggcagcccagcggtatgggaggg
A0A3P8Y761_BAD-01      ctcccagtcagcccccccggccctctgggctgccaagagatatggacggc
A0A3P8Y761_BAD-02      ctcccagtcagcccccccggccctctgggctgccaagagatatggacggc
A0A667ZNC6_BAD-01      ctcccagtcggcgccccctgccctctgggcggccaagaaatatggccgtc
A0A6F9CQZ0_BAD-02      ctcccagtcggccccccctgccctctgggcggctaagagatacggacggc
A0A6F9CA11_BAD-02      ctcccagtcggccccccctgccctctgggcggccaagaaatatggacggc
A0A4W5JLL9_BAD-01      ctcccagtcggccccccctgccctctgggcggccaagaaatacgggcggc
A0A4W5JLL9_BAD-02      ctcccagtcggccccccctgccctctgggcggccaagaaatacgggcggc
A0A1S3N9Q3_BAD-01      ctcccagtcggccccccctgccctctgggcggccaagagatacgggcggc
A0A674DKC6_BAD-01      ctcccagtcggccccccctgccctctgggcagccaagagatatgggcggc
A0A3Q2Y0E4_BAD-01      ctccaagtcggctccccccgtgctatgggctgcgaaaaagtacggacggc
A0A668V3Q4_BAD-01      gtcaaagtcagctccccctgctctgtgggctgccaagaagtacggccaga
I3K7B6_BAD-01          gtcaaagtcagctccccctgctctgtgggctgccaagaagtacggccaga
A0A3P9B2E4_BAD-01      gtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggc
A0A3Q4GGN3_BAD-01      gtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggc
A0A3P8QRJ7_BAD-01      gtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggc
A0A3Q3C680_BAD-01      gtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggc
A0A3B4GXJ6_BAD-01      gtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggc
A0A3Q0QNQ2_BAD-01      gtcaaagtccgcaccccctgctctgtgggctgccaagaagtacggccagc
A0A3Q0QNQ2_BAD-02      gtcaaagtccgcaccccctgctctgtgggctgccaagaagtacggccagc
A0A3Q3WTY4_BAD-01      gtccaaatctgctcccccttctttgtgggcagccaagaaatatggacaga
A0A672JQ68_BAD-01      gtcaaagtcggctcccccggccctgtgggccgccaagaagtacggccaga
A0A3P8WI83_BAD-01      gtccaggtcagctcctcctgccctgtgggcagcaaagaagtatggcaggc
A0A3P8WI83_BAD-02      gtccaggtcagctcctcctgccctgtgggcagcaaagaagtatggcaggc
A0A3Q3FKT9_BAD-03      atcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccggc
A0A3Q3FKT9_BAD-01      atcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccggc
A0A3Q3FKT9_BAD-02      atcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccggc
G3Q8B3_BAD-01          ttccaagtcggctcccccggctctgtgggcagccaagaaatacggacggc
A0A3Q1K1C7_BAD-01      gtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagc
A0A672YF93_BAD-01      gtccaagtcggctccccccgccttgtgggcagccaagaaatacggccagc
A0A3Q3RXS8_BAD-01      gtccaagtcagctccccctgctctgtgggcagccaagaaatatggccagc
A0A3Q3R5S3_BAD-01      gtccaagtcagctccccctgctctgtgggcagcaaagaaatatggccggc
H3D8J8_BAD-01          gtccagatcggctccccccgccttgtgggctgccaagaaatacggccggc
A0A674MXC1_BAD-01      gtccaggtcagcgcctcccgccttgtgggccgcgcagagatacggccggc
A0A674MXC1_BAD-02      gtccaggtcagcgcctcccgccttgtgggccgcgcagagatacggccggc
A0A674MXC1_BAD-03      gtccaggtcagcgcctcccgccttgtgggccgcgcagagatacggccggc
A0A674MXC1_BAD-04      gtccaggtcagcgcctcccgccttgtgggccgcgcagagatacggccggc
A0A3B5BAL2_BAD-01      gtctaagtcggctccacctgcactgtgggccgccaagaagtacggccaga
A0A3Q1GWH9_BAD-01      gtctaagtcggctccccctgcgctgtgggccgccaagaagtacggccagc
A0A3Q1CPU7_BAD-01      gtccaagtcggctccccctgcactgtgggccgccaagaagtacggccagc
A0A3P8TWH6_BAD-01      gtccaagtcggctccccctgcactgtgggccgccaagaagtacggccagc
A0A2U9BAC9_BAD-01      gtccaagtcggctcctcctgcgctgtgggcggccatgaaatacggccaga
A0A671TL42_BAD-01      gtccaagtcggctccccctgccttgtgggcggccaagaaatacggccggc
A0A665TUH3_BAD-01      gtccaagtcagctcctcctgccctgtgggcggccaagaaatatggccaga
A0A4W6EMZ7_BAD-01      gtccaagtcagctccccctgcgttgtgggcagctaagaaatacggacaga
A0A4W6EMZ7_BAD-02      gtccaagtcagctccccctgcgttgtgggcagctaagaaatacggacaga
A0A3B4VFC5_BAD-01      gtccaagtcagctccccctgcactgtgggcggccaagaaatacggccaga
A0A3B4W9T1_BAD-01      gtccaagtcagctccccctgcactgtgggcggcgaagaaatacggccaga
A0A3B3BQF7_BAD-01      atccaagtcagcccctccggccttgtgggccgccaagaagtacggccagc
A0A3P9HNZ2_BAD-01      atctaagtcggcccctccggccctgtgggccgccaaaaagtacggccagc
A0A3B3HDU2_BAD-01      atccaagtcggcccctccggctctgtgggccgccaaaaagtacggtcagc
A0A3P9KSL7_BAD-01      atccaagtcggcccctccggccctgtgggccgccaaaaagtacggccagc
A0A3P9KSL7_BAD-02      atccaagtcggcccctccggccctgtgggccgccaaaaagtacggccagc
A0A3Q3AEL8_BAD-01      atccaagtcggcccctccagccctgtgggccgccaagaagtacggccggc
A0A3Q3AEL8_BAD-02      atccaagtcggcccctccagccctgtgggccgccaagaagtacggccggc
A0A1A8AQV0_BAD-01      atcaaagtctgctcctccagccctgtgggccgccaagaagtacggccggc
A0A3Q2QC80_BAD-01      ctccaattcggctcctccggcgctgtgggcagccaagaagtacgggcggc
A0A3Q2D5S0_BAD-01      atctaattcagctcctccagctctgtgggctgccaagaagtacggccggc
A0A3B5L9R9_BAD-01      atctttatcagctcctccctccctgtgggctgccaagaagtacggccggc
A0A3B5Q2N7_BAD-01      atctttatcagctcctccctccttgtgggctgccaagaagtacggccggc
A0A3P9Q7C3_BAD-01      gtctaattcagctcccccctccctgtgggccgccaagaagtacggccggc
A0A3B3YFR1_BAD-01      atctaattcagctcccccctccctgtgggccgccaagaagtatggccggc
A0A087X8P8_BAD-01      atctaattcagctcccccctccctgtgggccgccaagaagtatggccggc
A0A3B3UA11_BAD-01      atctaattcagctcccccctccctgtgggccgccaagaagtacggccggc
A0A452IFQ4_BAD-01      ttcacgctcagcaccccccatcctttgggctgctatgcgttatgggcggg
A0A674I2R9_BAD-01      ctcccgctcagccccccctatcctttgggctgccatgcgttacgggcggg
A0A3B3QX41_BAD-01      ctcgcggtcagccccgcccgcgctgtgggcagcacagcggtatggacgac
A0A5F8GA49_BAD-01      ctccagctctgcaccccctatcctctgggccgcgcggcgatatggcagcg
G3VRY3_BAD-01          ctccagctcagcgccccctatcctctgggcggcgcggcattatggcagcg
G3VRY3_BAD-02          ctccagctcagcgccccctatcctctgggcggcgcggcattatggcagcg
G3VRY3_BAD-03          ctccagctcagcgccccctatcctctgggcggcgcggcattatggcagcg
A0A4X2KAA5_BAD-01      ctccagctcagcgcctcctatcctctgggctgcgcggcgttatggcagcg
A0A6I8NVP2_BAD-01      ctcgcactcggcaccccccatcctctgggtcgcccagcgttacggccgcg
Q61337_BAD-09          ---------------------------ggcagcgcagcgctacggccgtg
Q6P7C5_BAD-01          ctcacttccatcattttcctgtc----------------------ccatg
Q61337_BAD-07          ctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtg
Q61337_BAD-02          ctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtg
Q61337_BAD-05          ctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtg
Q61337_BAD-01          ctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtg
Q61337_BAD-03          ctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtg
Q61337_BAD-04          ctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtg
Q61337_BAD-06          ctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtg
G1P8C5_BAD-01          ctcgcgttcagcgcccccaaacctctgggcagcacagcgctacggccgcg
A0A4X1VE31_BAD-01      atcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcg
A0A287AEF3_BAD-01      atcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcg
A0A4X1VE31_BAD-02      atcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcg
A0A4X1VE31_BAD-03      atcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcg
F7DN67_BAD-01          ctcgcgctcggcgccccccaacctctgggctgcacgacgctacggccgcg
M3YNE7_BAD-01          ctcgcggtcagcgccccccaacctctgtgcggcactgcgttacggccgcg
A0A673V6P8_BAD-01      ctcacgctcggcgccccccaacctctgtgctgcactgcgctacggccgtg
A0A337SAW2_BAD-01      ctcgcgctcagcgccccccaacctctgggctgccctgcgctacggccgcg
A0A667H8Z9_BAD-01      ctcgcgctcagcgccccccaacctctgggctgccctgcgctacggccgcg
A0A452RJM6_BAD-01      ctcgagctcagcgccccccaacctctgtgctgcactgcgctatggccgcg
A0A384DJL2_BAD-01      ctcgagctcagcgccccccaacctctgtgctgcactgcgctatggccgcg
Q45KI9_BAD-01          ctcgagctcagcgccccccaacctctgcgcggcacggcgctacggccgcg
A0A3Q7SWS0_BAD-01      ctcgagctcagcgccccccaacctctgcgcagcactgcgctatggccgcg
A0A4W2C9A8_BAD-01      ctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcg
A0A4W2C9A8_BAD-01      ctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcg
F1MUT9_BAD-01          ctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcg
Q3SYZ0_BAD-01          ctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcg
A0A452ER54_BAD-01      ctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcg
A0A452ER54_BAD-02      ctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcg
W5P8G9_BAD-01          ctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcg
A0A4U1FMC3_BAD-01      ctcgcgctcggcgccccccaacctctgggctgcacggcgatatggccgcg
A0A2Y9EHU3_BAD-01      ctcgcgctcggcaccccccaacctctgggctgcacagcgatatggccgcg
G3TP47_BAD-01          ctcgctttcagcgccccccaacctctgggctgcacagagatatggccgtg
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          ctcacgctcagcgcctcccaatctctgggctgcacagcgctatggcagag
G5B6Q3_BAD-02          ctcacgctcagcgcctcccaatctctgggctgcacagcgctatggcagag
H0V608_BAD-01          ctcgcgctcggcgccacccaacctctgggctgcacagcgctacggccgag
A0A287CT05_BAD-01      ctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcg
A0A287CT05_BAD-02      ctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcg
A0A671ELU4_BAD-01      ctcgcgctcagcgccccccaacctctgggctgcacagcgctatggccgag
A0A2J8TYJ3_BAD-01      ttcgcgctcggcgccccccaatctctgggcagcacagcgctatggccgcg
A0A2R8Z674_BAD-03      ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
A0A2I2YFH2_BAD-04      ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
Q92934_BAD-04          ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
A0A2I3TBK7_BAD-03      ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
A0A2K6E7I4_BAD-03      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A2K5M0A7_BAD-03      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A2K5XJR2_BAD-03      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A2K5HKU7_BAD-02      ctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcg
A0A2K6N196_BAD-02      ctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcg
A0A2K6PUL3_BAD-02      ctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcg
H0WVR2_BAD-01          ctcacgctcggcgccccccaacctctgggctgcacagcgctatggccgcg
A0A2K5E6A6_BAD-03      ttcgcgctcagcaccccccaacctctgggcagcacagcgctatggccgcg
A0A2K6GWV0_BAD-01      ctcacgctcggcgccccccaacctctgggctgcacagcgctatggccgcg
A0A2K5HKU7_BAD-01      ctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcg
A0A2K6N196_BAD-01      ctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcg
A0A2K6PUL3_BAD-01      ctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcg
A0A0D9R491_BAD-01      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A2K5M0A7_BAD-01      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A2K5XJR2_BAD-01      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A2K6E7I4_BAD-01      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A2K5VCA1_BAD-01      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A1D5QBW1_BAD-01      ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
Q2PG01_BAD-01          ctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcg
A0A2K5PDB1_BAD-01      ttcgcgctcggcaccccccaacctctgggcagcacagcgctatggccgcg
A0A2K6TG62_BAD-01      ttcgcgctcggcaccccccaacctctgggcagcacagcgatatggccgcg
A0A2K5E6A6_BAD-01      ttcgcgctcagcaccccccaacctctgggcagcacagcgctatggccgcg
U3F2S3_BAD-01          ttcgcgctcggcaccccccaacctctgggcagcacagcgctatggccgcg
A0A2J8TYJ3_BAD-02      ttcgcgctcggcgccccccaatctctgggcagcacagcgctatggccgcg
A0A2J8TYJ3_BAD-03      ttcgcgctcggcgccccccaatctctgggcagcacagcgctatggccgcg
A0A2I3H4B2_BAD-01      ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
B4DZQ9_BAD-01          ttcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
A0A2I2YFH2_BAD-01      ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
A0A2I2YFH2_BAD-02      ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
A0A2I3TBK7_BAD-02      ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
A0A2R8Z674_BAD-01      ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
Q92934_BAD-01          ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
Q92934_BAD-02          ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
Q92934_BAD-05          ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
