Dataset for CDS classical BH3-containing proteins of organism Xiphophorus maculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3B5Q2N7_BAD-01       atggacaca---------------------aaatttacaa--------tt
A0A3B5QK08_BMF-01       atgg--------------------------aggatgaggaggatgatgtg
A0A3B5QK08_BMF-02       atgg--------------------------aggatgaggaggatgatgtg
A0A3B5QAM1_BCL2L11      atgc--------actcttta----------agaccgccaa-----atctg
A0A3B5QAM1_BCL2L11      atgctcacggtgacgctctgttcatccaacagaccgccaa-----atctg

A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3B5Q2N7_BAD-01       tcagacggtgagtcggacccatcggaagacgtagaggaaagaggagactt
A0A3B5QK08_BMF-01       tttga--gccagatc---------ccaactg------ctggcgcacaccc
A0A3B5QK08_BMF-02       tttga--gccagatc---------ccaactg------ctggcgcacaccc
A0A3B5QAM1_BCL2L11      ctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagaccc
A0A3B5QAM1_BCL2L11      ctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagaccc

A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3B5Q2N7_BAD-01       -----gcagctaatgcaagaa----------------------aaggaga
A0A3B5QK08_BMF-01       ttcagggagataaagtgcgaagac---------cggggcacgcaga----
A0A3B5QK08_BMF-02       ttcagggagataaagtgcgaagac---------cggggcacgcaga----
A0A3B5QAM1_BCL2L11      ----agcatcctcagcgcgaacaccacgttcctcgaagcacacagagcgg
A0A3B5QAM1_BCL2L11      ----agcatcctcagcgcgaacaccacgttcctcgaagcacacagagcgg

A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3B5Q2N7_BAD-01       agccgctcagtcaacgccacaccct-------------------------
A0A3B5QK08_BMF-01       ---cgcccggtcctggccaggcactacacaac------------------
A0A3B5QK08_BMF-02       ---cgcccggtcctggccaggcactacacaac------------------
A0A3B5QAM1_BCL2L11      agccgcgcgccgcaggcgggcgcctccacagccgggggaggaggaggagg
A0A3B5QAM1_BCL2L11      agccgcgcgccgcaggcgggcgcctccacagccgggggaggaggaggagg

A0A3B5RFA9_PMAIP1-      ------------------------------------cttcctgcc-----
A0A3B5Q2N7_BAD-01       ------------------------------------cacgcttcct----
A0A3B5QK08_BMF-01       ----------------------------------ggcatgctgccctgtg
A0A3B5QK08_BMF-02       ----------------------------------ggcatgctgccctgtg
A0A3B5QAM1_BCL2L11      agagggaggaggacgaagaggggagccggactcggactcgccgccttgct
A0A3B5QAM1_BCL2L11      agagggaggaggacgaagaggggagccggactcggactcgccgccttgct
                                                            *   *  **     

A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3B5Q2N7_BAD-01       -----------gagctccga------------tctaca-----acaggt-
A0A3B5QK08_BMF-01       gtgttgtggaggagcccagacgact-----attctacggtaacgcaggt-
A0A3B5QK08_BMF-02       gtgttgtggaggagcccagacgact-----attctacggtaacgcaggt-
A0A3B5QAM1_BCL2L11      ccgt-------gagcccggccagtttagacgtctttcg---aagcaggtc
A0A3B5QAM1_BCL2L11      ccgt-------gagcccggccagtttagacgtctttcg---aagcaggtc

A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3B5Q2N7_BAD-01       ---------------------------------------------cgggt
A0A3B5QK08_BMF-01       ----tttcgattgcacttc-------ccagcgcat--------tttga--
A0A3B5QK08_BMF-02       ----tttcgattgcacttc-------ccagcgcat--------tttga--
A0A3B5QAM1_BCL2L11      gatatttcgccctccccgccgctcgtccagcggatacttctcctttgact
A0A3B5QAM1_BCL2L11      gatatttcgccctccccgccgctcgtccagcggatacttctcctttgact

A0A3B5RFA9_PMAIP1-      -------gctgctgagctctgcgctc------------gcgagctg----
A0A3B5Q2N7_BAD-01       gagactgaactcggagtccatcgcttccaccatctccagagaggtggagc
A0A3B5QK08_BMF-01       ---acttgtcggggattttgacgc--------------gagg--------
A0A3B5QK08_BMF-02       ---acttgtcggggattttgacgc--------------gagg--------
A0A3B5QAM1_BCL2L11      gcgactcgctgccgagctccccgctctctccgcacccagtga--------
A0A3B5QAM1_BCL2L11      gcgactcgctgccgagctccccgctctctccgcacccagtga--------
                                     **      ***              * *         

