Dataset for CDS classical BH3-containing proteins of organism Vulpes vulpes

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      ggacggaagacaggcgcccgagccaggtgcgcgccacctccgccccctcc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      cgagcacgtgcgggcagctgcgtgtccccgccgcactctggccgccgggc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gggaggcggcggtccggcgggcgggctccctcccccacgcaggtccaggt
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      tggggagggggcgtgcgtgcgtgcggagctccgggcggggggccgaagtg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      cggctcgggccgggattgcgcgcgccggggagcggggaagggcagcgcgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gctcggcgctgtcccgggagctgcggccccgctgctggatactgggctgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gcggccggccggcaagtgtcgccgccctgtcccgagacgccccccccccc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gccctccccaggtagcggccgcgccgtcggagctggtctggcgccttggc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       -------------------------------------atgacgctcgcct
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      tttcctcgggtgctcgggcccgctgcggaggatttgcggaactgcggcgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       gcagctccatgaggaccataggaccaaatgtcacactcagcggagtatcc
A0A3Q7V097_BIK-01       ---------------------------------------atggggcgttg
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      ttctttcactggcgagactcggcgttttccttgcaccggctgaggccgag
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       ccagcaggtggcacagcctgggcccactgggaagaggctggacggagggt
A0A3Q7V097_BIK-01       gaggagggggatgctgctgacgatgtttctgccaaagcatcactcttggt
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gtttcagggcggctgcagcgttcgcgctcttctggacgtgtctgggggcg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       tgcatgcctgttacgtaccccaagtttcacaaggcagttggcaggtataa
A0A3Q7V097_BIK-01       tttcagattgtgaaataggccga---------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      ccctgccctgccctgccctgcccgggccgcggctgcgctgcagacaccag
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       aagctggatttgctgagctgcagagaaaccaagagagcagcattagcccg
A0A3Q7V097_BIK-01       ------aatatacctaattccagaga------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      cagccgcacgatcccgacggcgagaggcctcgggccgcaggacctgctcc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       ttcttttcctctcctgatgggctaggatgtggaagggggtgctcggagga
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gcccgtggggcacccccactcgctcgcagtgccgccgggcggtgcggtgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       tggctccatccgctggttgggtctccacgctgacctcggagaa-------
A0A3Q7V097_BIK-01       ---------------------------------------agaa-------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      cctcgggggcctgttcctcggtgtccgagctcgtggcggaagacccgccg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gccgcgggagcccggggcgtggatgtgttcgccgtctgccgcgctcacgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      gtgcgcgcggacacgcgtgcccgtggccagtggctgcggctgggatttgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       --------------------------------------------------
A0A3Q7V097_BIK-01       --------------------------------------------------
A0A3Q7V097_BIK-02       --------------------------------------------------
A0A3Q7SWS0_BAD-01       --------------------------------------------------
A0A3Q7S5V2_BCL2L11      acgtacgcgccgcgctcggggaggaaaagggaggaatttgcggaggacga
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7V097_BIK-03       ------------atg----------tctca--------ctcaggacccct
A0A3Q7V097_BIK-01       ------------atg----------tctca--------ctcaggacccct
A0A3Q7V097_BIK-02       ------------atg----------tctca--------ctcaggacccct
A0A3Q7SWS0_BAD-01       ------------atg----------ttccagat-----cccagagtttga
A0A3Q7S5V2_BCL2L11      aaaaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtga
A0A3Q7S5V2_BCL2L11      ------------atggcaaagcaaccttcagatgtaagttctgagtgtga
                                    ***             **          * *       

