Dataset for CDS PMAIP1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9GL49_PMAIP1-01        atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatc
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
                                                                          

Q9GL49_PMAIP1-01        ggcaggatgggaggaattggtaagaagccagccccgggcacatcaaggtc
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
                                                                          

Q9GL49_PMAIP1-01        tcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttcc
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        -------------------gcgcgggcagcggcgggagc-----------
                                                                          

Q9GL49_PMAIP1-01        ttcggtccgcctcccgctgccgtccgaggaaaccaaccaacctcagaggc
A0A4X1TQ35_PMAIP1-      ---------------------------------------acctcagaggc
F1SMU1_PMAIP1-01        -----------------------------------gccaacctcagaggc
                                                               ***********

Q9GL49_PMAIP1-01        ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
A0A4X1TQ35_PMAIP1-      ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
F1SMU1_PMAIP1-01        ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
                        **************************************************

Q9GL49_PMAIP1-01        tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
A0A4X1TQ35_PMAIP1-      tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
F1SMU1_PMAIP1-01        tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
                        **************************************************

Q9GL49_PMAIP1-01        cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
A0A4X1TQ35_PMAIP1-      cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
F1SMU1_PMAIP1-01        cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
                        **************************************************

Q9GL49_PMAIP1-01        gtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
A0A4X1TQ35_PMAIP1-      gtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
F1SMU1_PMAIP1-01        gtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
                        **************************************************

Q9GL49_PMAIP1-01        ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcag
A0A4X1TQ35_PMAIP1-      ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcag
F1SMU1_PMAIP1-01        ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcag
                        **************************************************

Q9GL49_PMAIP1-01        ttcagaaggattggagacaaactgaacttccggcagaaacttctgaatct
A0A4X1TQ35_PMAIP1-      ttcagaaggattggagacaaactgaacttccggcagaaacttctgaatct
F1SMU1_PMAIP1-01        ttcagaaggattggagacaaactgaacttccggcagaaacttctgaatct
                        **************************************************

Q9GL49_PMAIP1-01        gatagccaaactcttccgtctaggaacctga
A0A4X1TQ35_PMAIP1-      gatagccaaactcttccgcctaggaacctga
F1SMU1_PMAIP1-01        gatagccaaactcttccgcctaggaacctga
                        ****************** ************

© 1998-2022Legal notice