Dataset for CDS classical BH3-containing proteins of organism Taeniopygia guttata

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A674GIP8_BMF-03       atggatcgcc------------------------------ccagctacct
A0A674GIP8_BMF-01       atggatcgcc------------------------------ccagctacct
A0A674GIP8_BMF-02       atggatcgcc------------------------------ccagctacct
A0A674GQ16_BAD-01       atgctccggctggacgagacccccgagga----tcgcggctcccctcc--
A0A674H354_BCL2L11      atggccaagc------agccccccgaggtgaaggcgcgacgcgacggcga
A0A674HDV6_PMAIP1-      atgcctggcc------ggaccct----------gcgcaaaaccgcgcc--
                        ***      *                               *  *  *  

A0A674GIP8_BMF-03       ggaagaggactattctagcctggatgggctggacgatgacgtgtttcact
A0A674GIP8_BMF-01       ggaagaggactattctagcctggatgggctggacgatgacgtgtttcact
A0A674GIP8_BMF-02       ggaagaggactattctagcctggatgggctggacgatgacgtgtttcact
A0A674GQ16_BAD-01       ----------cccctcgccctgggggggct--------------------
A0A674H354_BCL2L11      gggcgggcggctgccggcggcggaggggccgggcccgggcgcgcagctgc
A0A674HDV6_PMAIP1-      --gccagccgct-cctgcggcggtggagt---------------------
                                             **  * *                      

A0A674GIP8_BMF-03       ctgatgactttggacttgcaggtcagcctggtgagatgact---------
A0A674GIP8_BMF-01       ctgatgactttggacttgcaggtcagcctggtgagatgact---------
A0A674GIP8_BMF-02       ctgatgactttggacttgcaggtcagcctggtgagatgact---------
A0A674GQ16_BAD-01       ------ccccc---tcccccagccagcccgggaccccctccccaggtcag
A0A674H354_BCL2L11      gtcccggcgct---cccgccgccctgcctgggg--ccggcccggtgtccg
A0A674HDV6_PMAIP1-      ------gcgc----------------cctggag--ctgacccg-------
                               *                  ** **        *          

A0A674GIP8_BMF-03       ----------gcaactggctttttcacacagaaccagtcctacagctgcc
A0A674GIP8_BMF-01       ----------gcaactggctttttcacacagaaccagtcctacagctgcc
A0A674GIP8_BMF-02       ----------gcaactggctttttcacacagaaccagtcctacagctgcc
A0A674GQ16_BAD-01       agactcccccccacccaaaatcccccccccggggggaccccaaaaccccc
A0A674H354_BCL2L11      cgggcgccgcggcgcggggcccgcccgccagccccggccccttcgccacc
A0A674HDV6_PMAIP1-      --------------------------------------------------

A0A674GIP8_BMF-03       ttctgg-------------------ggaggtttcaactatt------ccc
A0A674GIP8_BMF-01       ttctgg-------------------ggaggtttcaactatt------ccc
A0A674GIP8_BMF-02       ttctgg-------------------ggaggtttcaactatt------ccc
A0A674GQ16_BAD-01       cggggggaccccaaaagccatttttgggggtccc-----ctgacgcccct
A0A674H354_BCL2L11      cgctcgccgctcttcatcttcgtgcggaggtcgccgctgctgccgcgctc
A0A674HDV6_PMAIP1-      --------------------------------------------------

A0A674GIP8_BMF-03       cctcacacactgctgtggtcccggtatcaggca-----------tcctga
A0A674GIP8_BMF-01       cctcacacactgctgtggtcccggtatcaggca-----------tcctga
A0A674GIP8_BMF-02       cctcacacactgctgtggtcccggtatcaggca-----------tcctga
A0A674GQ16_BAD-01       ccccccgcagaggcgcggccccggctgctgtcggagcggggggggggcgg
A0A674H354_BCL2L11      ctccagcgggtacttctccttcgacgccgagcgcagccccgcacccctgg
A0A674HDV6_PMAIP1-      ------------------catcggcgacaggtgggac-------------
                                             **    *                      

A0A674GIP8_BMF-03       gcagcaggacaaggcaactcaaacactcagccca--tcctcttccagtca
A0A674GIP8_BMF-01       gcagcaggacaaggcaactcaaacactcagccca--tcctcttccagtca
A0A674GIP8_BMF-02       gcagcaggacaaggcaactcaaacactcagccca--tcctcttccagtca
A0A674GQ16_BAD-01       ggggc--ggcgg--------ggacccccaaatcggggccccccccgg---
A0A674H354_BCL2L11      gctgc--gacaaggccacgcagacccccagcccg----ccctgccag---
A0A674HDV6_PMAIP1-      -ttgc--ggcag--------aggctcctgaacct----gctcgccaa---
                           **  * *             * *      *          **     

