Dataset for CDS classical BH3-containing proteins of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A674MXC1_BAD-01      atgg-cgacaaggttcagcat---ttccagcgacagcgactcggatccct
A0A674MXC1_BAD-02      atgg-cgacgaggttcagcat---ttccagcgacagcgactcggatccct
A0A674MXC1_BAD-03      atgg-cgacgaggttcagcat---ttccagcgacagcgactcggatccct
A0A674MXC1_BAD-04      atgg-cgacgaggttcagcat---ttccagcgacagcgactcggatccct
A0A3B5KWG6_BMF-02      atggacgatgaggaggatgatgtatttcagccaga-----------ccct
A0A3B5KWG6_BMF-01      atggacgatgaggaggatgatgtatttcagccaga-----------ccct
A0A3B5KWG6_BMF-03      atggacgatgaggaggatgatgtatttcagccaga-----------ccct
                       **** ***  ***   *  **   ** **** * *           ****

A0A674MXC1_BAD-01      cggaggaggtggacga------aggagagaggaatagttctctaagtgag
A0A674MXC1_BAD-02      cggaggaggtggacga------aggagagaggaatagttctctaagtgag
A0A674MXC1_BAD-03      cggaggaggtggacga------aggagagaggaatagttctctaagtgag
A0A674MXC1_BAD-04      cggaggaggtggacga------aggagagaggaatagttctctaagtgag
A0A3B5KWG6_BMF-02      tacagctggcgcaccacattccaggagata-------------aagtgcg
A0A3B5KWG6_BMF-01      tacagctggcgcaccacattccaggagata-------------aagtgcg
A0A3B5KWG6_BMF-03      tacagctggcgcaccacattccaggagata-------------aagtgcg
                          **  ** * ** *      ****** *             ***** *

A0A674MXC1_BAD-01      caggagaggcaggttcttcagcggcacaccctgactctacctgaactcag
A0A674MXC1_BAD-02      caggagaggcaggttcttcagcggcacaccctgactctacctgaactcag
A0A674MXC1_BAD-03      caggagaggcaggttcttcagcggcacaccctgactctacctgaactcag
A0A674MXC1_BAD-04      caggagaggcaggttcttcagcggcacaccctgactctacctgaactcag
A0A3B5KWG6_BMF-02      agg----------------accggggcacgcagac---acctggcccgac
A0A3B5KWG6_BMF-01      agg----------------accggggcacgcagac---acctggcccgac
A0A3B5KWG6_BMF-03      agg----------------accggggcacgcagac---acctggcccgac
                         *                * ***  *** * ***   *****  *  * 

A0A674MXC1_BAD-01      actgacaggtaccagtcggaccagggtcagct------cggagtcccag-
A0A674MXC1_BAD-02      actgacaggtaccagtcggaccagggtcagct------cggagtcccag-
A0A674MXC1_BAD-03      actgacaggtaccagtcggaccagggtcagct------cggagtcccag-
A0A674MXC1_BAD-04      actgacaggtaccagtcggaccagggtcagct------cggagtcccag-
A0A3B5KWG6_BMF-02      cctggca--------ccgcacagcggcatgcttccctgtggagtcgcaga
A0A3B5KWG6_BMF-01      cctggca--------ccgcacagcggcatgcttccctgtggagtcgcaga
A0A3B5KWG6_BMF-03      cctggca--------ccgcacagcggcatgcttccctgtggagtcgcaga
                        *** **         ** **   **   ***       ****** *** 

A0A674MXC1_BAD-01      -gcgtcca------ccttctccagagaggaagagcttca-----------
A0A674MXC1_BAD-02      -gcgtcca------ccttctccagagaggaagagcttca-----------
A0A674MXC1_BAD-03      -gcgtcca------ccttctccagagaggaagagcttca-----------
A0A674MXC1_BAD-04      -gcgtcca------ccttctccagagaggaagagcttca-----------
A0A3B5KWG6_BMF-02      agagcccagactactcttctacggcaacgcaggttttcgattgcacttcc
A0A3B5KWG6_BMF-01      agagcccagactactcttctacggcaacgcaggttttcgattgcacttcc
A0A3B5KWG6_BMF-03      agagcccagactactcttctacggcaacgcaggttttcgattgcacttcc
                        * * ***       ***** * *  * * **   ***            

A0A674MXC1_BAD-01      --------------------ggggaacggggaggatgaggc---------
A0A674MXC1_BAD-02      --------------------ggggaacggggaggatgaggc---------
A0A674MXC1_BAD-03      --------------------ggggaacggggaggatgaggc---------
A0A674MXC1_BAD-04      --------------------ggggaacggggaggatgaggc---------
A0A3B5KWG6_BMF-02      ccgcacgcttcgaggttctcggggatcgaggag--tgaggcggcgagaca
A0A3B5KWG6_BMF-01      ccgcacgcttcgaggttctcggggatcgaggag--tgaggcggcgagaca
A0A3B5KWG6_BMF-03      ccgcacgcttcgaggttctcggggatcgaggag--tgaggcggcgagaca
                                           ***** ** ****  ******         