Q92934_BAD-06          ctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcg
A0A2K5PDB1_BAD-03      ttcgcgctcggcaccccccaacctctgggcagcacagcgctatggccgcg
A0A2K6TG62_BAD-03      ttcgcgctcggcaccccccaacctctgggcagcacagcgatatggccgcg
                                                                         

C1C3S9_BAD-01          agctgaggcgaatgagtgatgaattcgaccaaatctt-------------
H3ANP3_BAD-03          aactgcggagaatgagcgatgaattcgacatgtcctt-------------
H3ANP3_BAD-01          aactgcggagaatgagcgatgaattcgacatgtcctt-------------
H3ANP3_BAD-02          aactgcggagaatgagcgatgaattcgacatgtcctt-------------
H3ANP3_BAD-04          aactgcggagaatgagcgatgaattcgacatgtcctt-------------
E7FBJ6_BAD-01          agttgaggagaatgagcgatgaattcgacacatggctcgataa-------
A0A672LB88_BAD-01      agctgaggagaatgagcgatgaatttgacacatggctcgacaa-------
A0A671PX91_BAD-01      agctgaggagaatgagcgatgaatttgacacatggctcgacaa-------
A0A673J5Q9_BAD-01      agctgaggagaatgagcgatgaatttgacacatggctcgacaa-------
A0A672R7P6_BAD-01      agctgaggagaatgagcgatgaatttgacacatggcttgacaa-------
A0A671SBB4_BAD-01      agctgaggagaatgagcgatgaatttgacacatggcttgacaa-------
A0A673I6H5_BAD-01      agctgaggagaatgagcgatgaatttgacacatggcttgacaa-------
A0A4W4DXF5_BAD-01      aactgaggaggatgagcgatgagtttgacacctggctggacaa-------
A0A3P8YI30_BAD-01      agctgaggaggatgagtgatgaatttgacacctggcttgacaa-------
A0A3P8YI30_BAD-02      agctgaggaggatgagtgatgaatttgacacctggcttgacaa-------
A0A6F9BAV3_BAD-01      agctgaggaggatgagtgatgaatttgacacctggctcgacaa-------
A0A060W8W7_BAD-01      agctgaggaggatgagtgatgaatttgacacctggctcgacaa-------
A0A4W5MZR2_BAD-01      agctgaggaggatgagtgatgaatttgacacctggcttgacaa-------
A0A674AVP9_BAD-01      agctgaggaggatgagtgatgaatttgacacctggctcgacaa-------
A0A1S3L0Z2_BAD-01      agctgaggaggatgagtgatgaatttgacacctggctcgacaa-------
B5XEF1_BAD-01          agctgaggaggatgagtgatgaatttgacacctggctcgacaa-------
B5X1T1_BAD-01          agctgaggaggatgagtgatgaatttgacacctggctcgacaa-------
A0A673ZHY7_BAD-01      agctgaggaggatgagtgatgaatttgacacctggctcgacaa-------
A0A4W5R1T6_BAD-01      agctgaggaggatgagtgatgaatttgacacctggctcgacaa-------
A0A060W8P9_BAD-01      agctgaggaggatgagtgatgaatttgacacctggcttgacaa-------
A0A3B1JLM2_BAD-01      agttgaggaggatgagcgatgagtttgacacctggttggacaa-------
A0A3B4DUY7_BAD-01      agctgaggaggatgagtgatgaatttgacacctggctggataa-------
A0A672V9F8_BAD-01      agctgaggaggatgagcgatgagttccagcagcaggt-------------
A0A674GQ16_BAD-01      ggctgaggaggatgagcgacgagttccagctcca----------------
A7MCM4_BAD-01          agctgagaagaatgagtgatgagt------------ttgataa-------
Q4V925_BAD-02          agctgagaagaatgagtgatgagt------------ttgataa-------
Q4V925_BAD-03          agctgagaagaatgagtgatgagt------------ttgataa-------
Q4V925_BAD-01          agctgagaagaatgagtgatgagt------------ttgataa-------
Q4V925_BAD-04          agctgagaagaatgagtgatgagt------------ttgataa-------
A0A671NP27_BAD-01      agctaaggagaatgagtgatgagtttgacatcctccttgataa-------
A0A672SAE4_BAD-01      agctaaggagaatgagtgatgagtttgacatcctccttgataa-------
A0A672SAE4_BAD-02      agctaaggagaatgagtgatgagtttgacatcctccttgataa-------
A0A673J9C6_BAD-01      agctaaggagaatgagtgatgagtttgacatcctccttgataa-------
A0A672RGH0_BAD-01      agctaaggagaatgagtgatgagtttgacatcctccttgataa-------
A0A671RUV0_BAD-01      agctaaggagaatgagtgatgagtttgacatcctccttgataa-------
A0A673HRQ3_BAD-01      agctaaggagaatgagtgatgagtttgacatcctccttgataa-------
A0A4W4HE29_BAD-01      agttaaggaagatgagcgatgagtttgacaccttactggacaa-------
A0A3B1IH05_BAD-01      agctgaggaagatgagtgacgagtttgacaaggggctagagca-------
A0A3B4CPH6_BAD-01      agctgaggaagatgagtgacgagttcgacaccttgctggacaa-------
A0A670YRG7_BAD-01      aattacgcaggatgagcgatgaatttcacggcctgcc-------------
A0A670JUY4_BAD-01      agctgcgcaggatgagcgacgaattccatggcgagct-------------
A0A3P8Y761_BAD-01      agctgcgacgcatgagtgacgagttcgatacgtggctggataa-------
A0A3P8Y761_BAD-02      agctgcgacgcatgagtgacgagttcgatacgtggctggataa-------
A0A667ZNC6_BAD-01      agctccgaagaatgagtgacgagtttgacagcttgctggacaa-------
A0A6F9CQZ0_BAD-02      agctccgacgaatgagtgacgagtttgatacgtggctggataa-------
A0A6F9CA11_BAD-02      agctccgacgcatgagtgacgagtttgatacatggctggataa-------
A0A4W5JLL9_BAD-01      agctccgacgcatgagtgacgagtttgatacgtggctggataa-------
A0A4W5JLL9_BAD-02      agctccgacgcatgagtgacgagtttgatacgtggctggataa-------
A0A1S3N9Q3_BAD-01      agctccgacgcatgagtgacgagtttgatacgtggctggataa-------
A0A674DKC6_BAD-01      agctccgacgcatgagtgatgagtttgatacgtggctggataa-------
A0A3Q2Y0E4_BAD-01      agctgcggcgcatgagcgacgagttcgatagcctgatggacaa-------
A0A668V3Q4_BAD-01      agcttcgacggatgagtgacgagtttgacagcctactagataa-------
I3K7B6_BAD-01          agcttcgacggatgagtgacgagtttgacagcctactagataa-------
A0A3P9B2E4_BAD-01      agcttcgacgaatgagtgacgagtttgacagcttactagataa-------
A0A3Q4GGN3_BAD-01      agcttcgacgaatgagtgacgagtttgacagcttactagataa-------
A0A3P8QRJ7_BAD-01      agcttcgacgaatgagtgacgagtttgacagcttactagataa-------
A0A3Q3C680_BAD-01      agcttcgacgaatgagtgacgagtttgacagcttactagataa-------
A0A3B4GXJ6_BAD-01      agcttcgacgaatgagtgacgagtttgacagcttactagataa-------
A0A3Q0QNQ2_BAD-01      agcttcgaaggatgagtgatgagtttgacagcctactagataa-------
A0A3Q0QNQ2_BAD-02      agcttcgaaggatgagtgatgagtttgacagcctactagataa-------
A0A3Q3WTY4_BAD-01      ggctccgaaggatgagcgatgaatttgacaggc------aaga-------
A0A672JQ68_BAD-01      ggcttcgaaggatgagtgatgaattcgacagtttgctggataa-------
A0A3P8WI83_BAD-01      agctccgcaggatgagtgatgaatttgacagcctgctggacaa-------
A0A3P8WI83_BAD-02      agctccgcaggatgagtgatgaatttgacagcctgctggacaa-------
A0A3Q3FKT9_BAD-03      agctccggaggatgagcgacgagtttgacatcctgcttgacaa-------
A0A3Q3FKT9_BAD-01      agctccggaggatgagcgacgagtttgacatcctgcttgacaa-------
A0A3Q3FKT9_BAD-02      agctccggaggatgagcgacgagtttgacatcctgcttgacaa-------
G3Q8B3_BAD-01          agctccgaaggatgagcgacgagttcgacagcctgctggacaa-------
A0A3Q1K1C7_BAD-01      agctcagaagaatgagtgacgagtttgacagcctgctagacaa-------
A0A672YF93_BAD-01      agctccggaggatgagcgatgaatttgacagcctgctagacaa-------
A0A3Q3RXS8_BAD-01      agctccgaaggatgagcgatgagtttgacagcctcctggataa-------
A0A3Q3R5S3_BAD-01      agctccgaaggatgagcgatgagtttgacagtctgctggacaa-------
H3D8J8_BAD-01          agctccggagaatgagcgacgagttcgacagcctgctggataa-------
A0A674MXC1_BAD-01      agctccggagaatgagcgacgagttcgacagcttgctggataa-------
A0A674MXC1_BAD-02      agctccggagaatgagcgacgagttcgacagcttgctggataa-------
A0A674MXC1_BAD-03      agctccggagaatgagcgacgagttcgacagcttgctggataa-------
A0A674MXC1_BAD-04      agctccggagaatgagcgacgagttcgacagcttgctggataa-------
A0A3B5BAL2_BAD-01      agctgcgaaggatgagcgacgagtttgacagcctgctagataa-------
A0A3Q1GWH9_BAD-01      agctccgaaggatgagcgacgagtttgacagcctgctagacaa-------
A0A3Q1CPU7_BAD-01      agcttcgaaggatgagcgatgagtttgacagcctgctagataa-------
A0A3P8TWH6_BAD-01      agcttcgaaggatgagcgatgagtttgacagcctgctagataa-------
A0A2U9BAC9_BAD-01      agctccggcggatgagtgacgagtttgacagcctgctagacaa-------
A0A671TL42_BAD-01      agctccgaaggatgagcgacgagttcgacagcctgctagacaa-------
A0A665TUH3_BAD-01      agctcaggaggatgagcgatgaatttgacagcctgcttgacaa-------
A0A4W6EMZ7_BAD-01      agctccgaaggatgagcgatgagtttgacagcctgctagacaa-------
A0A4W6EMZ7_BAD-02      agctccgaaggatgagcgatgagtttgacagcctgctagacaa-------
A0A3B4VFC5_BAD-01      agctcagaaggatgagcgacgaatttgacagcctgctagacaa-------
A0A3B4W9T1_BAD-01      agctcagaaggatgagcgatgaatttgacagcctgctagacaa-------
A0A3B3BQF7_BAD-01      agcttcggaggatgagcgacgagttcgacagcctgctggataa-------
A0A3P9HNZ2_BAD-01      agctccgacggatgagcgacgagtttgacagcctgctggataa-------
A0A3B3HDU2_BAD-01      agctccgacggatgagcgacgagtttgacagcctgctggataa-------
A0A3P9KSL7_BAD-01      agctccgacggatgagtgacgagtttgacagcctgctggataa-------
A0A3P9KSL7_BAD-02      agctccgacggatgagtgacgagtttgacagcctgctggataa-------
A0A3Q3AEL8_BAD-01      agctccgccggatgagcgacgagttcgacagcctgctcgacaa-------
A0A3Q3AEL8_BAD-02      agctccgccggatgagcgacgagttcgacagcctgctcgacaa-------
A0A1A8AQV0_BAD-01      agctccgaaggatgagcgacgagttcgacagcctgctggacaa-------
A0A3Q2QC80_BAD-01      agcttcgcaggatgagcgacgagttcggcagcctgctcgataa-------
A0A3Q2D5S0_BAD-01      agcttcgaaggatgagtgatgagtttgtcaccctgcttgataa-------
A0A3B5L9R9_BAD-01      agcttcggaggatgagcgatgagtttgtcaacctgcttgataa-------
A0A3B5Q2N7_BAD-01      agcttcggaggatgagtgatgagtttgtcaacctgcttgataa-------
A0A3P9Q7C3_BAD-01      agcttcggaggatgagcgatgagtttgtcaacctgcttgataa-------
A0A3B3YFR1_BAD-01      agcttcggaggatgagcgatgagtttgtcaacctgcttgataa-------
A0A087X8P8_BAD-01      agcttcggaggatgagcgatgagtttgtcaacctgcttgataa-------
A0A3B3UA11_BAD-01      agcttcggaggatgagcgatgagtttgtcaacctgcttgataa-------
A0A452IFQ4_BAD-01      agctgcgcaggatgagtgacgagtttgatgtggcgctg------------
A0A674I2R9_BAD-01      aactgcgcaggatgagtgacgagtttgacgtggcgctg------------
A0A3B3QX41_BAD-01      agctgcggcgtatgagtgacgagtttgacaccctgctggaca--------
A0A5F8GA49_BAD-01      agctccgcagaatgagcgacgagttcgattgcagcttc------------
G3VRY3_BAD-01          agctgcgcaggatgagcgacgagttccactgcaccttc------------
G3VRY3_BAD-02          agctgcgcaggatgagcgacgagttccactgcaccttc------------
G3VRY3_BAD-03          agctgcgcaggatgagcgacgagttccactgcaccttc------------
A0A4X2KAA5_BAD-01      agttgcgcaggatgagcgacgagttcgattgcaccttc------------
A0A6I8NVP2_BAD-01      agctccgcaggatgagtgacgagttcgactgcactttc------------
Q61337_BAD-09          agctccgaaggatgagcgatgagtttgagggttccttc------------
Q6P7C5_BAD-01          tcccctga------------------------------------------
Q61337_BAD-07          agctccgaaggatgagcgatgagtttgagggttccttc------------
Q61337_BAD-02          agctccgaaggatgagcgatgagtttgagggttccttc------------
Q61337_BAD-05          agctccgaaggatgagcgatgagtttgagggttccttc------------
Q61337_BAD-01          agctccgaaggatgagcgatgagtttgagggttccttc------------
Q61337_BAD-03          agctccgaaggatgagcgatgagtttgagggttccttc------------
Q61337_BAD-04          agctccgaaggatgagcgatgagtttgagggttccttc------------
Q61337_BAD-06          agctccgaaggatgagcgatgagtttgagggttccttc------------
G1P8C5_BAD-01          agctccggaggatgagcgacgagttccagggctcctttaag---------
A0A4X1VE31_BAD-01      agctccggaggatgagtgacgagttccagggttccttcaaggtgagcgcg
A0A287AEF3_BAD-01      agctccggaggatgagtgacgagttccagggttccttcaag---------
A0A4X1VE31_BAD-02      agctccggaggatgagtgacgagttccagggttccttcaag---------
A0A4X1VE31_BAD-03      agctccggaggatgagtgacgagttccagggttccttc------------
F7DN67_BAD-01          agctccggaggatgagcgacgagttccaggtctccttc------------
M3YNE7_BAD-01          agctccggaggatgagcgacgagttccagggctccttc------------
A0A673V6P8_BAD-01      agctccggaggatgagcgacgagttccagggctccttc------------
A0A337SAW2_BAD-01      agctccggaggatgagcgacgagttccagggctccttc------------
A0A667H8Z9_BAD-01      agctccggaggatgagcgacgagttccagggctccttc------------
A0A452RJM6_BAD-01      agctccggaggatgagcgacgagttccagggctccttc------------
A0A384DJL2_BAD-01      agctccggaggatgagcgacgagttccagggctccttc------------
Q45KI9_BAD-01          agctccgcaggatgagcgacgagttccagggctccttc------------
A0A3Q7SWS0_BAD-01      agctccgcaggatgagcgacgagttccagggctccttc------------
A0A4W2C9A8_BAD-01      agctccggaggatgagcgacgagtttcacgtctccttc------------
A0A4W2C9A8_BAD-01      agctccggaggatgagcgacgagtttcacgtctccttc------------
F1MUT9_BAD-01          agctccggaggatgagcgacgagtttcacgtctccttc------------
Q3SYZ0_BAD-01          aactccggaggatgagcgacgagtttcacgtctccttc------------
A0A452ER54_BAD-01      agctccgaaggatgagcgacgagtttcacgtctccttc------------
A0A452ER54_BAD-02      agctccgaaggatgagcgacgagtttcacgtctccttc------------
W5P8G9_BAD-01          agctccgaaggatgagcgacgagtttcacgtctccttc------------
A0A4U1FMC3_BAD-01      agctccggaggatgagcgacgagttccacggctctttc------------
A0A2Y9EHU3_BAD-01      agctccggaggatgagcgacgagttccacggctccttc------------
G3TP47_BAD-01          agctccgcaggatgagtgatgagttccagggctatttc------------