A0A3Q7V097_BIK-03       ctccagg----------------aacctctttctgagcaccttcctacag
A0A3Q7V097_BIK-01       ctccagg----------------aacctctttctgagcaccttcctacag
A0A3Q7V097_BIK-02       ctccagg----------------aacctctttctgagcaccttcctacag
A0A3Q7SWS0_BAD-01       gcccagtg-agcaggaagactccagcc-------------ctgcaaatag
A0A3Q7S5V2_BCL2L11      ---cagagaaggtggacaattgcagcctgctgagagacctcctcagctca
A0A3Q7S5V2_BCL2L11      ---cagagaaggtggacaattgcagcctgctgagagacctcctcagctca
                           ***                 * **             *  *      

A0A3Q7V097_BIK-03       gagcatggcccggaagttctggaggttccgggcatgacagatctcatgga
A0A3Q7V097_BIK-01       gagcatggcccggaagttctggaggttccgggcatgacagatctcatgga
A0A3Q7V097_BIK-02       gagcatggcccggaagttctggaggttccgggcatgacagatctcatgga
A0A3Q7SWS0_BAD-01       gggcttgggccccagccccacaggggaccggccc--ccaggcctcctagg
A0A3Q7S5V2_BCL2L11      ggcctggggctcctacctctctacagacagaaca--gcaagac------a
A0A3Q7S5V2_BCL2L11      ggcctggggctcctacctctctacagacagaaca--gcaagac------a
                        *  *  ** *        *        * *  *    **   *       

A0A3Q7V097_BIK-03       gtattatgaccctgggccctcccctaacagcaacaacccggacgatgtgg
A0A3Q7V097_BIK-01       gtattatgaccctgggccctcccctaacagcaacaacccggacgatgtgg
A0A3Q7V097_BIK-02       gtattatgaccctgggccctcccctaacagcaacaacccggacgatgtgg
A0A3Q7SWS0_BAD-01       g------gaagctgg--tcaccagcaggggcagccagccagccgcaaaca
A0A3Q7S5V2_BCL2L11      g------gagcccgg--cacccatgagttgtgacaaatcaa-cacaaacc
A0A3Q7S5V2_BCL2L11      g------gagcccgg--cacccatgagttgtgacaaatcaa-cacaaacc
                        *      **  * **     **   *   *   * *  *   *       

A0A3Q7V097_BIK-03       ccatg-------------------------------cggctggccttcat
A0A3Q7V097_BIK-01       ccatg-------------------------------cggctggccttcat
A0A3Q7V097_BIK-02       ccatg-------------------------------cggctggccttcat
A0A3Q7SWS0_BAD-01       ccatggaggcgctggggctgagacccggagtcgccacagctcgttccccg
A0A3Q7S5V2_BCL2L11      cca-------------------------agtc-----------ctccttg
A0A3Q7S5V2_BCL2L11      cca-------------------------agtc-----------ctccttg
                        ***                                               

A0A3Q7V097_BIK-03       cggggac-------gagatggaagtgagatggatg---------------
A0A3Q7V097_BIK-01       cggggac-------gagatggaagtgagatggatg---------------
A0A3Q7V097_BIK-02       cggggac-------gagatggaagtgagatggatg---------------
A0A3Q7SWS0_BAD-01       cggggac--cgacgaggat---gaaggaatggaggaagaagagctcagcc
A0A3Q7S5V2_BCL2L11      ccaggccttcaaccattatctcagtgcaatgg------------------
A0A3Q7S5V2_BCL2L11      ccaggccttcaaccattatctcagtgcaatgg------------------
                        *  ** *          **      *  ****                  

A0A3Q7V097_BIK-03       cttccccgtgttgg---cgagct-----gcccgggatggccatgtacagc
A0A3Q7V097_BIK-01       cttccccgtgttgg---cgagct-----gcccgggatggccatgtacagc
A0A3Q7V097_BIK-02       cttccccgtgttgg---cgagct-----gcccgggatggccatgtacagc
A0A3Q7SWS0_BAD-01       ctttccgggggcg--ctcgagctcagcgccccccaacctctgcgcagcac
A0A3Q7S5V2_BCL2L11      cttccatgaggcagtctcaggct--gtacctgcagatatgcgcccggaga
A0A3Q7S5V2_BCL2L11      cttccatgaggcagtctcaggct--gtacctgcagatatgcgcccggaga
                        *** *  * *       *  ***      *     *              