A0A674GIP8_BMF-03       ggatgttatgttgccttgtggagtcactgaagagccaaggagactcttct
A0A674GIP8_BMF-01       ggatgttatgttgccttgtggagtcactgaagagccaaggagactcttct
A0A674GIP8_BMF-02       ggatgttatgttgccttgtggagtcactgaagagccaaggagactcttct
A0A674GQ16_BAD-01       ------------ggacc------cccccccgg-----------ccc----
A0A674H354_BCL2L11      ------------gcgctcagccactgcctcagcgccatggcttccc----
A0A674HDV6_PMAIP1-      ------------gctctt-----ctgccccggaacgtgggctgccc----
                                    *             *    *           * *    

A0A674GIP8_BMF-03       atgggagtgctggttaccgtttacatgtccctccagctgggtttgtgttg
A0A674GIP8_BMF-01       atgggagtgctggttaccgtttacatgtccctccagctgggtttgtgttg
A0A674GIP8_BMF-02       atgggagtgctggttaccgtttacatgtccctccagctgggtttgtgttg
A0A674GQ16_BAD-01       ------------gcggccgctcccgctccgccccccccgtgctctgggca
A0A674H354_BCL2L11      ------------gatggcaatcccactctccggctgaagaggtgcagccg
A0A674HDV6_PMAIP1-      ------------gcggaca-----------------------------cg
                                    *    *                                

A0A674GIP8_BMF-03       gatccgcacctccaggaggaacctcaggaaggtcagcgggaagcacgtgc
A0A674GIP8_BMF-01       gatccgcacctccaggaggaacctcaggaaggtcagcgggaagcacgtgc
A0A674GIP8_BMF-02       gatccgcacctccaggaggaacctcaggaaggtcagcgggaagcacgtgc
A0A674GQ16_BAD-01       gcgcagcgctacgg-gcggcggctgaggaggatgagcgacgagttccagc
A0A674H354_BCL2L11      gaa-atctggattgcgcaagagctgcggcgcattggggacgagttcaa--
A0A674HDV6_PMAIP1-      gcg-agcggaacggaggaggacct--------------------------
                        *     *        *      **                          

A0A674GIP8_BMF-03       tgaggtgcaaattgcacggaagttgcagtgcattgccgaccagttccacc
A0A674GIP8_BMF-01       tgaggtgcaaattgcacggaagttgcagtgcattgccgaccagttccacc
A0A674GIP8_BMF-02       tgaggtgcaaattgcacggaagttgcagtgcattgccgaccagttccacc
A0A674GQ16_BAD-01       tccaggtgctgccgcg------------------gccccgcagtgtcggg
A0A674H354_BCL2L11      ------------tgcc------------------tcctattgtccacgca
A0A674HDV6_PMAIP1-      --------------------------------------------------

A0A674GIP8_BMF-03       ggctccacattcagagg-gtaggcagaacagaaatc----aagtgtggtg
A0A674GIP8_BMF-01       ggctccacattcagaggcatcagcagaacagaaatc----aagtgtggtg
A0A674GIP8_BMF-02       ggctccacattcagag------gcagaacagaaatc----aagtgtggtg
A0A674GQ16_BAD-01       ggggctcccccgggggggggcggctggcgcgagaccctccgggcctggtg
A0A674H354_BCL2L11      ggggcttctt------ggatcaacaggtgggaaatccccaggtcatgatc
A0A674HDV6_PMAIP1-      -tggctttgt------gggtttggaagaagaggctccacaga--------
                            *                              *              

A0A674GIP8_BMF-03       -----------------gcagctttttctcttcctacacaac--------
A0A674GIP8_BMF-01       -----------------gcagctttttctcttcctacacaac--------
A0A674GIP8_BMF-02       -----------------gcagctttttctcttcctacacaac--------
A0A674GQ16_BAD-01       ggggtcccgacggccccgccccgcccccccggcccccccccctgaccgac
A0A674H354_BCL2L11      ttgcgcctgcttcgcctgctgcattccatcattcgcctcatc--------
A0A674HDV6_PMAIP1-      --------------------------------------cact--------

A0A674GIP8_BMF-03       --ttggccttaa--------------------------------------
A0A674GIP8_BMF-01       --ttggccttaaacacggaggtgaacaggaaccacactgggcagagaaat
A0A674GIP8_BMF-02       --ttggccttaaacacggaggtgaacaggaaccacactgggcagag----
A0A674GQ16_BAD-01       cccccccccaaaaacctcatctggggcggggggccccgaaatgctgcagg
A0A674H354_BCL2L11      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------

A0A674GIP8_BMF-03       ---------------------
A0A674GIP8_BMF-01       cactggctttgtttaaaatag
A0A674GIP8_BMF-02       -----------------gtga
A0A674GQ16_BAD-01       gaatgggggggggggcaataa
A0A674H354_BCL2L11      ------tggaggctccactga
A0A674HDV6_PMAIP1-      ------gggaga------tga

© 1998-2021Legal notice