A0A2K5E6A6_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2I2YFH2_BAD-03      --------------------------------------------------
A0A2R8Z674_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2K6E7I4_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
G5B6Q3_BAD-01          agctccggaggatgagcgatgagttcgtggactccttc------------
G5B6Q3_BAD-02          agctccggaggatgagcgatgagttcgtggactccttc------------
H0V608_BAD-01          agctccggaggatgagcgacgagttcgtggactccttc------------
A0A287CT05_BAD-01      agctccggaggatgagcgacgaattcgagggctccttt------------
A0A287CT05_BAD-02      agctccggaggatgagcgacgaattcgagggctccttt------------
A0A671ELU4_BAD-01      agctccggaggatgagcgatgagttcgagggttccttt------------
A0A2J8TYJ3_BAD-01      agctccggaggatga-----------------------------------
A0A2R8Z674_BAD-03      agctccggaggatga-----------------------------------
A0A2I2YFH2_BAD-04      agctccggaggatga-----------------------------------
Q92934_BAD-04          agctccggaggatga-----------------------------------
A0A2I3TBK7_BAD-03      agctccggaggatga-----------------------------------
A0A2K6E7I4_BAD-03      agctccggaggatga-----------------------------------
A0A2K5M0A7_BAD-03      agctccggaggatga-----------------------------------
A0A2K5XJR2_BAD-03      agctccggaggatga-----------------------------------
A0A2K5HKU7_BAD-02      agctccggaggatga-----------------------------------
A0A2K6N196_BAD-02      agctccggaggatga-----------------------------------
A0A2K6PUL3_BAD-02      agctccggaggatga-----------------------------------
H0WVR2_BAD-01          aactccggaggatgagtgacgagttcgaagactccttcaag---------
A0A2K5E6A6_BAD-03      agctccggaggatga-----------------------------------
A0A2K6GWV0_BAD-01      agctccggaggatgagcgacgagttcgaggactccttcaag---------
A0A2K5HKU7_BAD-01      agctccggaggatgagtgacgagtttgtggactctttt------------
A0A2K6N196_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
A0A2K6PUL3_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
A0A0D9R491_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
A0A2K5M0A7_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
A0A2K5XJR2_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
A0A2K6E7I4_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
A0A2K5VCA1_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
A0A1D5QBW1_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
Q2PG01_BAD-01          agctccggaggatgagtgacgagtttgtggactccttt------------
A0A2K5PDB1_BAD-01      agctccggaggatgagtgacgagttcgtggactccttt------------
A0A2K6TG62_BAD-01      agctccggaggatgagtgacgagtttgtggactccttc------------
A0A2K5E6A6_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
U3F2S3_BAD-01          agctccggaggatgagtgatgagtttgtggactccttt------------
A0A2J8TYJ3_BAD-02      agctccggaggatgagtgacgagtttgtggactcctttaag---------
A0A2J8TYJ3_BAD-03      agctccggaggatgagtgacgagtttgtggactcctttaag---------
A0A2I3H4B2_BAD-01      agctccggaggatgagtgacgagtttgtggactccttt------------
B4DZQ9_BAD-01          agctccggaggatgagtgacgagtttgtggactcctttaag---------
A0A2I2YFH2_BAD-01      agctccggaggatgagtgacgagtttgtggactcctttaag---------
A0A2I2YFH2_BAD-02      agctccggaggatgagtgacgagtttgtggactcctttaag---------
A0A2I3TBK7_BAD-02      agctccggaggatgagtgacgagtttgtggactcctttaag---------
A0A2R8Z674_BAD-01      agctccggaggatgagtgacgagtttgtggactcctttaag---------
Q92934_BAD-01          agctccggaggatgagtgacgagtttgtggactcctttaag---------
Q92934_BAD-02          agctccggaggatgagtgacgagtttgtggactcctttaag---------
Q92934_BAD-05          agctccggaggatgagtgacgagtttgtggactcctttaag---------
Q92934_BAD-06          agctccggaggatgagtgacgagtttgtggactcctttaag---------
A0A2K5PDB1_BAD-03      agctccggaggatga-----------------------------------
A0A2K6TG62_BAD-03      agctccggaggatga-----------------------------------
                                                                         

C1C3S9_BAD-01          -------------------------------cacgagtatccctcgacct
H3ANP3_BAD-03          -------------------------------tctggggcttccgaggcca
H3ANP3_BAD-01          -------------------------------tctggggcttccgaggcca
H3ANP3_BAD-02          -------------------------------tctggggcttccgaggcca
H3ANP3_BAD-04          -------------------------------tctggggcttccgaggcca
E7FBJ6_BAD-01          -------------------------------aggggtgagtaagacaccg
A0A672LB88_BAD-01      -------------------------------aggggaggtcaaaagagcg
A0A671PX91_BAD-01      -------------------------------aggggaggtcaaaagagcg
A0A673J5Q9_BAD-01      -------------------------------aggggaggtcaaaagagcg
A0A672R7P6_BAD-01      -------------------------------aggagaggtcaaaagagcg
A0A671SBB4_BAD-01      -------------------------------aggagaggtcaaaagagcg
A0A673I6H5_BAD-01      -------------------------------aggagaggtcaaaagagcg
A0A4W4DXF5_BAD-01      -------------------------------aggggagataagaagagtg
A0A3P8YI30_BAD-01      -------------------------------aggggagcccaagagagga
A0A3P8YI30_BAD-02      -------------------------------aggggagcccaagagagga
A0A6F9BAV3_BAD-01      -------------------------------aggggagcccaagagaggg
A0A060W8W7_BAD-01      -------------------------------aggggagcccaagagaggg
A0A4W5MZR2_BAD-01      -------------------------------aggggagcctaagagaggg
A0A674AVP9_BAD-01      -------------------------------aggggtgcccaagagaggg
A0A1S3L0Z2_BAD-01      -------------------------------aggggtgcccaagagaggg
B5XEF1_BAD-01          -------------------------------aggggtgcccaagagaggg
B5X1T1_BAD-01          -------------------------------aggggaacccaagagaggg
A0A673ZHY7_BAD-01      -------------------------------aggggaacccaagagaggg
A0A4W5R1T6_BAD-01      -------------------------------aggggagcccaagagaggg
A0A060W8P9_BAD-01      -------------------------------aggggagcccaagagaggg
A0A3B1JLM2_BAD-01      -------------------------------aggggacttaagaagaaca
A0A3B4DUY7_BAD-01      -------------------------------aggggacacaagaagagcg
A0A672V9F8_BAD-01      -------------------------------gggggtgctgccgcgcgcc
A0A674GQ16_BAD-01      ----------------------------------ggtgctgccgcggccc
A7MCM4_BAD-01          -------------------------------agggcagatgaagagagta
Q4V925_BAD-02          -------------------------------agg---gatgaagagagta
Q4V925_BAD-03          -------------------------------agg---gatgaagagagta
Q4V925_BAD-01          -------------------------------agggcagatgaagagagta
Q4V925_BAD-04          -------------------------------agggcagatgaagagagta
A0A671NP27_BAD-01      -------------------------------agg---gatgaagagggtg
A0A672SAE4_BAD-01      -------------------------------agg---gatgaagagggtg
A0A672SAE4_BAD-02      -------------------------------agg---gatgaagagggtg
A0A673J9C6_BAD-01      -------------------------------agg---gatgaagagggtg
A0A672RGH0_BAD-01      -------------------------------agg---gatgaagagggtg
A0A671RUV0_BAD-01      -------------------------------agg---gatgaagagggtg
A0A673HRQ3_BAD-01      -------------------------------agg---gatgaagagggtg
A0A4W4HE29_BAD-01      -------------------------------agg---gatgaagagggca
A0A3B1IH05_BAD-01      -------------------------------agg---gatgaagagggtg
A0A3B4CPH6_BAD-01      -------------------------------agg---gatgaagagagtg
A0A670YRG7_BAD-01      -------------------------------------------gcgcccg
A0A670JUY4_BAD-01      -------------------------------gcagaagctgccgcgcccc
A0A3P8Y761_BAD-01      -------------------------------agggcaaatgaagcgggtg
A0A3P8Y761_BAD-02      -------------------------------agggcaaatgaagcgggtg
A0A667ZNC6_BAD-01      -------------------------------aggggagatgaagagggtt
A0A6F9CQZ0_BAD-02      -------------------------------aggggagatgaagcagttg
A0A6F9CA11_BAD-02      -------------------------------aggggagatgaggcgggtg
A0A4W5JLL9_BAD-01      -------------------------------aggggagatgaggcgggtg
A0A4W5JLL9_BAD-02      -------------------------------aggggagatgaggcgggtg
A0A1S3N9Q3_BAD-01      -------------------------------aggggagatgaggcgggtg
A0A674DKC6_BAD-01      -------------------------------aggggagatgaggcgggtg
A0A3Q2Y0E4_BAD-01      -------------------------------aggggagtt---gaagttc
A0A668V3Q4_BAD-01      -------------------------------aggggagat---gaagctc
I3K7B6_BAD-01          -------------------------------aggggagat---gaagctc
A0A3P9B2E4_BAD-01      -------------------------------agggg-------------t
A0A3Q4GGN3_BAD-01      -------------------------------aggggagat---gaagctc
A0A3P8QRJ7_BAD-01      -------------------------------aggggagat---gaaggtc
A0A3Q3C680_BAD-01      -------------------------------aggggagat---gaaggtc
A0A3B4GXJ6_BAD-01      -------------------------------aggggagat---gaaggtc
A0A3Q0QNQ2_BAD-01      -------------------------------agggatgaa---gaaggcc
A0A3Q0QNQ2_BAD-02      -------------------------------agggatgaa---gaaggcc
A0A3Q3WTY4_BAD-01      -------------------------------atggaagacgagg------
A0A672JQ68_BAD-01      -------------------------------aggggagatgaagaagttg
A0A3P8WI83_BAD-01      -------------------------------aggg---atgaggaaggtg
A0A3P8WI83_BAD-02      -------------------------------aggg---atgaggaaggtg
A0A3Q3FKT9_BAD-03      -------------------------------aggggagatgaaaaaagta
A0A3Q3FKT9_BAD-01      -------------------------------aggggtgagaattaaaggg
A0A3Q3FKT9_BAD-02      -------------------------------aggggtgagaattaaaggg
G3Q8B3_BAD-01          -------------------------------aggggaaatgaggagggta
A0A3Q1K1C7_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A672YF93_BAD-01      -------------------------------gggggaaatgaagagggtg
A0A3Q3RXS8_BAD-01      -------------------------------aggggaaat---gagagtg
A0A3Q3R5S3_BAD-01      -------------------------------aggggagatgaagagggtg
H3D8J8_BAD-01          -------------------------------agggggaatgaggaagacc
A0A674MXC1_BAD-01      -------------------------------aggggggatgaggaagacc
A0A674MXC1_BAD-02      -------------------------------aggggggatgaggaagacc
A0A674MXC1_BAD-03      -------------------------------aggggggatgaggaagacc
A0A674MXC1_BAD-04      -------------------------------aggggggatgaggaagacc
A0A3B5BAL2_BAD-01      -------------------------------aggggagatgaagagggtg
A0A3Q1GWH9_BAD-01      -------------------------------aggggagatgaagagagtg
A0A3Q1CPU7_BAD-01      -------------------------------aggggagatgaagagggtg
A0A3P8TWH6_BAD-01      -------------------------------aggggagatgaagagggtg
A0A2U9BAC9_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A671TL42_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A665TUH3_BAD-01      -------------------------------aggggagatgaggaaagtg
A0A4W6EMZ7_BAD-01      -------------------------------aggggagatgaggagggtg
A0A4W6EMZ7_BAD-02      -------------------------------aggggagatgaggagggtg
A0A3B4VFC5_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A3B4W9T1_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A3B3BQF7_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A3P9HNZ2_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A3B3HDU2_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A3P9KSL7_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A3P9KSL7_BAD-02      -------------------------------aggggagatgaggaaggtg
A0A3Q3AEL8_BAD-01      -------------------------------gggggagatgaggaaggtg
A0A3Q3AEL8_BAD-02      -------------------------------gggggagatgaggaaggtg
A0A1A8AQV0_BAD-01      -------------------------------aggggagatgaggaaggtg
A0A3Q2QC80_BAD-01      -------------------------------aggggagttgaggaaggtg
A0A3Q2D5S0_BAD-01      -------------------------------aggggagttgaggaaggtg
A0A3B5L9R9_BAD-01      -------------------------------aggggaaatgaggaatgtg
A0A3B5Q2N7_BAD-01      -------------------------------aggggaaatgaggaatgtg
