Dataset for CDS PMAIP1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F1SMU1_PMAIP1-01      --------------------------------------------------
Q9GL49_PMAIP1-01      atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatc
                                                                        

F1SMU1_PMAIP1-01      --------------------------------------------------
Q9GL49_PMAIP1-01      ggcaggatgggaggaattggtaagaagccagccccgggcacatcaaggtc
                                                                        

F1SMU1_PMAIP1-01      -------------gcgcgggca------gcggcgggagc-----------
Q9GL49_PMAIP1-01      tcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttcc
                                   * * *****      ****  *****           

F1SMU1_PMAIP1-01      -----------------------------------gccaacctcagaggc
Q9GL49_PMAIP1-01      ttcggtccgcctcccgctgccgtccgaggaaaccaaccaacctcagaggc
                                                          **************

F1SMU1_PMAIP1-01      ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
Q9GL49_PMAIP1-01      ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
                      **************************************************

F1SMU1_PMAIP1-01      tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
Q9GL49_PMAIP1-01      tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
                      **************************************************

F1SMU1_PMAIP1-01      cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
Q9GL49_PMAIP1-01      cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
                      **************************************************

F1SMU1_PMAIP1-01      gtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
Q9GL49_PMAIP1-01      gtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
                      **************************************************

F1SMU1_PMAIP1-01      ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcag
Q9GL49_PMAIP1-01      ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcag
                      **************************************************

F1SMU1_PMAIP1-01      ttcagaaggattggagacaaactgaacttccggcagaaacttctgaatct
Q9GL49_PMAIP1-01      ttcagaaggattggagacaaactgaacttccggcagaaacttctgaatct
                      **************************************************

F1SMU1_PMAIP1-01      gatagccaaactcttccgcctaggaacctga
Q9GL49_PMAIP1-01      gatagccaaactcttccgtctaggaacctga
                      ****************** ************

© 1998-2020Legal notice