Dataset for CDS classical BH3-containing proteins of organism Vombatus ursinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4X2L9J9_BCL2L11      --------------------------------------------------
A0A4X2KLG2_BMF-01       --------------------------------------------------
A0A4X2KAA5_BAD-01       --------------------------------------------------
A0A4X2K3J4_HRK-01       --------------------------------------------------
A0A4X2LVY2_BBC3-01      atggtgctggagggggcagcggcggagcccgctctgacctgctccgccca
A0A4X2LVY2_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2L9J9_BCL2L11      ----------------------------atggcaa---------------
A0A4X2KLG2_BMF-01       ----------------------------atg-------------------
A0A4X2KAA5_BAD-01       ----------------------------atgagcatgtttcagatctcag
A0A4X2K3J4_HRK-01       ----------------------------atg-------------------
A0A4X2LVY2_BBC3-01      cctgtctccacaggctccccggtgtggcatggcca---------------
A0A4X2LVY2_BBC3-02      ----------------------------atggcca---------------
                                                    ***                   

A0A4X2L9J9_BCL2L11      -----agcaaccgtcagatctaaattctgaatgccacagagaaggtg---
A0A4X2KLG2_BMF-01       -----gagcctcctcattatg-----tcgaagagctggaggacgatgt--
A0A4X2KAA5_BAD-01       agtttgagcccagtgagcaggaaactcccaa-----agaagacggctt--
A0A4X2K3J4_HRK-01       --------------------------------------------------
A0A4X2LVY2_BBC3-01      -----gagcacagcaggacggcagctcccgagaaccagtagagggtctgc
A0A4X2LVY2_BBC3-02      -----gagcacagcaggacggcagctcccgagaaccagtagagggtctgc
                                                                          

A0A4X2L9J9_BCL2L11      ---------------------------------gacaattacaccctaca
A0A4X2KLG2_BMF-01       --------------------------------------gttccacccgga
A0A4X2KAA5_BAD-01       ---------------------------------tgcctatgccc-cgggg
A0A4X2K3J4_HRK-01       ---------------------------------tgcccgtgccccctgca
A0A4X2LVY2_BBC3-01      cccgggagggccccagaacctttcccctggggcggctcatgccctctgca
A0A4X2LVY2_BBC3-02      cccgggagggccccagaacctttcccctggggcggctcatgccctctgca
                                                               * *   *    

A0A4X2L9J9_BCL2L11      gaa-----------------------------------------------
A0A4X2KLG2_BMF-01       ggattcagagcctggtgcgcagccag------------------------
A0A4X2KAA5_BAD-01       gagtccagggggctgggcaagcacagc-----------------------
A0A4X2K3J4_HRK-01       -----ccgcggtcgcggc--------------------------------
A0A4X2LVY2_BBC3-01      gtctcctgcagcctctgcgaggctggcctgaacccttctggtgactccat
A0A4X2LVY2_BBC3-02      gtctcctgcagcctctgcgaggctggcctgaacccttctggtgactccat
                                                                          

A0A4X2L9J9_BCL2L11      ------------------------------------------------ag
A0A4X2KLG2_BMF-01       ggggcctgacctcggc--------------------------------tg
A0A4X2KAA5_BAD-01       -------gccactg----------------------------------cc
A0A4X2K3J4_HRK-01       --------cccccggcggtgtg--------------------------cg
A0A4X2LVY2_BBC3-01      gtgtccagcccctggccccgcgctggcacccccttccctcctgcccctcg
A0A4X2LVY2_BBC3-02      gtgtccagcccctggccccgcgctggcacccccttccctcctgcccctcg
                                                                          