A0A3P9Q7C3_BAD-01      -------------------------------aggggaaatgaggaaggtg
A0A3B3YFR1_BAD-01      -------------------------------aggggaaatgaggaaggtg
A0A087X8P8_BAD-01      -------------------------------aggggaaatgaggaaggtg
A0A3B3UA11_BAD-01      -------------------------------aggggaaatgaggaaggtg
A0A452IFQ4_BAD-01      -------------------------------cagg-tgctgccacgcccc
A0A674I2R9_BAD-01      -------------------------------cagg-tgctgccacgcccc
A0A3B3QX41_BAD-01      -------------------------------aagg----------gatga
A0A5F8GA49_BAD-01      -------------------------------aagg-gacttccgcgcccg
G3VRY3_BAD-01          -------------------------------aagg-gacttccccgcccg
G3VRY3_BAD-02          -------------------------------aagg-gacttccccgcccg
G3VRY3_BAD-03          -------------------------------aagg-gacttccccgcccg
A0A4X2KAA5_BAD-01      -------------------------------aagg-gtcttccccgcccg
A0A6I8NVP2_BAD-01      -------------------------------cagg-gtctgccccggccg
Q61337_BAD-09          -------------------------------aagt-------ttcattta
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          -------------------------------aag----------------
Q61337_BAD-02          -------------------------------aagg-ga-----------g
Q61337_BAD-05          -------------------------------aagg-t-------------
Q61337_BAD-01          -------------------------------aagg-gacttcctcgccca
Q61337_BAD-03          -------------------------------aagg-gacttcctcgccca
Q61337_BAD-04          -------------------------------aagg-gacttcctcgccca
Q61337_BAD-06          -------------------------------aagg-gacttcctcgccca
G1P8C5_BAD-01          -------------------------------aagg-gtctccctcgcccg
A0A4X1VE31_BAD-01      cgcgtgggactgtaccctcgagtctcctcccaatg-ggctgtcccgttcg
A0A287AEF3_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A4X1VE31_BAD-02      -------------------------------aagg-gacttcctcgcccg
A0A4X1VE31_BAD-03      -------------------------------aagg-gacttcctcgcccg
F7DN67_BAD-01          -------------------------------cagg-cacttcctcgcccg
M3YNE7_BAD-01          -------------------------------aagg-ggcttcctcgcccg
A0A673V6P8_BAD-01      -------------------------------aagg-gacttccacgcccg
A0A337SAW2_BAD-01      -------------------------------aagg-gacttccacgcccg
A0A667H8Z9_BAD-01      -------------------------------aagg-gacttccacgcccg
A0A452RJM6_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A384DJL2_BAD-01      -------------------------------aagg-gacttcctcgcccg
Q45KI9_BAD-01          -------------------------------aagg-gacttcctcgcccg
A0A3Q7SWS0_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A4W2C9A8_BAD-01      -------------------------------aagg-ggcttcctcgcccg
A0A4W2C9A8_BAD-01      -------------------------------aagg-ggcttcctcgcccg
F1MUT9_BAD-01          -------------------------------aagg-ggcttcctcgcccg
Q3SYZ0_BAD-01          -------------------------------aagg-ggcttcctcgcccg
A0A452ER54_BAD-01      -------------------------------aagg-ggcttcctcgcccg
A0A452ER54_BAD-02      -------------------------------aagg-ggcttcctcgcccg
W5P8G9_BAD-01          -------------------------------aagg-ggcttcctcgcccg
A0A4U1FMC3_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2Y9EHU3_BAD-01      -------------------------------aaag-gacttcctcgcccg
G3TP47_BAD-01          -------------------------------aagg-gacttcctcgcccg
A0A2K5E6A6_BAD-02      ------------------------------------gacttcctcgcccg
A0A2K5PDB1_BAD-02      ------------------------------------gacttcctcgcccg
A0A2K6TG62_BAD-02      ------------------------------------gacttcctcgcccg
A0A2I2YFH2_BAD-03      ------------------------------------gacttcctcgcccg
A0A2R8Z674_BAD-02      ------------------------------------gacttcctcgcccg
Q92934_BAD-03          ------------------------------------gacttcctcgcccg
A0A2I3TBK7_BAD-01      ------------------------------------gacttcctcgcccg
A0A2K6E7I4_BAD-02      ------------------------------------gacttcctcgcccg
A0A2K5M0A7_BAD-02      ------------------------------------gacttcctcgcccg
A0A2K5XJR2_BAD-02      ------------------------------------gacttcctcgcccg
G5B6Q3_BAD-01          -------------------------------aagg-gtcttcctcgcccg
G5B6Q3_BAD-02          -------------------------------aagg-gtcttcctcgcccg
H0V608_BAD-01          -------------------------------aagg-gtcttcctcgcccg
A0A287CT05_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A287CT05_BAD-02      -------------------------------aaggtgacattttc-----
A0A671ELU4_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          -------------------------------aagg-gacttcctcgcccg
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K5HKU7_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K6N196_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K6PUL3_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A0D9R491_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K5M0A7_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K5XJR2_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K6E7I4_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K5VCA1_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A1D5QBW1_BAD-01      -------------------------------aagg-gacttcctcgcccg
Q2PG01_BAD-01          -------------------------------aagg-ggcttcctcgcccg
A0A2K5PDB1_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K6TG62_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2K5E6A6_BAD-01      -------------------------------aagg-gacttcctcgcccg
U3F2S3_BAD-01          -------------------------------aagg-gacttcctcgcccg
A0A2J8TYJ3_BAD-02      -------------------------------aagg-gacttcctcgcccg
A0A2J8TYJ3_BAD-03      -------------------------------aagg-gacttcctcgcccg
A0A2I3H4B2_BAD-01      -------------------------------aagg-gacttcctcgcccg
B4DZQ9_BAD-01          -------------------------------aagg-gacttcctcgcccg
A0A2I2YFH2_BAD-01      -------------------------------aagg-gacttcctcgcccg
A0A2I2YFH2_BAD-02      -------------------------------aagg-gacttcctcgcccg
A0A2I3TBK7_BAD-02      -------------------------------aagg-gacttcctcgcccg
A0A2R8Z674_BAD-01      -------------------------------aagg-gacttcctcgcccg
Q92934_BAD-01          -------------------------------aagg-gacttcctcgcccg
Q92934_BAD-02          -------------------------------aagg-gacttcctcgcccg
Q92934_BAD-05          -------------------------------aagg-gacttcctcgcccg
Q92934_BAD-06          -------------------------------aagg-gacttcctcgcccg
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          a-----aa------------------agt---gc---aagtgc-agccac
H3ANP3_BAD-03          a-----ag------------------agc---gc---tggagc-agctgg
H3ANP3_BAD-01          a-----ag------------------agc---gc---tggagc-agctgg
H3ANP3_BAD-02          a-----ag------------------agc---gc---tggagc-agctgg
H3ANP3_BAD-04          a-----ag------------------agc---gc---tggagc-agctgg
E7FBJ6_BAD-01          a-----ac------------------agcca----------------gaa
A0A672LB88_BAD-01      a-----ac------------------agcca----------------gaa
A0A671PX91_BAD-01      a-----ac------------------agcca----------------gaa
A0A673J5Q9_BAD-01      a-----ac------------------agcca----------------gaa
A0A672R7P6_BAD-01      a-----ac------------------agtca----------------gaa
A0A671SBB4_BAD-01      a-----ac------------------agtca----------------gaa
A0A673I6H5_BAD-01      a-----ac------------------agtca----------------gaa
A0A4W4DXF5_BAD-01      a-----gc------------------agccctgggaaactgtc-acagaa
A0A3P8YI30_BAD-01      a-----tt------------------atcccaggaagagc-------aaa
A0A3P8YI30_BAD-02      a-----tt------------------atcccaggaagagc-------aaa
A0A6F9BAV3_BAD-01      a-----tt------------------agcccaggaggatg-------caa
A0A060W8W7_BAD-01      a-----tt------------------agcccaggaggagg-------caa
A0A4W5MZR2_BAD-01      a-----tt------------------agcccaggaggagg-------caa
A0A674AVP9_BAD-01      a-----tt------------------attccaagaggagg-------caa
A0A1S3L0Z2_BAD-01      a-----tt------------------atcccaagaggagg-------caa
B5XEF1_BAD-01          a-----tt------------------atcccaagaggagg-------caa
B5X1T1_BAD-01          a-----ta------------------agcccaggaggggt-------caa
A0A673ZHY7_BAD-01      a-----ta------------------agcccaggaggggt-------caa
A0A4W5R1T6_BAD-01      a-----tt------------------agcccaggagggat-------caa
A0A060W8P9_BAD-01      a-----tt------------------agcccaggaggggt-------caa
A0A3B1JLM2_BAD-01      a-----ct------------------ggccctggg-------------ag
A0A3B4DUY7_BAD-01      a-----gc------------------agccctggg-------------aa
A0A672V9F8_BAD-01      a-----gc------------------agc---gcggggggggc-------
A0A674GQ16_BAD-01      c-----gc------------------agt---gtcgggggggc-tccccc
A7MCM4_BAD-01          a-----aa------------------agt---gc---aggaac-tgcgcg
Q4V925_BAD-02          a-----aa------------------agt---gc---aggaac-tgcgcg
Q4V925_BAD-03          a-----aa------------------agt---gc---aggaac-tgcgcg
Q4V925_BAD-01          a-----aa------------------agt---gc---aggaac-tgcgcg
Q4V925_BAD-04          a-----aa------------------agt---gc---aggaac-tgcgcg
A0A671NP27_BAD-01      a-----ag------------------agt---gc---aggaac-aacacg
A0A672SAE4_BAD-01      a-----ag------------------agt---gc---aggaac-aacacg
A0A672SAE4_BAD-02      a-----ag------------------agt---gc---aggaac-aacacg
A0A673J9C6_BAD-01      a-----ag------------------agt---gc---aggaac-aacacg
A0A672RGH0_BAD-01      a-----ag------------------agt---gc---aggaac-aacacg
A0A671RUV0_BAD-01      a-----ag------------------agc---gc---aggaac-tacacg
A0A673HRQ3_BAD-01      a-----ag------------------agc---gc---aggaac-aacacg
A0A4W4HE29_BAD-01      a-----gg------------------agc---gc---aggagc-agctcg
A0A3B1IH05_BAD-01      a-----gg------------------agt---gc---cggagc-agcccg
A0A3B4CPH6_BAD-01      a-----gg------------------agt---gc---aggtgc-agcccg
A0A670YRG7_BAD-01      a-----aa------------------agc---gc---cgggac-ctgctc
A0A670JUY4_BAD-01      a-----ag------------------agt---gc---agggac-agctac
A0A3P8Y761_BAD-01      a-----ag------------------agt---gc---aggagc-agccaa
A0A3P8Y761_BAD-02      a-----ag------------------agt---gc---aggagc-agccaa
A0A667ZNC6_BAD-01      a-----gg------------------agt---gc---tgggac-ggccaa
A0A6F9CQZ0_BAD-02      a-----ag------------------agt---gt---tggagc-agccaa
A0A6F9CA11_BAD-02      a-----ag------------------agt---gc---gggagc-agccaa
A0A4W5JLL9_BAD-01      a-----ag------------------agt---gc---gggagc-agccaa
A0A4W5JLL9_BAD-02      a-----ag------------------agt---gc---gggagc-agccaa
A0A1S3N9Q3_BAD-01      a-----ag------------------agt---gc---gggagc-agccaa
A0A674DKC6_BAD-01      a-----ag------------------agt---gc---gggagc-agccaa
A0A3Q2Y0E4_BAD-01      a-----ag------------------agc---gccggcggcac-atccag
A0A668V3Q4_BAD-01      a-----ag------------------------------------------
I3K7B6_BAD-01          a-----ag------------------------------------------
A0A3P9B2E4_BAD-01      a-----ag------------------------------------------
A0A3Q4GGN3_BAD-01      a-----ag------------------------------------------
A0A3P8QRJ7_BAD-01      a-----ag------------------------------------------
A0A3Q3C680_BAD-01      a-----ag------------------------------------------
A0A3B4GXJ6_BAD-01      a-----ag------------------------------------------
A0A3Q0QNQ2_BAD-01      a-----ag------------------aat---gc---tgggac-caccag
A0A3Q0QNQ2_BAD-02      a-----ag------------------aat---gc---tgggac-caccag
A0A3Q3WTY4_BAD-01      --------------------------agt---gc---tgggac-ggccac
A0A672JQ68_BAD-01      a-----gg------------------aat---cc---aggcca-agccag
A0A3P8WI83_BAD-01      a-----ag------------------agc---gc---aggcac-agccag
