Dataset for CDS BCL2L11 of organism Suricata suricatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673SRF7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgaatgtgacagagaaggtgg
A0A673SRF7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgaatgtgacagagaaggtgg
A0A673SRF7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgaatgtgacagagaaggtgg
A0A673SRF7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgaatgtgacagagaaggtgg
                        **************************************************

A0A673SRF7_BCL2L11      acaattgcagcctgctgagagacctcctcagctcaggcctggggccccta
A0A673SRF7_BCL2L11      acaattgcagcctgctgagagacctcctcagctcaggcctggggccccta
A0A673SRF7_BCL2L11      acaattgcagcctgctgagagacctcctcagctcaggcctggggccccta
A0A673SRF7_BCL2L11      acaattgcagcctgctgagagacctcctcagctcaggcctggggccccta
                        **************************************************

A0A673SRF7_BCL2L11      cctctctacagacccagcggcaaggtaatcctgaaggcgaaggggaccgc
A0A673SRF7_BCL2L11      cctctctacagacccagcggcaaggtaatcctgaaggcgaaggggaccgc
A0A673SRF7_BCL2L11      cctctctacagacccagcggca----------------------------
A0A673SRF7_BCL2L11      cctctctacagacccagcggca----------------------------
                        **********************                            

A0A673SRF7_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A673SRF7_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
                                                                          

A0A673SRF7_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtgagaagatcctccc
A0A673SRF7_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtgagaagatcctccc
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
                                                                          

A0A673SRF7_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A673SRF7_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A673SRF7_BCL2L11      ----------------------------------------agacaggagc
A0A673SRF7_BCL2L11      ----------------------------------------a---------
                                                                *         

A0A673SRF7_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A673SRF7_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A673SRF7_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A673SRF7_BCL2L11      --------------------------------------------------
                                                                          

A0A673SRF7_BCL2L11      ccaggccatcaaccattatctcagtgcaatggcttccatgaggcagtctc
A0A673SRF7_BCL2L11      ccaggccatcaaccattatctcagtgcaatggcttccatgaggcagtctc
A0A673SRF7_BCL2L11      ccaggccatcaaccattatctcagtgcaatggcttccatgaggcagtctc
A0A673SRF7_BCL2L11      -------------------------------gcttccatgaggcagtctc
                                                       *******************

A0A673SRF7_BCL2L11      aggctgcacctgcagacatgcgcccggagatctggatcgcacaggagctg
A0A673SRF7_BCL2L11      aggctgcacctgcagacatgcgcccggagatctggatcgcacaggagctg
A0A673SRF7_BCL2L11      aggctgcacctgcagacatgcgcccggagatctggatcgcacaggagctg
A0A673SRF7_BCL2L11      aggctgcacctgcagacatgcgcccggagatctggatcgcacaggagctg
                        **************************************************

A0A673SRF7_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagggtcttttt
A0A673SRF7_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagg-----tta
A0A673SRF7_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagg-----ggg
A0A673SRF7_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagg-----ctg
                        ******************************************        

A0A673SRF7_BCL2L11      gaataa--------------------------------------------
A0A673SRF7_BCL2L11      gagcaa--------------------------------------------
A0A673SRF7_BCL2L11      gaaggaccaagcatgttcactgagcccaagagggtgtgtgcgtccgctaa
A0A673SRF7_BCL2L11      gcagga--------gttc--------------------------------
                        *    *                                            

A0A673SRF7_BCL2L11      ---ttaccaagcagccgaagcccaccccc----------------aaatg
A0A673SRF7_BCL2L11      ---tag--------------------------------------------
A0A673SRF7_BCL2L11      ggctgctgtaacagagtacgacagactccaggggagggagtgcataaacg
A0A673SRF7_BCL2L11      ---------------------cagcatcc---------------------
                                                                          

A0A673SRF7_BCL2L11      ataatcttacgactgttacgttacatcgtccgcttggtgtggcgattgca
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      acagaaccgcatttattcagtcctggaggccagaggcttgggagctcggg
A0A673SRF7_BCL2L11      --------------------------------------------------
                                                                          

A0A673SRF7_BCL2L11      gcga--------------------------------
A0A673SRF7_BCL2L11      ------------------------------------
A0A673SRF7_BCL2L11      ctggctgcgcctgtgtgctgtgcaaggtctttttga
A0A673SRF7_BCL2L11      ---------------------------tctatctta
                                                            

© 1998-2020Legal notice