A0A4X2L9J9_BCL2L11      gcctactcagcctca-acaactcagacc--------aggggcccctacct
A0A4X2KLG2_BMF-01       ctctgtttgcccagagccagcccgactatatgctagatgggctgcagctt
A0A4X2KAA5_BAD-01       cccagcttggccccagtcaggcctggac----cca----gacccgcacct
A0A4X2K3J4_HRK-01       cct-------------gcagctcc---------------ggccgcctcga
A0A4X2LVY2_BBC3-01      cctacttctgcactcgacagccccgttc----ctatgggggcccccgctg
A0A4X2LVY2_BBC3-02      cctacttctgcactcgacagccccgttc----ctatgggggcccccgctg
                                         **   *                * *     *  

A0A4X2L9J9_BCL2L11      ctatacaaacacagtatcaagacaggagtccagcacctatga------gt
A0A4X2KLG2_BMF-01       ttcc-----ctctcacccactgctgcggcccagggcttcggtcagttggc
A0A4X2KAA5_BAD-01       ggag-----ccca---ccaccatgagggcgcag-gcgcaggc------gc
A0A4X2K3J4_HRK-01       gcag-----cgcg---cggcggcggcggcacagctcacggcc------gc
A0A4X2LVY2_BBC3-01      ggcc-----cggg---tggc--caggagcccagcccccagca------gc
A0A4X2LVY2_BBC3-02      ggcc-----cggg---tggc--caggagcccagcccccagca------gc
                                 *                 *  ***  *            * 

A0A4X2L9J9_BCL2L11      tgtgacaaatctac-----acaaactccaag-ccctcctt----------
A0A4X2KLG2_BMF-01       caggaagacaaggc----------cactcagaccctcagtccggca----
A0A4X2KAA5_BAD-01       cggggacagaaggccccgcctgatctcctac-cccccacttcgggagggg
A0A4X2K3J4_HRK-01       c----------cgc----------ctcaagg-cgctc-------------
A0A4X2LVY2_BBC3-01      cagggccagagtgg----------ctcccag-ccctcgttgggtgaaagg
A0A4X2LVY2_BBC3-02      cagggccagagtgg----------ctcccag-ccctcgttgggtgaaagg
                                                * *     * * *             

A0A4X2L9J9_BCL2L11      -------------------------gtcaagcctt---------------
A0A4X2KLG2_BMF-01       ----------tccccaagccagggtgtcatgctgccttgtggagtgactg
A0A4X2KAA5_BAD-01       ccc------------ggggaggcgagtcccgaagc-------ggaggccg
A0A4X2K3J4_HRK-01       ----------------------ggggacgagctgc-------aggagc--
A0A4X2LVY2_BBC3-01      tctgcagaggaccaggaggagggaggacaggaggt-------agaacccc
A0A4X2LVY2_BBC3-02      tctgcagaggaccaggaggagggaggacaggaggt-------agaacccc
                                                 * *  *                   

A0A4X2L9J9_BCL2L11      --caatcattatctaagtgcaatggc------------------------
A0A4X2KLG2_BMF-01       aagaaccccaccgactcttttatggcaatgctggataccgacttcccctc
A0A4X2KAA5_BAD-01       aggccgact----------------t------------------------
A0A4X2K3J4_HRK-01       --ggaccat------------gtggc------------------------
A0A4X2LVY2_BBC3-01      agggagcatccccgatgtctggtggc------------------------
A0A4X2LVY2_BBC3-02      agggagcatccccgatgtctggtggc------------------------
                                                                          

A0A4X2L9J9_BCL2L11      ----------ttccatgaggc---agtctcagt-------caatacctgc
A0A4X2KLG2_BMF-01       ccagccaattttcctgtgagcctgaggcttggag------aggagccccc
A0A4X2KAA5_BAD-01       ----------cttcgagggggaggaggaacgcagcctgttccggagccgc
A0A4X2K3J4_HRK-01       ------------------ggcgccgggcgcggagc-----cggcgggc--
A0A4X2LVY2_BBC3-01      ----------cccccaggggtgttaggcccagacc-----acgggggcca
A0A4X2LVY2_BBC3-02      ----------cccccaggggtgttaggcccagacc-----acgggggcca
                                           *     *                        