A0A3P8WI83_BAD-02      a-----ag------------------agc---gc---aggcac-agccag
A0A3Q3FKT9_BAD-03      a-----ga------------------agc---cc---tgggcc-agccaa
A0A3Q3FKT9_BAD-01      g-----ggggggggggtagcaggggtggc---tg---tggatt-agtggt
A0A3Q3FKT9_BAD-02      g-----ggggggggggtagcaggggtggc---tg---tggatt-agtggt
G3Q8B3_BAD-01          a-----ag------------------agc---gc---cgggac-gaccaa
A0A3Q1K1C7_BAD-01      a-----gg------------------agc---gc---tggcac-ggccag
A0A672YF93_BAD-01      a-----ga------------------agt---gc---ggggac-agccag
A0A3Q3RXS8_BAD-01      a-----gg------------------aat---gc---tggcaa-ggccca
A0A3Q3R5S3_BAD-01      a-----gg------------------agt---gc---cggggc-ggccag
H3D8J8_BAD-01          a-----gc------------------agc---gc---cggctc-ggccag
A0A674MXC1_BAD-01      a-----ac------------------agc---ac---cggatc-gaccaa
A0A674MXC1_BAD-02      a-----ac------------------agc---ac---cggatc-gaccaa
A0A674MXC1_BAD-03      a-----ac------------------agc---ac---cggatc-gaccaa
A0A674MXC1_BAD-04      a-----ac------------------agc---ac---cggatc-gaccaa
A0A3B5BAL2_BAD-01      a-----gg------------------agt---gc---agggac-ggccaa
A0A3Q1GWH9_BAD-01      a-----gg------------------agc---gc---agggac-ggccag
A0A3Q1CPU7_BAD-01      a-----gg------------------agt---gc---agggac-agccag
A0A3P8TWH6_BAD-01      a-----gg------------------agt---gc---agggac-agccag
A0A2U9BAC9_BAD-01      a-----ag------------------agc---gc---cgggac-ggccag
A0A671TL42_BAD-01      a-----ag------------------agt---gc---cgggac-gcccaa
A0A665TUH3_BAD-01      a-----ag------------------agc---gt---tgggtc-agccaa
A0A4W6EMZ7_BAD-01      a-----ag------------------agc---gc---tacaac-gaccag
A0A4W6EMZ7_BAD-02      a-----ag------------------agc---gc---tacaac-gaccag
A0A3B4VFC5_BAD-01      a-----ag------------------agc---gc---tgggac-agccaa
A0A3B4W9T1_BAD-01      a-----ag------------------agc---gc---tgggac-agccaa
A0A3B3BQF7_BAD-01      a-----gg------------------agc---gc---gggggc-gaccaa
A0A3P9HNZ2_BAD-01      a-----gg------------------agc---ac---tggggc-ggccaa
A0A3B3HDU2_BAD-01      a-----gg------------------agc---ac---tggggc-ggccaa
A0A3P9KSL7_BAD-01      a-----gg------------------agc---ac---tggggc-ggccaa
A0A3P9KSL7_BAD-02      a-----gg------------------agc---ac---tggggc-ggccaa
A0A3Q3AEL8_BAD-01      a-----ag------------------agc---gc---cgggac-gaccaa
A0A3Q3AEL8_BAD-02      a-----ag------------------agc---gc---cgggac-gaccaa
A0A1A8AQV0_BAD-01      a-----ga------------------agt---gc---cgggtc-aaccaa
A0A3Q2QC80_BAD-01      a-----gc------------------agc---gc---tgggac-gaacag
A0A3Q2D5S0_BAD-01      a-----gc------------------agc---ac---ggggac-gaacag
A0A3B5L9R9_BAD-01      a-----gc------------------agt---ga---tgggtc-gaacag
A0A3B5Q2N7_BAD-01      a-----gc------------------agt---ga---tgggtc-gaacag
A0A3P9Q7C3_BAD-01      a-----gc------------------agt---gc---cgggtc-gaacgg
A0A3B3YFR1_BAD-01      a-----gc------------------agt---ac---cgggtc-gaacag
A0A087X8P8_BAD-01      a-----gc------------------agt---ac---cgggtc-gaacag
A0A3B3UA11_BAD-01      a-----gc------------------agt---ac---cgggtc-gaacag
A0A452IFQ4_BAD-01      a-----ag------------------agt---gc---aggcac-gacatc
A0A674I2R9_BAD-01      a-----ag------------------agt---gc---aggcac-aacatc
A0A3B3QX41_BAD-01      agagggtg------------------cgcagtgc---cggggc-tgcccg
A0A5F8GA49_BAD-01      a-----ag------------------agc---gc---cggcac-tgcgag
G3VRY3_BAD-01          a-----ag------------------agc---gc---aggcac-tgcgag
G3VRY3_BAD-02          a-----ag------------------agc---gc---aggcac-tgcgag
G3VRY3_BAD-03          a-----ag------------------agc---gc---aggcac-tgcgag
A0A4X2KAA5_BAD-01      a-----ag------------------agc---gc---cggcac-tgcgag
A0A6I8NVP2_BAD-01      a-----ag------------------agc---gc---gggcac-cgcggc
Q61337_BAD-09          ------gg------------------atcccggc---acacgc-atcatc
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          ------ag------------------cat---gc---tgggacttgcagt
Q61337_BAD-02          a-----ag------------------agc---tg---acgtac-a-----
Q61337_BAD-05          -------g------------------agc---gc---cagcgt-t-----
Q61337_BAD-01          a-----ag------------------agc---gc---aggcac-tgcaac
Q61337_BAD-03          a-----ag------------------agc---gc---aggcac-tgcaac
Q61337_BAD-04          a-----ag------------------agc---gc---aggcac-tgcaac
Q61337_BAD-06          a-----ag------------------agc---gc---aggcac-tgcaac
G1P8C5_BAD-01          a-----ag------------------agc---gc---tggcac-agcaac
A0A4X1VE31_BAD-01      agtcccag------------------ggcctttc---gggatc-tgaggt
A0A287AEF3_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A4X1VE31_BAD-02      a-----ag------------------agc---gc---gggcac-agcgac
A0A4X1VE31_BAD-03      a-----ag------------------agc---gc---gggcac-agcgac
F7DN67_BAD-01          a-----ag------------------agc---gc---gggcac-agcgac
M3YNE7_BAD-01          a-----ag------------------agc---gc---aggcac-agccac
A0A673V6P8_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A337SAW2_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A667H8Z9_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A452RJM6_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A384DJL2_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
Q45KI9_BAD-01          a-----ag------------------agc---gc---ggggac-agcgac
A0A3Q7SWS0_BAD-01      a-----ag------------------agc---gc---ggggac-agcgac
A0A4W2C9A8_BAD-01      a-----ag------------------agc---gc---gggcac-ggcaac
A0A4W2C9A8_BAD-01      a-----ag------------------agc---gc---gggcac-ggcaac
F1MUT9_BAD-01          a-----ag------------------agc---gc---gggcac-ggcaac
Q3SYZ0_BAD-01          a-----ag------------------agc---gc---gggcac-ggcaac
A0A452ER54_BAD-01      a-----ag------------------agc---gc---gggaac-ggcaac
A0A452ER54_BAD-02      a-----ag------------------agc---gc---gggaac-ggcaac
W5P8G9_BAD-01          a-----ag------------------agc---gc---gggcac-ggcaac
A0A4U1FMC3_BAD-01      a-----ac------------------agc---gc---cggcac-agcgac
A0A2Y9EHU3_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
G3TP47_BAD-01          a-----ag------------------agc---gc---gggcac-agcaac
A0A2K5E6A6_BAD-02      a-----ag------------------agc---gc---gggcac-agcaac
A0A2K5PDB1_BAD-02      a-----ag------------------agc---gc---gggcac-agcaac
A0A2K6TG62_BAD-02      a-----ag------------------agc---gc---gggcac-agcaac
A0A2I2YFH2_BAD-03      a-----ag------------------agc---gc---aggcac-agcaac
A0A2R8Z674_BAD-02      a-----ag------------------agc---gc---gggcac-agcaac
Q92934_BAD-03          a-----ag------------------agc---gc---gggcac-agcaac
A0A2I3TBK7_BAD-01      a-----ag------------------agc---gc---gggcac-agcaac
A0A2K6E7I4_BAD-02      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K5M0A7_BAD-02      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K5XJR2_BAD-02      a-----ag------------------agc---gc---gggcac-agcgac
G5B6Q3_BAD-01          a-----aa------------------agc---gc---gggcac-agcgac
G5B6Q3_BAD-02          a-----aa------------------agc---gc---gggcac-agcgac
H0V608_BAD-01          a-----ag------------------agc---gc---gggcac-agcgac
A0A287CT05_BAD-01      a-----gg------------------agc---gc---aggcac-agcgtc
A0A287CT05_BAD-02      --------------------------------------------------
A0A671ELU4_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          a-----ag------------------agc---gc---aggcac-agcgac
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K5HKU7_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K6N196_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K6PUL3_BAD-01      a-----ag------------------agc---gc---gggtac-agcgac
A0A0D9R491_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K5M0A7_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K5XJR2_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K6E7I4_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A2K5VCA1_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
A0A1D5QBW1_BAD-01      a-----ag------------------agc---gc---gggcac-agcgac
Q2PG01_BAD-01          a-----ag------------------agc---gc---gggcac-agcgac
A0A2K5PDB1_BAD-01      a-----ag------------------agc---gc---gggcac-agcaac
A0A2K6TG62_BAD-01      a-----ag------------------agc---gc---gggcac-agcaac
A0A2K5E6A6_BAD-01      a-----ag------------------agc---gc---gggcac-agcaac
U3F2S3_BAD-01          a-----ag------------------agc---gc---gggcac-agcaac
A0A2J8TYJ3_BAD-02      a-----ag------------------agc---gc---gggcac-agcaac
A0A2J8TYJ3_BAD-03      a-----ag------------------agc---gc---gggcac-agcaac
A0A2I3H4B2_BAD-01      a-----ag------------------agc---gc---gggcac-agcaac
B4DZQ9_BAD-01          a-----ag------------------agc---gc---gggcac-agcaac
A0A2I2YFH2_BAD-01      a-----ag------------------agc---gc---aggcac-agcaac
A0A2I2YFH2_BAD-02      a-----ag------------------agc---gc---aggcac-agcaac
A0A2I3TBK7_BAD-02      a-----ag------------------agc---gc---gggcac-agcaac
A0A2R8Z674_BAD-01      a-----ag------------------agc---gc---gggcac-agcaac
Q92934_BAD-01          a-----ag------------------agc---gc---gggcac-agcaac
Q92934_BAD-02          a-----ag------------------agc---gc---gggcac-agcaac
Q92934_BAD-05          a-----ag------------------agc---gc---gggcac-agcaac
Q92934_BAD-06          a-----ag------------------agc---gc---gggc---------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          tgagatgacc----------gttag-------------caagagtttcgg
H3ANP3_BAD-03          agaaatg-------------gtgga-------------cgagagct--gg
H3ANP3_BAD-01          agaaatg-------------gtgga-------------cgagagct--gg
H3ANP3_BAD-02          agaaatg-------------gtgga-------------cgagagct--gg
H3ANP3_BAD-04          agaaatg-------------gtgga-------------cgagagct--gg
E7FBJ6_BAD-01          acag----------------accta-------------ccgaggat--gg
A0A672LB88_BAD-01      acag----------------accta-------------ccgaggat--gg
A0A671PX91_BAD-01      acag----------------accta-------------ccgaggat--gg
A0A673J5Q9_BAD-01      acag----------------accta-------------ccgaggat--gg
A0A672R7P6_BAD-01      acag----------------accta-------------ccgaggat--gg
A0A671SBB4_BAD-01      acag----------------accta-------------ccgtggat--gg
A0A673I6H5_BAD-01      acag----------------accta-------------ccgaggat--gg
A0A4W4DXF5_BAD-01      gcag----------------accaa-------------ccaaggat--gg
A0A3P8YI30_BAD-01      gcag----------------gtcta-------------cagaggat--gg
A0A3P8YI30_BAD-02      gcag----------------gtcta-------------cagaggat--gg
A0A6F9BAV3_BAD-01      gcagaaa-------------gtctc-------------ccgaggat--gg
A0A060W8W7_BAD-01      gcagaaa-------------gtctc-------------ccgaggat--gg
A0A4W5MZR2_BAD-01      gcagaaa-------------gtctc-------------ccgaggat--gg
A0A674AVP9_BAD-01      gcagaaa-------------gtctc-------------ccgaggat--gg
A0A1S3L0Z2_BAD-01      gcagaaa-------------gtctc-------------ccgaggat--gg
B5XEF1_BAD-01          gcagaaa-------------gtctc-------------ccgaggat--gg
B5X1T1_BAD-01          gcaggag-------------gtctc-------------ccgaggat--gg
A0A673ZHY7_BAD-01      gcaggag-------------gtctc-------------ccgaggat--gg
A0A4W5R1T6_BAD-01      gcaggag-------------gtctc-------------ccgaggat--gg
A0A060W8P9_BAD-01      gcaggag-------------gtctc-------------ccgaggat--gg
A0A3B1JLM2_BAD-01      gcat----------------accaa-------------ccgaggat--gg
A0A3B4DUY7_BAD-01      gcag----------------acgaa-------------ccgaggat--gg
A0A672V9F8_BAD-01      --ggggggg----tggcgcgaggtgct-----------gaggagct--gg
A0A674GQ16_BAD-01      gggggggggcggctggcgcgagaccct-----------ccgggcct--gg
A7MCM4_BAD-01          tcagatg--a----------gtcaatc-----------gcccagct--gg
Q4V925_BAD-02          tcagatg--a----------gtcaatc-----------gcccagct--gg