A0A674MXC1_BAD-01      ----cgggacgcccac--ggaaggagccccgttcagaggaaggtccaggt
A0A674MXC1_BAD-02      ----cgggacgcccac--ggaaggagccccgttcagaggaaggtccaggt
A0A674MXC1_BAD-03      ----cgggacgcccac--ggaaggagccccgttcagaggaaggtccaggt
A0A674MXC1_BAD-04      ----cgggacgcccac--ggaaggagccccgttcagaggaaggtccaggt
A0A3B5KWG6_BMF-02      ccggaggggcgcccaacgggatggagccgctgccccagcatggtcctg--
A0A3B5KWG6_BMF-01      ccggaggggcgcccaacgggatggagccgctgccccagcagggtcctg--
A0A3B5KWG6_BMF-03      ccggaggggcgcccaacgggatggagccgctgccccagcagggtcctg--
                            *** ******   *** ****** *   *  ** * ***** *  

A0A674MXC1_BAD-01      cagcgcctcccgccttgtgggccgcgcagagat-----acggccggcagc
A0A674MXC1_BAD-02      cagcgcctcccgccttgtgggccgcgcagagat-----acggccggcagc
A0A674MXC1_BAD-03      cagcgcctcccgccttgtgggccgcgcagagat-----acggccggcagc
A0A674MXC1_BAD-04      cagcgcctcccgccttgtgggccgcgcagagat-----acggccggcagc
A0A3B5KWG6_BMF-02      --------------tggtgcgcagcacggaggcttgcattggccagaagc
A0A3B5KWG6_BMF-01      --------------tggtgcgcagcacggaggcttgcattggccagaagc
A0A3B5KWG6_BMF-03      --------------tggtgcgcagcacggaggcttgcattggccagaagc
                                     * *** ** ** * ***         **** * ***

A0A674MXC1_BAD-01      tccggagaatgagcgacgagt----tcgacagcttgctggataaaggggg
A0A674MXC1_BAD-02      tccggagaatgagcgacgagt----tcgacagcttgctggataaaggggg
A0A674MXC1_BAD-03      tccggagaatgagcgacgagt----tcgacagcttgctggataaaggggg
A0A674MXC1_BAD-04      tccggagaatgagcgacgagt----tcgacagcttgctggataaaggggg
A0A3B5KWG6_BMF-02      tccagctgattggggatcagtttcatcgggaacgcgttcaat------tg
A0A3B5KWG6_BMF-01      tccagctgattggggatcagtttcatcgggaacgcgttcaat------tg
A0A3B5KWG6_BMF-03      tccagctgattggggatcagtttcatcgggaacgcgttcaat------tg
                       *** *   **  * **  ***    ***  * *  * *  **       *

A0A674MXC1_BAD-01      gatgaggaagaccaacagcaccggatcgaccaaaccgatgcaccactccc
A0A674MXC1_BAD-02      gatgaggaagaccaacagcaccggatcgaccaaaccgatgcaccactccc
A0A674MXC1_BAD-03      gatgaggaagaccaacagcaccggatcgaccaaaccgatgcaccactccc
A0A674MXC1_BAD-04      gatgaggaagaccaacagcaccggatcgaccaaaccgatgcaccactccc
A0A3B5KWG6_BMF-02      tatcagcgaaaccaaaggaaccagggc-------ccgctgtggt------
A0A3B5KWG6_BMF-01      tatcagcgaaaccaaaggaaccagggc-------ccgctgtggt------
A0A3B5KWG6_BMF-03      tatcagcgaaaccaaaggaaccagggc-------ccgctgtggtg-----
                        ** **  * *****  * *** *  *       *** **          

A0A674MXC1_BAD-01      ggagctggtggagctacctgttcagccaccag---ga----------gac
A0A674MXC1_BAD-02      ggagctggtggagctacctgttcagccaccag---ga----------gac
A0A674MXC1_BAD-03      ggagctggtggagctacctgttcagccaccag---ga----------gac
A0A674MXC1_BAD-04      ggagctggtggagctacctgttcagccaccag---ga----------gac
A0A3B5KWG6_BMF-02      ggcgcctgggcaccgctctgctcagccttctgtttgacaggggcttcgtc
A0A3B5KWG6_BMF-01      ggcgcctgggcaccgctctgctcagccttctgtttgacaggggcttcgtc
A0A3B5KWG6_BMF-03      ggcgcctgggcaccgctctgctcagccttctgtttga-------------
                       ** **  * * * *   *** ******  * *   **             

A0A674MXC1_BAD-01      ggagggcgagaacggccaccacgacggccacacgcaccgcactgagtag
A0A674MXC1_BAD-02      ggagggcgagaacggccaccacgacggccacacgcaccgcactgagtag
A0A674MXC1_BAD-03      ggagggcgagaacggccaccacgacggccacacgcaccgcactgagtag
A0A674MXC1_BAD-04      ggagggcgagaacggccaccacgacggccacacgcaccgcactgagtag
A0A3B5KWG6_BMF-02      gctggaggaggaggagcggggcggaggtga-------------------
A0A3B5KWG6_BMF-01      gctggaggaggaggagcggggcggaggtga-------------------
A0A3B5KWG6_BMF-03      -------------------------------------------------
                                                                        

© 1998-2021Legal notice