Dataset for CDS classical BH3-containing proteins of organism Sparus aurata

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A671X848_BMF-01       at------------------------------------------------
A0A671TL42_BAD-01       atggctgcaaacttcaccatttccagcgagagcgactcaga------gcc
A0A671W556_BCL2L11      at-gcagcatccgtccagaccacca-----aacagctccgatgggtcgac

A0A671X848_BMF-01       -------------ggacgatgaggaggatgatgtgttcgagccagacccc
A0A671TL42_BAD-01       ctcgg----aggaggtcgaggaaggagaaca-------cagccaatcacc
A0A671W556_BCL2L11      cgcagtaacggcaggtcaggggagcggagga-------gatcc-atcacc
                                     ** *   *  *  **  *        * **   * **

A0A671X848_BMF-01       cactgctggcgcaccacattccgggagataaagtgtgaagaccggggcac
A0A671TL42_BAD-01       agctgaagaagggcagca-----ggtgtctcagcgccacgccc---tcac
A0A671W556_BCL2L11      cgccg-----gtgccgcc-----ggagcctcagcgcaaacctc---ccgc
                          * *     *  *  *      ** *    ** *  *    *    * *

A0A671X848_BMF-01       acagacacctggccctgccctggcactgt---------------------
A0A671TL42_BAD-01       cc---tac----------ctgagctc------------------------
A0A671W556_BCL2L11      tcagacaccggcggcgtgccgagctccggccagcccagcaccagtggagg
                         *    **          *   ** *                        

A0A671X848_BMF-01       acaacggcatgctgccttgtggag-tcgcagaggagcccagaccactctt
A0A671TL42_BAD-01       aggatggcaggtcgaatcaggctgaactcagagtcccacgcttccaccgt
A0A671W556_BCL2L11      aggagagccggactcgccgtgctg-gcgcagaggcaaaaccatctcccct
                        *  *  **  *         *  *  * *****          *   * *

A0A671X848_BMF-01       ctacggcaacgcag---gttttcga-----------ttgcacttccc---
A0A671TL42_BAD-01       ctccagagacgtgga--gctccaggcgagg--------------------
A0A671W556_BCL2L11      ctcgacagtcttggcgtgtttcagacgaggtcgatatttcacctccctcg
                        **       *   *   * *   *                          

A0A671X848_BMF-01       ------------ggcacactttgagcttgtcggagatcaggaag------
A0A671TL42_BAD-01       ----------------------------ggtgaaga--------------
A0A671W556_BCL2L11      ccgcgcctccagtggatatttctcctccgacggagactcgctgccgagct
                                                    *  * ***              

A0A671X848_BMF-01       ------------cgaggcgaca--------------------agac----
A0A671TL42_BAD-01       ------------cgaggctg----------------------gaacgccc
A0A671W556_BCL2L11      ctccgctctccccgaggccactgacggttgatagagccacgcagactccc
                                    ******                          **    

A0A671X848_BMF-01       -----------------------------------------agcggaggg
A0A671TL42_BAD-01       a--ccgac---------------------------------------gga
A0A671W556_BCL2L11      agcccgaccggccaggtgatgcaacacgccctgcagcgcatggctgagga

A0A671X848_BMF-01       gagcaaagc--gggatggagcagct------------tccc---------
A0A671TL42_BAD-01       gcgccgttcagggggcggtccaagt---cgg---ctccccctgc----ct
A0A671W556_BCL2L11      gcgcggacc-ggggacgcaccagctgcacggacactctcccagcccctct
                        * **    *  ***  *   **  *             ***         

A0A671X848_BMF-01       ------cggccgcaacctgtggcacgcagtgtggaggcctg---catcgg
A0A671TL42_BAD-01       tgtgggcggccaagaaatacggc---------------------------
A0A671W556_BCL2L11      agcacacggccacaaaacgcagcaggggacatgcaagcggaggcaattgg
                              *****   *      **                           

A0A671X848_BMF-01       ccagaaactccagctgataggagaccagtttcaccgcgaacacctacaa-
A0A671TL42_BAD-01       -cggcagctccgaaggatgagcgacgagttcgacagcctgctagacaaag
A0A671W556_BCL2L11      acgagagctccgacgcattggagacgacttcaatagacagcttcttctaa
                         *   * ****     **  * *** * **  *  *    *       * 

A0A671X848_BMF-01       ----------------------------------------ctgtatcatc
A0A671TL42_BAD-01       gggagatgaggaaggtgaagagtgccgggacg--------cccaaacaga
A0A671W556_BCL2L11      ggggggt--ggcaggcggacaaaggcggattgtgatcaatccgaaccagc
                                                                *   * **  

A0A671X848_BMF-01       gaaaccaaaggaaccaggggccgctgtggtggcgccttggcgcagctctg
A0A671TL42_BAD-01       tgcacca----ctcgaggagctg--gtggagctacc---------tcttc
A0A671W556_BCL2L11      tgccgcacatccaccaggagccc--gccatgctgctctgcgtgggcctcc
                             **      * *** **    *    *   *               

A0A671X848_BMF-01       atcaaccttctgtttgacaggaggttcatcgctggaggagg---------
A0A671TL42_BAD-01       agccaccaggagatggagggagagaacaaccaccatgacaaccacacac-
A0A671W556_BCL2L11      tgctcctcctgatcggacggata-atctacttgcaaggcag-cacagaca
                          *  *         **  *      *  *      *             

A0A671X848_BMF-01       --tggagcgggacggagg--tga
A0A671TL42_BAD-01       ------accgcactgag---tag
A0A671W556_BCL2L11      gccaggaccactctcaggtttag
                               *    *  **   *  

© 1998-2021Legal notice