Q4V925_BAD-03          tcagatg--a----------gtcaatc-----------gcccagct--gg
Q4V925_BAD-01          tcagatg--a----------gtcaatc-----------gcccagct--gg
Q4V925_BAD-04          tcagatg--a----------gtcaatc-----------gcccagct--gg
A0A671NP27_BAD-01      tcagatg--c----------agcagtc-----------acccagct--gg
A0A672SAE4_BAD-01      tcagatg--c----------agcagtc-----------acccagct--gg
A0A672SAE4_BAD-02      tcagatg--c----------agcagtc-----------acccagct--gg
A0A673J9C6_BAD-01      tcagatg--c----------agcagtc-----------acccagct--gg
A0A672RGH0_BAD-01      tcagatg--c----------ggcagtc-----------ccccagct--gg
A0A671RUV0_BAD-01      gcagatg--c----------ggcagtc-----------ccccagct--gg
A0A673HRQ3_BAD-01      tcagatg--c----------ggcagtc-----------ccccagct--gg
A0A4W4HE29_BAD-01      tcagatg--c----------acacatc-----------ccccagct--gg
A0A3B1IH05_BAD-01      ccagatg--c----------aaaactc-----------ccccagct--gg
A0A3B4CPH6_BAD-01      tcagatg--c----------acgcttc-----------ccccagct--gg
A0A670YRG7_BAD-01      ccacatggacc---------gccctcc-----------tcccagct--gg
A0A670JUY4_BAD-01      ccaaatg--c----------gccggac-----------gttgggct--gg
A0A3P8Y761_BAD-01      acagatg--a----------caacatc-----------cccgagct--gg
A0A3P8Y761_BAD-02      acagatg--a----------caacatc-----------cccgagct--gg
A0A667ZNC6_BAD-01      acagatg--c----------agcactc-----------caaaagct--gg
A0A6F9CQZ0_BAD-02      acagatg--a----------cacagtc-----------ccccagct--gg
A0A6F9CA11_BAD-02      acagatg--a----------caaagtc-----------ccccagct--gg
A0A4W5JLL9_BAD-01      acagatg--a----------ccaagtc-----------ccccagct--gg
A0A4W5JLL9_BAD-02      acagatg--a----------ccaagtc-----------ccccagct--gg
A0A1S3N9Q3_BAD-01      acagatg--a----------ccaagtc-----------ccccagct--gg
A0A674DKC6_BAD-01      acagatg--a----------ccaagtc-----------ccccagct--gg
A0A3Q2Y0E4_BAD-01      ggccatc--c----------accactc-----------caaaacct--gg
A0A668V3Q4_BAD-01      -aagctg--c----------accactc-----------taaaacct--gg
I3K7B6_BAD-01          -aagctg--c----------accactc-----------taaaacct--gg
A0A3P9B2E4_BAD-01      -aa-----------------------------------------------
A0A3Q4GGN3_BAD-01      -aagctg--c----------accactc-----------taaaacct--gg
A0A3P8QRJ7_BAD-01      -aagctg--c----------accactc-----------taaaacct--gg
A0A3Q3C680_BAD-01      -aagctg--c----------accactc-----------taaaacct--gg
A0A3B4GXJ6_BAD-01      -aagctg--c----------accactc-----------taaaacct--gg
A0A3Q0QNQ2_BAD-01      aaagatg--c----------accactc-----------taaaacct--gg
A0A3Q0QNQ2_BAD-02      aaagatg--c----------accactc-----------taaaacct--gg
A0A3Q3WTY4_BAD-01      acagatg--c----------accagtc-----------tcgaagct--gg
A0A672JQ68_BAD-01      acagatt--c----------accactc-----------tagaagct--gg
A0A3P8WI83_BAD-01      acagatg--c----------accactc-----------caaaagct--gg
A0A3P8WI83_BAD-02      acagatg--c----------accactc-----------caaaagct--gg
A0A3Q3FKT9_BAD-03      acagatg--c----------accactc-----------caagagtt--gg
A0A3Q3FKT9_BAD-01      ggagtcggtc----------gtctctcaaccgaaaagtcaggagtt--ca
A0A3Q3FKT9_BAD-02      ggagtcggtc----------gtctctcaaccgaaaagtcaggagtt--ca
G3Q8B3_BAD-01          acagatg--c----------agcactc-----------caagagct--gg
A0A3Q1K1C7_BAD-01      acagatg--c----------accactc-----------taagagct--gg
A0A672YF93_BAD-01      acagatg--c----------accactc-----------taaaactt--gg
A0A3Q3RXS8_BAD-01      aaagatg--c----------accactc-----------taaaacct--gg
A0A3Q3R5S3_BAD-01      ccagatg--c----------accactc-----------taaaagct--gg
H3D8J8_BAD-01          gcagatg--c----------accactc-----------ccgcagct--gg
A0A674MXC1_BAD-01      accgatg--c----------accactc-----------ccggagct--gg
A0A674MXC1_BAD-02      accgatg--c----------accactc-----------ccggagct--gg
A0A674MXC1_BAD-03      accgatg--c----------accactc-----------ccggagct--gg
A0A674MXC1_BAD-04      accgatg--c----------accactc-----------ccggagct--gg
A0A3B5BAL2_BAD-01      acagatg--c----------accactc-----------taaaagct--gg
A0A3Q1GWH9_BAD-01      acagatg--c----------accactc-----------taaaagct--gg
A0A3Q1CPU7_BAD-01      acagatg--c----------accactc-----------taaaagct--gg
A0A3P8TWH6_BAD-01      acagatg--c----------accactc-----------taaaagct--gg
A0A2U9BAC9_BAD-01      acagatg--c----------accactc-----------tcaaagct--gg
A0A671TL42_BAD-01      acagatg--c----------accactc-----------gaggagct--gg
A0A665TUH3_BAD-01      acagatg--c----------accactc-----------taaaagct--gg
A0A4W6EMZ7_BAD-01      acagatg--c----------accactc-----------taaaagct--gg
A0A4W6EMZ7_BAD-02      acagatg--c----------accactc-----------taaaagct--gg
A0A3B4VFC5_BAD-01      acagatg--c----------accactc-----------taaaagct--gg
A0A3B4W9T1_BAD-01      acagatg--c----------accactc-----------taaaagct--gg
A0A3B3BQF7_BAD-01      acagatg--c----------accactc-----------cacgagct--gg
A0A3P9HNZ2_BAD-01      acagatg--c----------tccactc-----------cacgagct--gg
A0A3B3HDU2_BAD-01      acagatg--c----------tccactc-----------cacgagct--gg
A0A3P9KSL7_BAD-01      acagatg--c----------tccactc-----------cacgagct--gg
A0A3P9KSL7_BAD-02      acagatg--c----------tccactc-----------cacgagct--gg
A0A3Q3AEL8_BAD-01      acagata--c----------accactc-----------ccgaagct--gg
A0A3Q3AEL8_BAD-02      acagata--c----------accactc-----------ccgaagct--gg
A0A1A8AQV0_BAD-01      acccatg--c----------accactc-----------caggagct--gg
A0A3Q2QC80_BAD-01      acccatt--c----------accactc-----------caggagct--gg
A0A3Q2D5S0_BAD-01      accaata--c----------gccattc-----------caagagct--gg
A0A3B5L9R9_BAD-01      accgatt--c----------accactc-----------caggagct--gg
A0A3B5Q2N7_BAD-01      accgatt--c----------accactc-----------caggagct--gg
A0A3P9Q7C3_BAD-01      accgatc--c----------accactc-----------caggagct--gg
A0A3B3YFR1_BAD-01      accgata--c----------accactc-----------caggagct--gg
A0A087X8P8_BAD-01      accgata--c----------accactc-----------caggagct--gg
A0A3B3UA11_BAD-01      accgata--c----------accactc-----------caggagct--gg
A0A452IFQ4_BAD-01      ccagctc--c----------accgggg-----------gaacagct--gg
A0A674I2R9_BAD-01      ccagctg--c----------accgggg-----------gaacagct--gg
A0A3B3QX41_BAD-01      acagatg--c----------aggcgtc-----------ccccagct--gg
A0A5F8GA49_BAD-01      ccagatg--c----------gtcggag-----------ccacggtt--gg
G3VRY3_BAD-01          ccagatg--c----------gtcggag-----------ccatggct--gg
G3VRY3_BAD-02          ccagatg--c----------gtcggag-----------ccatggct--gg
G3VRY3_BAD-03          ccagatg--c----------gtcggag-----------ccatggct--gg
A0A4X2KAA5_BAD-01      tcagatg--c----------gtcggag-----------ccacggct--gg
A0A6I8NVP2_BAD-01      gcagttg--c----------agcgacc-----------ctcgggct--gg
Q61337_BAD-09          ccgtgtc--tctgaccgcccagtgcag-----------agcaagct--gg
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          tctaatc--c----------g------------------------t--cc
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-05          --aggtg--c----------ga----------------------------
Q61337_BAD-01          acagatg--c----------gacaaag-----------cgccggct--gg
Q61337_BAD-03          acagatg--c----------gacaaag-----------cgccggct--gg
Q61337_BAD-04          acagatg--c----------gacaaag-----------cgccggct--gg
Q61337_BAD-06          acagatg--c----------gacaaag-----------cgccggct--gg
G1P8C5_BAD-01          gcagatg--t----------ggcaaaa-----------gtccagct--gg
A0A4X1VE31_BAD-01      ccaggcc--cccctccagaaggccaag-----------actc--ct--g-
A0A287AEF3_BAD-01      gcagatg--c----------ggcaaag-----------ccccagct--gg
A0A4X1VE31_BAD-02      gcagatg--c----------ggcaaag-----------ccccagct--gg
A0A4X1VE31_BAD-03      gcagatg--c----------ggcaaag-----------ccccagct--gg
F7DN67_BAD-01          gcagatg--c----------ggcaaag-----------ccccagct--gg
M3YNE7_BAD-01          gcagatg--c----------gacagag-----------ccccagtt--gg
A0A673V6P8_BAD-01      gcagatg--c----------ggcaaag-----------ccccagct--gg
A0A337SAW2_BAD-01      gcagatg--c----------ggcaaag-----------ccccagct--gg
A0A667H8Z9_BAD-01      gcagatg--c----------ggcaaag-----------ccccagct--gg
A0A452RJM6_BAD-01      gcagatg--c----------gacaaag-----------ccccagct--gg
A0A384DJL2_BAD-01      gcagatg--c----------gacaaag-----------ccccagct--gg
Q45KI9_BAD-01          gcagatg--c----------gacaaag-----------ccccagct--gg
A0A3Q7SWS0_BAD-01      gcagatg--c----------gacaaag-----------ccccagct--gg
A0A4W2C9A8_BAD-01      gcaaatg--c----------gacaaag-----------ccccagct--gg
A0A4W2C9A8_BAD-01      gcaaatg--c----------gacaaag-----------ccccagct--gg
F1MUT9_BAD-01          gcaaatg--c----------gacaaag-----------ccccagct--gg
Q3SYZ0_BAD-01          ggaaatg--c----------gacaaag-----------ccccagct--gg
A0A452ER54_BAD-01      gcaaatg--c----------gacaaag-----------ccctagct--gg
A0A452ER54_BAD-02      gcaaatg--c----------gacaaag-----------ccctagct--gg
W5P8G9_BAD-01          gcaaatg--c----------gacaaag-----------ccctagct--gg
A0A4U1FMC3_BAD-01      gcagatg--c----------gacaaag-----------ccccagct--gg
A0A2Y9EHU3_BAD-01      gcagatg--c----------gacaaag-----------ccccagct--gg
G3TP47_BAD-01          gcagatg--c----------ggcaaag-----------ccccagct--gg
A0A2K5E6A6_BAD-02      gcagatg--c----------ggcaaag-----------ctccagtt--gg
A0A2K5PDB1_BAD-02      gcagatg--c----------ggcaaag-----------cgccagct--gg
A0A2K6TG62_BAD-02      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2I2YFH2_BAD-03      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2R8Z674_BAD-02      gcagatg--c----------ggcaaag-----------ctccagct--gg
Q92934_BAD-03          gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2I3TBK7_BAD-01      ccagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K6E7I4_BAD-02      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K5M0A7_BAD-02      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K5XJR2_BAD-02      gcagatg--c----------ggcaaag-----------ctccagct--gg
G5B6Q3_BAD-01          gaagctg--t----------ggcagag-----------ctccagtt--gg
G5B6Q3_BAD-02          gaagctg--t----------ggcagag-----------ctccagtt--gg
H0V608_BAD-01          gaagctg--t----------ggcagaa-----------ctctaatt--gg
A0A287CT05_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A287CT05_BAD-02      ----------------------------------------ccagtc----
A0A671ELU4_BAD-01      gcagatg--c----------ggcaaaa-----------ctccagct--gg
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          acagatg--c----------gacagag-----------ctccagct--gg
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      gcagata--c----------ggcagag-----------ctccagct--gg
A0A2K5HKU7_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K6N196_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K6PUL3_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A0D9R491_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K5M0A7_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K5XJR2_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K6E7I4_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K5VCA1_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A1D5QBW1_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
Q2PG01_BAD-01          gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K5PDB1_BAD-01      gcagatg--c----------ggcaaag-----------cgccagct--gg
A0A2K6TG62_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2K5E6A6_BAD-01      gcagatg--c----------ggcaaag-----------ctccagtt--gg
U3F2S3_BAD-01          gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2J8TYJ3_BAD-02      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2J8TYJ3_BAD-03      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2I3H4B2_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
B4DZQ9_BAD-01          gcagatg--c----------ggcaaag-----------ccccaggc--gc
A0A2I2YFH2_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2I2YFH2_BAD-02      gcagatg--c----------ggcaaag-----------ctccagct--gg