A0A3B5RFA9_PMAIP1-      ---cggcaagttgga-------------------------------gata
A0A3B5Q2N7_BAD-01       tgcaggcaaggggggaagaggaggttgggacccccact--------gagg
A0A3B5QK08_BMF-01       ---caacaagaggagcagaacag-----------------------gatg
A0A3B5QK08_BMF-02       ---caacaagaggagcagaacag-----------------------gatg
A0A3B5QAM1_BCL2L11      ---cggctgacaaagccacgcagacccccagcctcaccggccaggtgatg
A0A3B5QAM1_BCL2L11      ---cggctgacaaagccacgcagacccccagcctcaccggccaggtgatg
                              *                                       **  

A0A3B5RFA9_PMAIP1-      aa------------------------------------------------
A0A3B5Q2N7_BAD-01       g-----ctttccattcaggggccgatctt------------tatcagct-
A0A3B5QK08_BMF-01       gagcagttacccctgcaccagccggctgc------------actcagctt
A0A3B5QK08_BMF-02       gagcagttacccctgcaccagccggctgc------------actcagctt
A0A3B5QAM1_BCL2L11      aacca---cgccctgcagcgaatggctgtggagcacggtggactcggcct
A0A3B5QAM1_BCL2L11      aacca---cgccctgcagcgaatggctgtggagcacggtggactcggcct

A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------cctccctcctt----------------------gtg
A0A3B5QK08_BMF-01       ggagg-------------cctccat-------------------------
A0A3B5QK08_BMF-02       ggagg-------------cctccat-------------------------
A0A3B5QAM1_BCL2L11      gcacgggcagtctcccaaccactatagcactattaacgcggcacgggata
A0A3B5QAM1_BCL2L11      gcacgggcagtctcccaaccactatagcactattaacgcggcacgggata

A0A3B5RFA9_PMAIP1-      ----------------------------------ttgtactggagat---
A0A3B5Q2N7_BAD-01       ggctgccaagaagt----acggccggcagcttcggaggatgagtgatgag
A0A3B5QK08_BMF-01       --cgggcagaaacttcagctgataggcgac-cagtttcaccgggaacact
A0A3B5QK08_BMF-02       --cgggcagaaacttcagctgataggcgac-cagtttcaccgggaacact
A0A3B5QAM1_BCL2L11      tgcagtcagaaacct---atggtcgtcaactccgtgctattggagatgag
A0A3B5QAM1_BCL2L11      tgcagtcagaaacct---atggtcgtcaactccgtgctattggagatgag
                                                              *   *  *    

A0A3B5RFA9_PMAIP1-      ----acaaactcctgga---------------------------------
A0A3B5Q2N7_BAD-01       tttgtcaacctgcttgataaaggggaaatgaggaatgtgagc------ag
A0A3B5QK08_BMF-01       tacaacagtatc----------------------aacaaaaccaaaggaa
A0A3B5QK08_BMF-02       tacaacagtatc----------------------aacaaaaccaaaggaa
A0A3B5QAM1_BCL2L11      tacaacaacctcctgatgggaaggaggatggcgagaggacaccaacggaa
A0A3B5QAM1_BCL2L11      tacaacaacctcctgatgggaaggaggatggcgagaggacaccaacggaa
                             **   *                                       

A0A3B5RFA9_PMAIP1-      ------------------aatgctgctcaagaactatgagactc------
A0A3B5Q2N7_BAD-01       tgatgggtcgaacagaccgattcaccac----tccaggagctggtggagc
A0A3B5QK08_BMF-01       tcaggggccgctg----tggtggcgcat-----------gactgcagctc
A0A3B5QK08_BMF-02       tcaggggccgctg----tggtggcgcat-----------gactgcagctc
A0A3B5QAM1_BCL2L11      tatagtccctctaaacctgatgccgcacatccagcaagagcctgttgcca
A0A3B5QAM1_BCL2L11      tatagtccctctaaacctgatgccgcacatccagcaagagcctgttgcca
                                            *    *             *          

A0A3B5RFA9_PMAIP1-      ---------tcaac------------------------------------
A0A3B5Q2N7_BAD-01       tacctct--tcagtcaccagg------agacagaggga------------
A0A3B5QK08_BMF-01       ttc------tcagcctcctgtt-----tgatagggggtttattgctggag
A0A3B5QK08_BMF-02       ttc------tcagcctcctgtt-----tgatagggggtttattgctggag
A0A3B5QAM1_BCL2L11      tgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatg
A0A3B5QAM1_BCL2L11      tgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatg

A0A3B5RFA9_PMAIP1-      -aaaataaaatga------------------------------
A0A3B5Q2N7_BAD-01       -gagaacaaccaccacgaaaaccacgcctcccgcaccgagtag
A0A3B5QK08_BMF-01       -gaggtggagcaggacggaggtga-------------------
A0A3B5QK08_BMF-02       -gaggtggagcaggacggaggtga-------------------
A0A3B5QAM1_BCL2L11      caaggcaacacaag-cagccatgaccactctcaggtttag---
A0A3B5QAM1_BCL2L11      caaggcaacacaag-cagccatgaccactctcaggtttag---

© 1998-2021Legal notice