Dataset for CDS classical BH3-containing proteins of organism Ursus maritimus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A452V3L2_BIK-01       atggcttggagctcagaa---gaagctaggtcaagagaagaaatgtccc-
A0A452U4S4_BCL2L11      atggcaaagcaacc-------------------------------ttc--
A0A384DJL2_BAD-01       atgttccagatcccagagtttgagcccagtgagcaggaaga----ctcca
A0A384D070_BMF-01       atgg---agccgcctcagtgtgtggaggagctggaggatgatgtgttcca
A0A452TE71_PMAIP1-      -tgg---ggctccc-----------------------------tgctc--
                         **     *    *                                 *  

A0A452V3L2_BIK-01       -------acacaggacccctctccaggaacctctttttgagcaccttcct
A0A452U4S4_BCL2L11      -------agatgtaagttc-------------------------------
A0A384DJL2_BAD-01       gccctgcagataggggcct-------------------------------
A0A384D070_BMF-01       gccagaggatggggagccg-------------------------------
A0A452TE71_PMAIP1-      -------agtggggagcct-------------------------------

A0A452V3L2_BIK-01       gcaggagcatggcccggaagttctggaggttccgggca------------
A0A452U4S4_BCL2L11      ---tgagtgtgacagagaaggtggacaactgc----------------ag
A0A384DJL2_BAD-01       ---gggccccagccccacaggggaccagcccccaggcc------------
A0A384D070_BMF-01       ---gggacccagcctgggagcttgctctctgctgacctgtttgcccagag
A0A452TE71_PMAIP1-      ---g----------------------------------------------

A0A452V3L2_BIK-01       -----tgactgatctcgtggagta---------ctatgatccggggccct
A0A452U4S4_BCL2L11      cctgctgagaggcctcctcag------------ctcaggcctggggcccc
A0A384DJL2_BAD-01       ----ctggcaagcaccggcagacagccccaggcctcctaggggaagctgc
A0A384D070_BMF-01       ccagctggactgccccctcagccgtctgcatctcttc---------cctc
A0A452TE71_PMAIP1-      ---------------------------------cttc---------tccc

A0A452V3L2_BIK-01       cccctaacagcaacaaccccgacgatgtggccatgcggctggccttcatc
A0A452U4S4_BCL2L11      tacctctctacag---------------acaga-----gcagcaagacag
A0A384DJL2_BAD-01       tcacccccaggggcagcc----------ggcca-----gcagcaaccacc
A0A384D070_BMF-01       tcacccactgctgtggccctgggcttcgaccca-----ccagccaggaag
A0A452TE71_PMAIP1-      tctccctctgctg-------------------------------------
                           *   *                                          

A0A452V3L2_BIK-01       ggggacgagatggaagtgagatggatgcttccccgcgt------------
A0A452U4S4_BCL2L11      -------------------gagcccggcacccatgagt------------
A0A384DJL2_BAD-01       atggaggcgctggggctgtggagc------cccggagtcgccacagctcg
A0A384D070_BMF-01       acaaggccacccagaccctgagcccggcctccccgagt------------
A0A452TE71_PMAIP1-      -------caccc---------------cctcccgaagt------------
                                                      **    **            

A0A452V3L2_BIK-01       -----------tggcgagctgccc---gggatggccatgtacagcttggc
A0A452U4S4_BCL2L11      ---------tgtgacaaa--------------------------------
A0A384DJL2_BAD-01       taccccgcggggaccgaagaggatgaagggttggaggaggaagagctcag
A0A384D070_BMF-01       ------cagggtgtcatgctgccttgtggggtgaccgaagaaccccagcg
A0A452TE71_PMAIP1-      -----ggagtgtgccat---------------------------------

A0A452V3L2_BIK-01       ttttacctacaaccagacaggcctgagaggtgttcttcgaagtctcatgg
A0A452U4S4_BCL2L11      -----------tcaacacaaac--------------cccaagtcctcctt
A0A384DJL2_BAD-01       ccctttccgggggcgctcgagc--------------tcagcgcccc----
A0A384D070_BMF-01       actcttttatggcaacgcaggc--------------taccggctccctct
A0A452TE71_PMAIP1-      -----------tcaactcagg-----------------------------

A0A452V3L2_BIK-01       acggactcactaacctcagggagaacataaggatctggagcttcctgacc
A0A452U4S4_BCL2L11      --------------------------------------------------
A0A384DJL2_BAD-01       -----ccaacctctgtgctgcactgcgctatggccgcgagctccgg----
A0A384D070_BMF-01       ccctgccagtttccctgcaggcttgccccttggggagcagcccccagaag
A0A452TE71_PMAIP1-      ------------------agatttg-------------------------

A0A452V3L2_BIK-01       ttcagg---------aacaggggcctggatttggagccttccctgcccgc
A0A452U4S4_BCL2L11      ----------------------gccaggccttcaaccattatctcagtgc
A0A384DJL2_BAD-01       ---------------aggatgagcgacgagttccagggctccttcaaggg
A0A384D070_BMF-01       ggccgtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgc
A0A452TE71_PMAIP1-      ----------------------gagacaaactg------aatttccg---
                                              *        *           *      

A0A452V3L2_BIK-01       cacccagccccagagccgatccagcagatgcagtgactcac---cacctc
A0A452U4S4_BCL2L11      aatggatctttggacc-----------gtggagagacatctggaaacc--
A0A384DJL2_BAD-01       actt----cctcgcccgaagagcgcgggcacagcgacgcagatgcgacaa
A0A384D070_BMF-01       attgcagaccagttccaccggcttcacatgcagcaacaccagcaaaacca
A0A452TE71_PMAIP1-      -----------------------------gcagaaacttctg--aatctg
                                                       **  **          *  

A0A452V3L2_BIK-01       cggccgggctgg---tcaggtcctgcccactcccagctgccccg------
A0A452U4S4_BCL2L11      ------------------------gcact---------------------
A0A384DJL2_BAD-01       agccccagctgg------------acgcgcgtcatccagtcctggt----
A0A384D070_BMF-01       aaatcgagtgtggtggcagatcctgctcttcttacacaacctcgctttga
A0A452TE71_PMAIP1-      atatccaa----------------actcttc-----------cgct----
                                                 * *                      

A0A452V3L2_BIK-01       -----------------------------tccggccctcacgactga
A0A452U4S4_BCL2L11      -------------------------------------------gtga
A0A384DJL2_BAD-01       ---gggatcggaacttggggagaggaggctccgccccctcccaatga
A0A384D070_BMF-01       acgcagatgagaacagggatggggcaggtccca---------ggtga
A0A452TE71_PMAIP1-      ------------------------caggaacc------------tga

© 1998-2020Legal notice