A0A2I3TBK7_BAD-02      ccagatg--c----------ggcaaag-----------ctccagct--gg
A0A2R8Z674_BAD-01      gcagatg--c----------ggcaaag-----------ctccagct--gg
Q92934_BAD-01          gcagatg--c----------ggcaaag-----------ctccagct--gg
Q92934_BAD-02          gcagatg--c----------ggcaaag-----------ctccagct--gg
Q92934_BAD-05          gcagatg--c----------ggcaaag-----------ctccagct--gg
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          agaaacattttttaacttctttagaag-----------------------
H3ANP3_BAD-03          tggaagaa-------actg-------------------------------
H3ANP3_BAD-01          tggaagaa-------actg-------------------------------
H3ANP3_BAD-02          tggaagaa-------actg-------------------------------
H3ANP3_BAD-04          tggaagaa-------actg-------------------------------
E7FBJ6_BAD-01          ttttcgtt-------cctctggagt-------------------------
A0A672LB88_BAD-01      ttctcgtt-------cctctggagt-------------------------
A0A671PX91_BAD-01      ttctcgtt-------cctctggagt-------------------------
A0A673J5Q9_BAD-01      ttctcgtt-------cctctggagt-------------------------
A0A672R7P6_BAD-01      ttctcgtt-------cctctggagt-------------------------
A0A671SBB4_BAD-01      ttctcgtt-------cctcttgagt-------------------------
A0A673I6H5_BAD-01      ttctcgtt-------cctctggagt-------------------------
A0A4W4DXF5_BAD-01      ttctcttt-------cctttggtgt-------------------------
A0A3P8YI30_BAD-01      ttctcgtt-------cctctggagt-------------------------
A0A3P8YI30_BAD-02      ttctcgtt-------cctctggagt-------------------------
A0A6F9BAV3_BAD-01      ttctcttt-------cctctggagt-------------------------
A0A060W8W7_BAD-01      ttctcttt-------cctctggagt-------------------------
A0A4W5MZR2_BAD-01      ttctcttt-------cctctggagt-------------------------
A0A674AVP9_BAD-01      ttctcttt-------cctctggagt-------------------------
A0A1S3L0Z2_BAD-01      ttctcttt-------cctctggagt-------------------------
B5XEF1_BAD-01          ttctcttt-------cctctggagt-------------------------
B5X1T1_BAD-01          ttctcttt-------cctctggagt-------------------------
A0A673ZHY7_BAD-01      ttctcttt-------cctctggagt-------------------------
A0A4W5R1T6_BAD-01      ttctcttt-------cctctggagt-------------------------
A0A060W8P9_BAD-01      ttctcttt-------cctctggagt-------------------------
A0A3B1JLM2_BAD-01      ttctcttt-------cctctggggt-------------------------
A0A3B4DUY7_BAD-01      ttctcttt-------tctctggggt-------------------------
A0A672V9F8_BAD-01      tggggggc-------cccgccccccccccggccccgccccgccgcgaccc
A0A674GQ16_BAD-01      tgggggtc-------ccgacggcccc----gccccgcccccccg-gcccc
A7MCM4_BAD-01          ttggcatt-------tctttggagtca-----------------------
Q4V925_BAD-02          ttggcatt-------tctttggagtca-----------------------
Q4V925_BAD-03          ttggcatt-------tctttggagtca-----------------------
Q4V925_BAD-01          ttggcatt-------tctttggagtca-----------------------
Q4V925_BAD-04          ttggcatt-------tctttggagtca-----------------------
A0A671NP27_BAD-01      ttcgcttt-------cctttggagtca-----------------------
A0A672SAE4_BAD-01      ttcgcttt-------cctttggagtca-----------------------
A0A672SAE4_BAD-02      ttcgcttt-------cctttggagtca-----------------------
A0A673J9C6_BAD-01      ttcgcttt-------cctttggagtca-----------------------
A0A672RGH0_BAD-01      ttggcctt-------cctttggagtca-----------------------
A0A671RUV0_BAD-01      ttggcctt-------cctttggagtca-----------------------
A0A673HRQ3_BAD-01      ttggcctt-------cctttggagtca-----------------------
A0A4W4HE29_BAD-01      ttcgcctt-------cctctggagcca-----------------------
A0A3B1IH05_BAD-01      tttgcctt-------tctttggagtca-----------------------
A0A3B4CPH6_BAD-01      ttcacctt-------cttatggagcca-----------------------
A0A670YRG7_BAD-01      aaagacac-------cctg--cggt-------------------------
A0A670JUY4_BAD-01      aaggaggt-------tctg--cagt-------------------------
A0A3P8Y761_BAD-01      tgggcctt-------cctgttcagcca-----------------------
A0A3P8Y761_BAD-02      tgggcctt-------cctgttcagcca-----------------------
A0A667ZNC6_BAD-01      tggaacta-------cctcttcagtca-----------------------
A0A6F9CQZ0_BAD-02      tgggccta-------cctgttcagtca-----------------------
A0A6F9CA11_BAD-02      tgggccta-------cctgttcagcca-----------------------
A0A4W5JLL9_BAD-01      tgggccta-------cctgttcagtca-----------------------
A0A4W5JLL9_BAD-02      tgggccta-------cctgttcagtca-----------------------
A0A1S3N9Q3_BAD-01      tgggccta-------cctgttcagtca-----------------------
A0A674DKC6_BAD-01      tgggccta-------cctgttcagtca-----------------------
A0A3Q2Y0E4_BAD-01      tggagcta-------cctcttcagcca-----------------------
A0A668V3Q4_BAD-01      tggagcta-------cctctttagtca-----------------------
I3K7B6_BAD-01          tggagcta-------cctctttagtca-----------------------
A0A3P9B2E4_BAD-01      --------------------------------------------------
A0A3Q4GGN3_BAD-01      tggagcta-------tctctttagtca-----------------------
A0A3P8QRJ7_BAD-01      tggagcta-------tctctttagtca-----------------------
A0A3Q3C680_BAD-01      tggagcta-------tctctttagtca-----------------------
A0A3B4GXJ6_BAD-01      tggagcta-------tctctttagtca-----------------------
A0A3Q0QNQ2_BAD-01      tggagcta-------tctctttagtca-----------------------
A0A3Q0QNQ2_BAD-02      tggagcta-------tctctttagtca-----------------------
A0A3Q3WTY4_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A672JQ68_BAD-01      tggagcta-------cctcttcagcca-----------------------
A0A3P8WI83_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A3P8WI83_BAD-02      tggagcta-------cctctttagtca-----------------------
A0A3Q3FKT9_BAD-03      tggagcta-------cctcttcagcca-----------------------
A0A3Q3FKT9_BAD-01      atacccag-------ctcctgcagccacatgtccgatgtgtccttgggtc
A0A3Q3FKT9_BAD-02      atacccag-------ctcctgcagccacatgtccgatgtgtccttgggtc
G3Q8B3_BAD-01          tggagttc-------cctctttagtca-----------------------
A0A3Q1K1C7_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A672YF93_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A3Q3RXS8_BAD-01      tggagcta-------cctctttagtta-----------------------
A0A3Q3R5S3_BAD-01      tggagcta-------cctctttagtca-----------------------
H3D8J8_BAD-01          tggagcta-------cctgttcagcca-----------------------
A0A674MXC1_BAD-01      tggagcta-------cctgttcagcca-----------------------
A0A674MXC1_BAD-02      tggagcta-------cctgttcagcca-----------------------
A0A674MXC1_BAD-03      tggagcta-------cctgttcagcca-----------------------
A0A674MXC1_BAD-04      tggagcta-------cctgttcagcca-----------------------
A0A3B5BAL2_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A3Q1GWH9_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A3Q1CPU7_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A3P8TWH6_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A2U9BAC9_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A671TL42_BAD-01      tggagcta-------cctcttcagcca-----------------------
A0A665TUH3_BAD-01      tggaacta-------cctctttagtca-----------------------
A0A4W6EMZ7_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A4W6EMZ7_BAD-02      tggagcta-------cctctttagtca-----------------------
A0A3B4VFC5_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A3B4W9T1_BAD-01      tggagcta-------cctctttagtca-----------------------
A0A3B3BQF7_BAD-01      tggaacta-------cctcttcagcca-----------------------
A0A3P9HNZ2_BAD-01      tggaacta-------cctcttcagcca-----------------------
A0A3B3HDU2_BAD-01      tggaacta-------cctcttcagcca-----------------------
A0A3P9KSL7_BAD-01      tggaacta-------cctcttcagcca-----------------------
A0A3P9KSL7_BAD-02      tggaacta-------cctcttcagcca-----------------------
A0A3Q3AEL8_BAD-01      tggaacta-------cctctttagtca-----------------------
A0A3Q3AEL8_BAD-02      tggaacta-------cctctttagtca-----------------------
A0A1A8AQV0_BAD-01      tggaacta-------cctcttcagtca-----------------------
A0A3Q2QC80_BAD-01      tggaacta-------cctcttcagcca-----------------------
A0A3Q2D5S0_BAD-01      tggagcta-------cctcttcagtca-----------------------
A0A3B5L9R9_BAD-01      tggagcta-------cctcttcagtca-----------------------
A0A3B5Q2N7_BAD-01      tggagcta-------cctcttcagtca-----------------------
A0A3P9Q7C3_BAD-01      tggagcta-------cctcttcagtca-----------------------
A0A3B3YFR1_BAD-01      tggagcta-------cctcttcagtca-----------------------
A0A087X8P8_BAD-01      tggagcta-------cctcttcagtca-----------------------
A0A3B3UA11_BAD-01      tggagcta-------cctcttcagtca-----------------------
A0A452IFQ4_BAD-01      aaagagac-------cctc--cagg-------------------------
A0A674I2R9_BAD-01      aaagaaac-------cctc--cagg-------------------------
A0A3B3QX41_BAD-01      ttcgcctt-------tctc--tggagc-----------------------
A0A5F8GA49_BAD-01      acccgcac-------cgtc--cagt-------------------------
G3VRY3_BAD-01          acccgcac-------cttc--cagt-------------------------
G3VRY3_BAD-02          acccgcac-------cttc--cagt-------------------------
G3VRY3_BAD-03          acccgcac-------cttc--cagt-------------------------
A0A4X2KAA5_BAD-01      gcccgcac-------cttc--cagt-------------------------
A0A6I8NVP2_BAD-01      acccgcgt-------cctc--cgct-------------------------
Q61337_BAD-09          tggtgggg-------acct--gatt-------------------------
Q6P7C5_BAD-01          --------------------------------------------------
Q61337_BAD-07          tctctcag-------tgtc--cagtga-----------------------
Q61337_BAD-02          ----gctt-------gagt--ccct-------------------------
Q61337_BAD-05          --------------------------------------------------
Q61337_BAD-01          acgcgcat-------tatc--cagt-------------------------
Q61337_BAD-03          acgcgcat-------tatc--cagt-------------------------
Q61337_BAD-04          acgcgcat-------tatc--cagt-------------------------
Q61337_BAD-06          acgcgcat-------tatc--cagt-------------------------
G1P8C5_BAD-01          acgcgctt-------tttc--cagt-------------------------
A0A4X1VE31_BAD-01      ----gctt-------cccc--aaat-------------------------
A0A287AEF3_BAD-01      aagcgctt-------cctc--cagt-------------------------
A0A4X1VE31_BAD-02      aagcgctt-------cctc--cagt-------------------------
A0A4X1VE31_BAD-03      aagcgctt-------cctc--cagt-------------------------
F7DN67_BAD-01          acgcgcgc-------catc--cagt-------------------------
M3YNE7_BAD-01          acgcgcgt-------catc--cagt-------------------------
A0A673V6P8_BAD-01      acgcgctt-------catc--cagt-------------------------
A0A337SAW2_BAD-01      acgcgctt-------catc--cagt-------------------------
A0A667H8Z9_BAD-01      acgcgctt-------catc--cagt-------------------------
A0A452RJM6_BAD-01      acgcgcgt-------catc--cagt-------------------------
A0A384DJL2_BAD-01      acgcgcgt-------catc--cagt-------------------------
Q45KI9_BAD-01          acgcgcgt-------catc--cagt-------------------------
A0A3Q7SWS0_BAD-01      acgcgcgt-------catc--cagt-------------------------
A0A4W2C9A8_BAD-01      acgcgctt-------cctc--cagt-------------------------
A0A4W2C9A8_BAD-01      acgcgctt-------cctc--cagt-------------------------
F1MUT9_BAD-01          acgcgctt-------cctc--cagt-------------------------
Q3SYZ0_BAD-01          acgcgctt-------cctc--cagt-------------------------
A0A452ER54_BAD-01      acgcgctt-------cctc--cagt-------------------------
A0A452ER54_BAD-02      acgcgctt-------cctc--cagt-------------------------
W5P8G9_BAD-01          acgcgctt-------cctc--cagt-------------------------
A0A4U1FMC3_BAD-01      acgcgctt-------cctt--cagt-------------------------
A0A2Y9EHU3_BAD-01      acgcgctt-------cctt--cagt-------------------------
