Dataset for CDS classical BH3-containing proteins of organism Sphaeramia orbicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A673CKA1_BCL2L11      gttgctc-------------cgtgcgtaaaatcg------cttaaacgcg
A0A672YF93_BAD-01       atggctg-------------------caaaattcaccatttccgacagtg
A0A673C8N3_BMF-01       atggaggatgaggaggatgatgtgtttgagccagaccctcactgctggcg
                         * *                        *                  * *

A0A673CKA1_BCL2L11      catat----tgttcagcgagcggcgagctgagccccgg------------
A0A672YF93_BAD-01       aatcagagccatccgaagatttagaggaggaacaacg-------------
A0A673C8N3_BMF-01       cacca----cattcagggagataaagtgtgaagaccggggcacacagaca
                         *         * *   **          **    **             

A0A673CKA1_BCL2L11      -------tttcaccggt-cccaccggcgaaggacg-------agagccgg
A0A672YF93_BAD-01       ------------ccgtcagccaccgactgaaca---------ggagcag-
A0A673C8N3_BMF-01       cctggccttgccctggcacccaacaacggcatgcttccctgtggagtcg-
                                    * *    *** *  *                ***  * 

A0A673CKA1_BCL2L11      actcgccgtcccagatcggagtcaaagccaccctcc--------------
A0A672YF93_BAD-01       -----------cagat--ttcttacagccactccctcac-tctacctgag
A0A673C8N3_BMF-01       -----------cagaa--gagcccagaccactcttctacggcaacgcagg
                                   ****            **** *                 

A0A673CKA1_BCL2L11      tttctgatagcctcagcagg----tttcagatgaggtct---------at
A0A672YF93_BAD-01       ctcagaatggcaggggccgggcgactcaggctgaactctgagtcccaagt
A0A673C8N3_BMF-01       ttttcgattgcacttcccgg----cacattttgaactct-----ttgggg
                         *    ** **     * **           ***  ***           

A0A673CKA1_BCL2L11      attccgt-----------------------------------------gg
A0A672YF93_BAD-01       ttccaatgtcaccagagacgaggagctccagatgaggggggaagatgaag
A0A673C8N3_BMF-01       atccagt-------gaggcga-------caagtgagtgaggaagaggagc
                         * *  *                                           

A0A673CKA1_BCL2L11      ccgtcgccgctccagtgggtatttctcctatgaaagcgactcgttaccag
A0A672YF93_BAD-01       ccagcactcccacggaaggagcc-ccattcagggcacggtccaagtcggc
A0A673C8N3_BMF-01       aaaacg-------ggatggagcagctaccccggcagcaacctatggca--
                            *         *  **     *      *    *         *   

A0A673CKA1_BCL2L11      actctccgcctt------cgccgaggccaatgacggctgacaaagcca--
A0A672YF93_BAD-01       tccccccgccttgtgggcagccaag---aaatacggccagcagctccgga
A0A673C8N3_BMF-01       ------cgcagtgtgg--aggcgtg---catt--ggccagaaactccagc
                              ***  *       * *  *    *    ***    *   **   

A0A673CKA1_BCL2L11      -cgcagactcccagtctcaccg----------------cacaggtgatga
A0A672YF93_BAD-01       ggatgagcgatgaatttgacag------cctgcta-gacaagggggaaat
A0A673C8N3_BMF-01       tgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaac
                                    * * * ** *                 *     **   

A0A673CKA1_BCL2L11      tacacgccctagagcgcacggcggaggc-gcatggcgaaggagcatttct
A0A672YF93_BAD-01       gaagagggtgagaag----tgcggggacagccagac--agatgcac----
A0A673C8N3_BMF-01       caaaggaaccaggggccgctgtggtggc-gcctggc--tgcagctctgct
                         *   *    **        * ** * * **  * *   *  **      

A0A673CKA1_BCL2L11      cacacatgacgtgtggttaagcgtcagtgttgaatacacacttggggaat
A0A672YF93_BAD-01       cactc-taaaacttggtggagctacctctttagtc---------------
A0A673C8N3_BMF-01       cagtc-ttctgtttgacagag------ggttcatt---------------
                        **  * *      **    **        **                   

A0A673CKA1_BCL2L11      atgctgaagagctggtgcgcgtgctgctgcggactaggagacagcattct
A0A672YF93_BAD-01       --------------------------------accaggaga--------t
A0A673C8N3_BMF-01       --------------------------------gctggaaga---------
                                                         *  * ***         

A0A673CKA1_BCL2L11      gaagggaataaactgcattcctgcaaactttag----------------
A0A672YF93_BAD-01       ggaaggagagaacagccaccatgaaaaccacaaaaaccgcactgagtaa
A0A673C8N3_BMF-01       ggtggagcaggacag----------------------------aggtga
                        *   *      ** *                                  

© 1998-2021Legal notice