Dataset for CDS BAD of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A674MXC1_BAD-01      atggcgacaaggttcagcatttccagcgacagcgactcggatccctcgga
A0A674MXC1_BAD-02      atggcgacgaggttcagcatttccagcgacagcgactcggatccctcgga
A0A674MXC1_BAD-03      atggcgacgaggttcagcatttccagcgacagcgactcggatccctcgga
A0A674MXC1_BAD-04      atggcgacgaggttcagcatttccagcgacagcgactcggatccctcgga
                       ******** *****************************************

A0A674MXC1_BAD-01      ggaggtggacgaaggagagaggaatagttctctaagtgagcaggagaggc
A0A674MXC1_BAD-02      ggaggtggacgaaggagagaggaatagttctctaagtgagcaggagaggc
A0A674MXC1_BAD-03      ggaggtggacgaaggagagaggaatagttctctaagtgagcaggagaggc
A0A674MXC1_BAD-04      ggaggtggacgaaggagagaggaatagttctctaagtgagcaggagaggc

A0A674MXC1_BAD-01      aggttcttcagcggcacaccctgactctacctgaactcagactgacaggt
A0A674MXC1_BAD-02      aggttcttcagcggcacaccctgactctacctgaactcagactgacaggt
A0A674MXC1_BAD-03      aggttcttcagcggcacaccctgactctacctgaactcagactgacaggt
A0A674MXC1_BAD-04      aggttcttcagcggcacaccctgactctacctgaactcagactgacaggt

A0A674MXC1_BAD-01      accagtcggaccagggtcagctcggagtcccaggcgtccaccttctccag
A0A674MXC1_BAD-02      accagtcggaccagggtcagctcggagtcccaggcgtccaccttctccag
A0A674MXC1_BAD-03      accagtcggaccagggtcagctcggagtcccaggcgtccaccttctccag
A0A674MXC1_BAD-04      accagtcggaccagggtcagctcggagtcccaggcgtccaccttctccag

A0A674MXC1_BAD-01      agaggaagagcttcaggggaacggggaggatgaggccgggacgcccacgg
A0A674MXC1_BAD-02      agaggaagagcttcaggggaacggggaggatgaggccgggacgcccacgg
A0A674MXC1_BAD-03      agaggaagagcttcaggggaacggggaggatgaggccgggacgcccacgg
A0A674MXC1_BAD-04      agaggaagagcttcaggggaacggggaggatgaggccgggacgcccacgg

A0A674MXC1_BAD-01      aaggagccccgttcagaggaaggtccaggtcagcgcctcccgccttgtgg
A0A674MXC1_BAD-02      aaggagccccgttcagaggaaggtccaggtcagcgcctcccgccttgtgg
A0A674MXC1_BAD-03      aaggagccccgttcagaggaaggtccaggtcagcgcctcccgccttgtgg
A0A674MXC1_BAD-04      aaggagccccgttcagaggaaggtccaggtcagcgcctcccgccttgtgg

A0A674MXC1_BAD-01      gccgcgcagagatacggccggcagctccggagaatgagcgacgagttcga
A0A674MXC1_BAD-02      gccgcgcagagatacggccggcagctccggagaatgagcgacgagttcga
A0A674MXC1_BAD-03      gccgcgcagagatacggccggcagctccggagaatgagcgacgagttcga
A0A674MXC1_BAD-04      gccgcgcagagatacggccggcagctccggagaatgagcgacgagttcga

A0A674MXC1_BAD-01      cagcttgctggataaaggggggatgaggaagaccaacagcaccggatcga
A0A674MXC1_BAD-02      cagcttgctggataaaggggggatgaggaagaccaacagcaccggatcga
A0A674MXC1_BAD-03      cagcttgctggataaaggggggatgaggaagaccaacagcaccggatcga
A0A674MXC1_BAD-04      cagcttgctggataaaggggggatgaggaagaccaacagcaccggatcga

A0A674MXC1_BAD-01      ccaaaccgatgcaccactcccggagctggtggagctacctgttcagccac
A0A674MXC1_BAD-02      ccaaaccgatgcaccactcccggagctggtggagctacctgttcagccac
A0A674MXC1_BAD-03      ccaaaccgatgcaccactcccggagctggtggagctacctgttcagccac
A0A674MXC1_BAD-04      ccaaaccgatgcaccactcccggagctggtggagctacctgttcagccac

A0A674MXC1_BAD-01      caggagacggagggcgagaacggccaccacgacggccacacgcaccgcac
A0A674MXC1_BAD-02      caggagacggagggcgagaacggccaccacgacggccacacgcaccgcac
A0A674MXC1_BAD-03      caggagacggagggcgagaacggccaccacgacggccacacgcaccgcac
A0A674MXC1_BAD-04      caggagacggagggcgagaacggccaccacgacggccacacgcaccgcac

A0A674MXC1_BAD-01      tgagtag
A0A674MXC1_BAD-02      tgagtag
A0A674MXC1_BAD-03      tgagtag
A0A674MXC1_BAD-04      tgagtag

© 1998-2021Legal notice