G3TP47_BAD-01          acacgcat-------catc--cagg-------------------------
A0A2K5E6A6_BAD-02      acgcaagt-------catc--cagt-------------------------
A0A2K5PDB1_BAD-02      acgcgagt-------catc--cagt-------------------------
A0A2K6TG62_BAD-02      acgcgagt-------catc--cagt-------------------------
A0A2I2YFH2_BAD-03      acgcgagt-------cttc--cagt-------------------------
A0A2R8Z674_BAD-02      acgcgagt-------cttc--cagt-------------------------
Q92934_BAD-03          acgcgagt-------cttc--cagt-------------------------
A0A2I3TBK7_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A2K6E7I4_BAD-02      acgcgagt-------cttc--cagt-------------------------
A0A2K5M0A7_BAD-02      acgcgagt-------cttc--cagt-------------------------
A0A2K5XJR2_BAD-02      acgcgagt-------cttc--cagt-------------------------
G5B6Q3_BAD-01          acacgcgc-------catc--cagt-------------------------
G5B6Q3_BAD-02          acacgcgc-------catc--cagt-------------------------
H0V608_BAD-01          acacgggc-------catc--cagt-------------------------
A0A287CT05_BAD-01      acgcgctt-------catc--cagt-------------------------
A0A287CT05_BAD-02      -----------------cc--catt-------------------------
A0A671ELU4_BAD-01      acacgcat-------cttc--cagt-------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      --------------------------------------------------
A0A2I2YFH2_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K6E7I4_BAD-03      --------------------------------------------------
A0A2K5M0A7_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2K5HKU7_BAD-02      --------------------------------------------------
A0A2K6N196_BAD-02      --------------------------------------------------
A0A2K6PUL3_BAD-02      --------------------------------------------------
H0WVR2_BAD-01          acgcgtgt-------catt--cagt-------------------------
A0A2K5E6A6_BAD-03      --------------------------------------------------
A0A2K6GWV0_BAD-01      acgcgcgt-------catt--cagt-------------------------
A0A2K5HKU7_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A2K6N196_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A2K6PUL3_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A0D9R491_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A2K5M0A7_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A2K5XJR2_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A2K6E7I4_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A2K5VCA1_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A1D5QBW1_BAD-01      acgcgagt-------cttc--cagt-------------------------
Q2PG01_BAD-01          acgcgagt-------cttc--cagt-------------------------
A0A2K5PDB1_BAD-01      acgcgagt-------catc--cagt-------------------------
A0A2K6TG62_BAD-01      acgcgagt-------catc--cagt-------------------------
A0A2K5E6A6_BAD-01      acgcaagt-------catc--cagt-------------------------
U3F2S3_BAD-01          acgcgagt-------catc--cagt-------------------------
A0A2J8TYJ3_BAD-02      acgcgagt-------cttc--caat-------------------------
A0A2J8TYJ3_BAD-03      acgcgagt-------cttc--caat-------------------------
A0A2I3H4B2_BAD-01      acgcgagt-------cttc--cagt-------------------------
B4DZQ9_BAD-01          ctgcgc--------------------------------------------
A0A2I2YFH2_BAD-01      acgcgagt-------cttc--cagt-------------------------
A0A2I2YFH2_BAD-02      acgcgagt-------cttc--cagt-------------------------
A0A2I3TBK7_BAD-02      acgcgagt-------cttc--cagt-------------------------
A0A2R8Z674_BAD-01      acgcgagt-------cttc--cagt-------------------------
Q92934_BAD-01          acgcgagt-------cttc--cagt-------------------------
Q92934_BAD-02          acgcgagt-------cttc--cagt-------------------------
Q92934_BAD-05          acgcga--------------------------------------------
Q92934_BAD-06          --------------------------------------------------
A0A2K5PDB1_BAD-03      --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          ----------------------------------aaagaaca------aa
H3ANP3_BAD-03          ----------------------------------atacgctctctaaagg
H3ANP3_BAD-01          ----------------------------------atacgctctctaaagg
H3ANP3_BAD-02          ----------------------------------atacgctctctaaagg
H3ANP3_BAD-04          ----------------------------------atacgctctctaaagg
E7FBJ6_BAD-01          cccaa-----------------------------agaagaag------ag
A0A672LB88_BAD-01      tccaa-----------------------------agaagagg------ag
A0A671PX91_BAD-01      cccaa-----------------------------agaagagg------ag
A0A673J5Q9_BAD-01      cccaa-----------------------------agaagagg------ag
A0A672R7P6_BAD-01      tccaa-----------------------------agacgagg------ag
A0A671SBB4_BAD-01      tccaa-----------------------------agaagagg------ag
A0A673I6H5_BAD-01      tccaa-----------------------------agaagagg------ag
A0A4W4DXF5_BAD-01      tccaa-----------------------------ggaagagg------aa
A0A3P8YI30_BAD-01      ccaaa-----------------------------ggaagctg------aa
A0A3P8YI30_BAD-02      ccaaa-----------------------------ggaagctg------aa
A0A6F9BAV3_BAD-01      ccaaa-----------------------------ggaggccg------aa
A0A060W8W7_BAD-01      ccaaa-----------------------------ggaggcag------aa
A0A4W5MZR2_BAD-01      ccaaa-----------------------------ggaggcgg------aa
A0A674AVP9_BAD-01      ccaaa-----------------------------ggaggcgg------aa
A0A1S3L0Z2_BAD-01      ccaaa-----------------------------ggaggcgg------aa
B5XEF1_BAD-01          ccaaa-----------------------------ggaggcgg------aa
B5X1T1_BAD-01          ccaaa-----------------------------aaaggctg------aa
A0A673ZHY7_BAD-01      ccaaa-----------------------------aaaggctg------aa
A0A4W5R1T6_BAD-01      ccaaa-----------------------------ggagtcgg------aa
A0A060W8P9_BAD-01      ccaaa-----------------------------cgaggccg------aa
A0A3B1JLM2_BAD-01      accaa-----------------------------agaagagg------ag
A0A3B4DUY7_BAD-01      tccaa-----------------------------agaagaag------aa
A0A672V9F8_BAD-01      ccccattgacagcccccccccgggtccccccccca-----cgcttcgggg
A0A674GQ16_BAD-01      cccccctgaccgac-----------cccccccccaaaaacctcatctggg
A7MCM4_BAD-01          ca--------------------------------aagagtct------ga
Q4V925_BAD-02          ca--------------------------------aagagtct------ga
Q4V925_BAD-03          ca--------------------------------aagagtct------ga
Q4V925_BAD-01          ca--------------------------------aagagtct------ga
Q4V925_BAD-04          ca--------------------------------aagagtct------ga
A0A671NP27_BAD-01      ca--------------------------------aagagtct------ga
A0A672SAE4_BAD-01      ca--------------------------------aagagtct------ga
A0A672SAE4_BAD-02      ca--------------------------------aagagtct------ga
A0A673J9C6_BAD-01      ca--------------------------------aagagtct------ga
A0A672RGH0_BAD-01      ca--------------------------------aagagtct------ga
A0A671RUV0_BAD-01      ca--------------------------------aagagtct------ga
A0A673HRQ3_BAD-01      ca--------------------------------aagagtct------ga
A0A4W4HE29_BAD-01      ca--------------------------------aagagtca------ga
A0A3B1IH05_BAD-01      ca--------------------------------aggaatca------ga
A0A3B4CPH6_BAD-01      ca--------------------------------aagagtca------ga
A0A670YRG7_BAD-01      cgtggtggctttactc------------------cggatctg------ac
A0A670JUY4_BAD-01      catggtggcgt-----------------------cggaattc------cc
A0A3P8Y761_BAD-01      ca--------------------------------aggaaact------ga
A0A3P8Y761_BAD-02      ca--------------------------------aggaaact------ga
A0A667ZNC6_BAD-01      cc--------------------------------aggagaca------ga
A0A6F9CQZ0_BAD-02      tc--------------------------------aggagaca------ga
A0A6F9CA11_BAD-02      cc--------------------------------aagagaca------ga
A0A4W5JLL9_BAD-01      ta--------------------------------aggagaca------ga
A0A4W5JLL9_BAD-02      ta--------------------------------aggagaca------ga
A0A1S3N9Q3_BAD-01      ta--------------------------------aggagaca------ga
A0A674DKC6_BAD-01      ta--------------------------------aggagaca------ga
A0A3Q2Y0E4_BAD-01      cc--------------------------------aggagacg------ga
A0A668V3Q4_BAD-01      cc--------------------------------aagagact------ga
I3K7B6_BAD-01          cc--------------------------------aagagact------ga
A0A3P9B2E4_BAD-01      -----------------------------------------t------gg
A0A3Q4GGN3_BAD-01      cc--------------------------------aagagact------ga
A0A3P8QRJ7_BAD-01      cc--------------------------------aagagact------ga
A0A3Q3C680_BAD-01      cc--------------------------------aagagact------ga
A0A3B4GXJ6_BAD-01      cc--------------------------------aagagact------ga
A0A3Q0QNQ2_BAD-01      cc--------------------------------aggagagt------ga
A0A3Q0QNQ2_BAD-02      cc--------------------------------aggagagt------ga
A0A3Q3WTY4_BAD-01      cc--------------------------------aggagacg------ga
A0A672JQ68_BAD-01      cc--------------------------------aggagacc------ga
A0A3P8WI83_BAD-01      cc--------------------------------aggagctg------ga
A0A3P8WI83_BAD-02      cc--------------------------------aggagctg------ga
A0A3Q3FKT9_BAD-03      cc--------------------------------aggagaca------ga
A0A3Q3FKT9_BAD-01      ct--------------------------------tgaatgtg------ta
A0A3Q3FKT9_BAD-02      ct--------------------------------tgaatgtg------ta
G3Q8B3_BAD-01          cc--------------------------------aggagatg------ga
A0A3Q1K1C7_BAD-01      cc--------------------------------aggagact------ga
A0A672YF93_BAD-01      cc--------------------------------aggagatg------ga
A0A3Q3RXS8_BAD-01      cc--------------------------------aggagaca------ga
A0A3Q3R5S3_BAD-01      tc--------------------------------aggagaca------ga
H3D8J8_BAD-01          cc--------------------------------aggagacg------ga
A0A674MXC1_BAD-01      cc--------------------------------aggagacg------ga
A0A674MXC1_BAD-02      cc--------------------------------aggagacg------ga
A0A674MXC1_BAD-03      cc--------------------------------aggagacg------ga
A0A674MXC1_BAD-04      cc--------------------------------aggagacg------ga
A0A3B5BAL2_BAD-01      cc--------------------------------aggagctg------ga
A0A3Q1GWH9_BAD-01      cc--------------------------------aggagatg------ga
A0A3Q1CPU7_BAD-01      cc--------------------------------aggagatg------ga
A0A3P8TWH6_BAD-01      cc--------------------------------aggagatg------ga
A0A2U9BAC9_BAD-01      cc--------------------------------aggagatg------ga
A0A671TL42_BAD-01      cc--------------------------------aggagatg------ga
A0A665TUH3_BAD-01      cc--------------------------------aggagaca------ga
A0A4W6EMZ7_BAD-01      cc--------------------------------aggagaca------ga
A0A4W6EMZ7_BAD-02      cc--------------------------------aggagaca------ga
A0A3B4VFC5_BAD-01      cc--------------------------------aggagaca------ga
A0A3B4W9T1_BAD-01      cc--------------------------------aggagaca------ga
A0A3B3BQF7_BAD-01      cc--------------------------------cggaggcc------ga
A0A3P9HNZ2_BAD-01      cc--------------------------------cggaggca------ga
A0A3B3HDU2_BAD-01      cc--------------------------------cggaggcg------ga
A0A3P9KSL7_BAD-01      cc--------------------------------cggaggcg------ga
A0A3P9KSL7_BAD-02      cc--------------------------------cggaggcg------ga
A0A3Q3AEL8_BAD-01      cc--------------------------------aggagacg------ga
A0A3Q3AEL8_BAD-02      cc--------------------------------aggagacg------ga
A0A1A8AQV0_BAD-01      cc--------------------------------aggagagc------ga
A0A3Q2QC80_BAD-01      cc--------------------------------aggagacg------ga
A0A3Q2D5S0_BAD-01      cc--------------------------------aggagatg------ga
A0A3B5L9R9