A0A4X2L9J9_BCL2L11      agatatgcggccagaaatttggattgcacaagaattgcgacgtattggag
A0A4X2KLG2_BMF-01       tcaagagcagtgggaacatcgaactgaggt--------gcagattgcccg
A0A4X2KAA5_BAD-01       tccagctcagcgcctcctatcctctgggct---gcgcggcgttatggcag
A0A4X2K3J4_HRK-01       -----agcagc-------------cgaggc---------------ggccg
A0A4X2LVY2_BBC3-01      agcagagcagcaagaccgggagattggggcccagctccgaaggatggccg
A0A4X2LVY2_BBC3-02      agcagagcagcaagaccgggagattggggcccagctccgaaggatggccg
                               * *               *                       *

A0A4X2L9J9_BCL2L11      atgagtttaatgcttattatcca---------------------------
A0A4X2KLG2_BMF-01       aaagcttcaatgcatagcagaccagttccacagactccacatgcagcggc
A0A4X2KAA5_BAD-01       -----cgagttgcgcaggatg-----------------------------
A0A4X2K3J4_HRK-01       --------------------------------------------------
A0A4X2LVY2_BBC3-01      atgacctcaatgctctgtatg-----------------------------
A0A4X2LVY2_BBC3-02      atgacctcaatgctctgtatg-----------------------------
                                                                          

A0A4X2L9J9_BCL2L11      agaagggggtttttggataataactatcaagcggatcaccaa--atggtt
A0A4X2KLG2_BMF-01       accagcaga----------------accgaaaccatgtgtggtggcagat
A0A4X2KAA5_BAD-01       agcgacgag----------------ttcgattgcaccttcaa----gggt
A0A4X2K3J4_HRK-01       -gcagcggc----------------ggcg-----------------ggct
A0A4X2LVY2_BBC3-01      agcagcgga----------------gacgagaggaggagcaaagacggca
A0A4X2LVY2_BBC3-02      agcagcgga----------------gacgagaggaggagcaaagacggca
                                                   *                   *  

A0A4X2L9J9_BCL2L11      attttacgcctg--------ttacgttaca--------tca---------
A0A4X2KLG2_BMF-01       cctcctc-------------tttcttcacaatttggccttgaa-------
A0A4X2KAA5_BAD-01       cttccccgcccgaagagcgccggcactgcgag------tcagatgcgtcg
A0A4X2K3J4_HRK-01       ccccgcctgctgggct----tggctgtgcgcggccg-ctcagg-----tg
A0A4X2LVY2_BBC3-01      tctctccccctggagg----ctgctctacaatctcgtctcaggactcctg
A0A4X2LVY2_BBC3-02      tctctccccctggagg----ctgctctacaatctcgtctcaggactcctg
                              *                *    *         *           

A0A4X2L9J9_BCL2L11      -----------------------------tccgccttgtttggag-----
A0A4X2KLG2_BMF-01       ----------------------------------------cagag--agg
A0A4X2KAA5_BAD-01       gagccacggctgggcccgcaccttccagtcttggctcagccggagtctgg
A0A4X2K3J4_HRK-01       gcggcg---ctggc-------------ggcctggctgctccggag-----
A0A4X2LVY2_BBC3-01      gccccacaccgagg-------------gaaccggat--ccccgag-----
A0A4X2LVY2_BBC3-02      gccccacaccgagg-------------gaaccggat--ccccgag-----
                                                                  ***     

A0A4X2L9J9_BCL2L11      --------aatgcag--------------tga
A0A4X2KLG2_BMF-01       agaacaggaatggggcaggcc---ctaggtga
A0A4X2KAA5_BAD-01       ggaaagggagcgccgccggtccttcccactga
A0A4X2K3J4_HRK-01       ----gaggaac-------------ttg--tag
A0A4X2LVY2_BBC3-01      ----atcgaac-------------ccaactag
A0A4X2LVY2_BBC3-02      ----atcgaac-------------ccaactag
                                *                    *  

© 1998-2020Legal notice