Dataset for CDS BCL2L11 of organism Xiphophorus maculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B5QAM1_BCL2L11      atgc--------actcttta----------agaccgccaaatctgctcga
A0A3B5QAM1_BCL2L11      atgctcacggtgacgctctgttcatccaacagaccgccaaatctgctcga
                        ****        ** ** *           ********************

A0A3B5QAM1_BCL2L11      tggctcgaccgaagtaacgccagcagaggggaccggcggagacccagcat
A0A3B5QAM1_BCL2L11      tggctcgaccgaagtaacgccagcagaggggaccggcggagacccagcat

A0A3B5QAM1_BCL2L11      cctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcg
A0A3B5QAM1_BCL2L11      cctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcg

A0A3B5QAM1_BCL2L11      ccgcaggcgggcgcctccacagccgggggaggaggaggaggagagggagg
A0A3B5QAM1_BCL2L11      ccgcaggcgggcgcctccacagccgggggaggaggaggaggagagggagg

A0A3B5QAM1_BCL2L11      aggacgaagaggggagccggactcggactcgccgccttgctccgtgagcc
A0A3B5QAM1_BCL2L11      aggacgaagaggggagccggactcggactcgccgccttgctccgtgagcc

A0A3B5QAM1_BCL2L11      cggccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgc
A0A3B5QAM1_BCL2L11      cggccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgc

A0A3B5QAM1_BCL2L11      cgctcgtccagcggatacttctcctttgactgcgactcgctgccgagctc
A0A3B5QAM1_BCL2L11      cgctcgtccagcggatacttctcctttgactgcgactcgctgccgagctc

A0A3B5QAM1_BCL2L11      cccgctctctccgcacccagtgacggctgacaaagccacgcagaccccca
A0A3B5QAM1_BCL2L11      cccgctctctccgcacccagtgacggctgacaaagccacgcagaccccca

A0A3B5QAM1_BCL2L11      gcctcaccggccaggtgatgaaccacgccctgcagcgaatggctgtggag
A0A3B5QAM1_BCL2L11      gcctcaccggccaggtgatgaaccacgccctgcagcgaatggctgtggag

A0A3B5QAM1_BCL2L11      cacggtggactcggcctgcacgggcagtctcccaaccactatagcactat
A0A3B5QAM1_BCL2L11      cacggtggactcggcctgcacgggcagtctcccaaccactatagcactat

A0A3B5QAM1_BCL2L11      taacgcggcacgggatatgcagtcagaaacctatggtcgtcaactccgtg
A0A3B5QAM1_BCL2L11      taacgcggcacgggatatgcagtcagaaacctatggtcgtcaactccgtg

A0A3B5QAM1_BCL2L11      ctattggagatgagtacaacaacctcctgatgggaaggaggatggcgaga
A0A3B5QAM1_BCL2L11      ctattggagatgagtacaacaacctcctgatgggaaggaggatggcgaga

A0A3B5QAM1_BCL2L11      ggacaccaacggaatatagtccctctaaacctgatgccgcacatccagca
A0A3B5QAM1_BCL2L11      ggacaccaacggaatatagtccctctaaacctgatgccgcacatccagca

A0A3B5QAM1_BCL2L11      agagcctgttgccatgctttgtgtctgccttctgctcctcctggtcggac
A0A3B5QAM1_BCL2L11      agagcctgttgccatgctttgtgtctgccttctgctcctcctggtcggac

A0A3B5QAM1_BCL2L11      gaataatgtacatgcaaggcaacacaagcagccatgaccactctcaggtt
A0A3B5QAM1_BCL2L11      gaataatgtacatgcaaggcaacacaagcagccatgaccactctcaggtt

A0A3B5QAM1_BCL2L11      tag
A0A3B5QAM1_BCL2L11      tag

© 1998-2020Legal notice