A0A3Q7V097_BIK-03       ttggcttttacctacaaccagacaggcctgagaggtgttcttagaagttt
A0A3Q7V097_BIK-01       ttggcttttacctacaaccagacaggcctgagaggtgttcttagaagttt
A0A3Q7V097_BIK-02       ttggcttttacctacaaccagacaggcctgagaggtgttcttagaagttt
A0A3Q7SWS0_BAD-01       tgcgctatggccgcgagctccgcagg-atgagcgacg--------agttc
A0A3Q7S5V2_BCL2L11      tatggattgcccaagagttgcggcgt-attggagacg--------aattt
A0A3Q7S5V2_BCL2L11      tatggattgcccaagagttgcggcgt-attggagacg--------aattt
                        *  *   *  **   *        *   *  * *  *        * ** 

A0A3Q7V097_BIK-03       cctggatggtcttgctaacctcagggagaacatccgcatctggagcttcc
A0A3Q7V097_BIK-01       cctggatggtcttgctaacctcagggagaacatccgcatctggagcttcc
A0A3Q7V097_BIK-02       cctggatggtcttgctaacctcagggagaacatccgcatctggagcttcc
A0A3Q7SWS0_BAD-01       cagggct-------ccttc-----aagggacttcctcgcccgaagagcgc
A0A3Q7S5V2_BCL2L11      aatgcat-------attacccaaggagggtcttttt-----gaata----
A0A3Q7S5V2_BCL2L11      aatgcat-------attacccaaggagggtcttttt-----gaata----
                           *  *           *        *  * *        * *      

A0A3Q7V097_BIK-03       tgaccttccggaacagggtgtcccccaacccggggcgtgggctggtgctg
A0A3Q7V097_BIK-01       tgaccttccggaacagggtgtcccccaacccggggcgtgggctggtgctg
A0A3Q7V097_BIK-02       tgaccttccggaacagggtgtcccccaacccggggcgtgggctggtgctg
A0A3Q7SWS0_BAD-01       ggggacagcgacgca-gatgcgacaaagccc-------cagctgg-----
A0A3Q7S5V2_BCL2L11      ----attaccaagca-gccgaagcccacccc-------caaatgattatc
A0A3Q7S5V2_BCL2L11      ----attaccaagca-gccgaagcccacccc-------caaatgattatc
                                *    ** *  *   *  * ***           **      

A0A3Q7V097_BIK-03       tcgctgctgctgctgctggtgctgctactaggc--------tgggg----
A0A3Q7V097_BIK-01       tcgctgctgctgctgctggtgctgctactaggc--------tgggg----
A0A3Q7V097_BIK-02       tcgctgctgctgctgctggtgctgctactaggc--------tgggg----
A0A3Q7SWS0_BAD-01       --acg-----cgcgtcatccagtcctggtgggatcggaacttggggagag
A0A3Q7S5V2_BCL2L11      ttacgactgttacgttacatcgtccgcctgg----------tgtggaga-
A0A3Q7S5V2_BCL2L11      ttacgactgttacgttacatcgtccgcctgg----------tgtggaga-
                           *        *         * *   * *          ** **    

A0A3Q7V097_BIK-03       ---cctccgcctc-ctccagtga
A0A3Q7V097_BIK-01       ---cctccgcctc-ctccagtga
A0A3Q7V097_BIK-02       ---cctccgcctc-ctccagtga
A0A3Q7SWS0_BAD-01       gaggctccgccccgtcccagtga
A0A3Q7S5V2_BCL2L11      --------------ttgcagtga
A0A3Q7S5V2_BCL2L11      --------------ttgcagtga
                                         ******

© 1998-2020Legal notice