Dataset for CDS BBC3 of organism Vombatus ursinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment

A0A4X2LVY2_BBC3-01      atggtgctggagggggcagcggcggagcccgctctgacctgctccgccca
A0A4X2LVY2_BBC3-02      --------------------------------------------------

A0A4X2LVY2_BBC3-01      cctgtctccacaggctccccggtgtggcatggccagagcacagcaggacg
A0A4X2LVY2_BBC3-02      ----------------------------atggccagagcacagcaggacg

A0A4X2LVY2_BBC3-01      gcagctcccgagaaccagtagagggtctgccccgggagggccccagaacc
A0A4X2LVY2_BBC3-02      gcagctcccgagaaccagtagagggtctgccccgggagggccccagaacc

A0A4X2LVY2_BBC3-01      tttcccctggggcggctcatgccctctgcagtctcctgcagcctctgcga
A0A4X2LVY2_BBC3-02      tttcccctggggcggctcatgccctctgcagtctcctgcagcctctgcga

A0A4X2LVY2_BBC3-01      ggctggcctgaacccttctggtgactccatgtgtccagcccctggccccg
A0A4X2LVY2_BBC3-02      ggctggcctgaacccttctggtgactccatgtgtccagcccctggccccg

A0A4X2LVY2_BBC3-01      cgctggcacccccttccctcctgcccctcgcctacttctgcactcgacag
A0A4X2LVY2_BBC3-02      cgctggcacccccttccctcctgcccctcgcctacttctgcactcgacag

A0A4X2LVY2_BBC3-01      ccccgttcctatgggggcccccgctgggcccgggtggccaggagcccagc
A0A4X2LVY2_BBC3-02      ccccgttcctatgggggcccccgctgggcccgggtggccaggagcccagc

A0A4X2LVY2_BBC3-01      ccccagcagccagggccagagtggctcccagccctcgttgggtgaaaggt
A0A4X2LVY2_BBC3-02      ccccagcagccagggccagagtggctcccagccctcgttgggtgaaaggt

A0A4X2LVY2_BBC3-01      ctgcagaggaccaggaggagggaggacaggaggtagaaccccagggagca
A0A4X2LVY2_BBC3-02      ctgcagaggaccaggaggagggaggacaggaggtagaaccccagggagca

A0A4X2LVY2_BBC3-01      tccccgatgtctggtggccccccaggggtgttaggcccagaccacggggg
A0A4X2LVY2_BBC3-02      tccccgatgtctggtggccccccaggggtgttaggcccagaccacggggg

A0A4X2LVY2_BBC3-01      ccaagcagagcagcaagaccgggagattggggcccagctccgaaggatgg
A0A4X2LVY2_BBC3-02      ccaagcagagcagcaagaccgggagattggggcccagctccgaaggatgg

A0A4X2LVY2_BBC3-01      ccgatgacctcaatgctctgtatgagcagcggagacgagaggaggagcaa
A0A4X2LVY2_BBC3-02      ccgatgacctcaatgctctgtatgagcagcggagacgagaggaggagcaa

A0A4X2LVY2_BBC3-01      agacggcatctctccccctggaggctgctctacaatctcgtctcaggact
A0A4X2LVY2_BBC3-02      agacggcatctctccccctggaggctgctctacaatctcgtctcaggact

A0A4X2LVY2_BBC3-01      cctggccccacaccgagggaaccggatccccgagatcgaacccaactag
A0A4X2LVY2_BBC3-02      cctggccccacaccgagggaaccggatccccgagatcgaacccaactag

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice