Dataset for CDS classical BH3-containing proteins of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673IWZ7_BCL2L11      atggctgacagtacaatattgaagcaaacgctggccaatggcccggcctc
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       atgg----------------------------------------------
A0A673JJ10_BMF-01       atgg----------------------------------------------
A0A673HRQ3_BAD-01       --------------------------------------------------
A0A673J9C6_BAD-01       atgaagacttaccggagtgttggcccgatgcagttagtgtctgtgctctc
A0A673I6H5_BAD-01       --------------------------------------------------
A0A673J5Q9_BAD-01       --------------------------------------------------
                                                                          

A0A673IWZ7_BCL2L11      gcggggaagcggagagagcg------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       --------------------------------------------------
A0A673JJ10_BMF-01       --------------------------------------------------
A0A673HRQ3_BAD-01       --------------------------------------------------
A0A673J9C6_BAD-01       aatctcacgcaggattcgctcgtgctctgctgctgtctcggcgctcgcca
A0A673I6H5_BAD-01       --------------------------------------------------
A0A673J5Q9_BAD-01       --------------------------------------------------
                                                                          

A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       --------------------------------------------------
A0A673JJ10_BMF-01       --------------------------------------------------
A0A673HRQ3_BAD-01       --------------------------------------------------
A0A673J9C6_BAD-01       tcttccataacctcgcgaccacagtctatgctcacgacgcactcttgaga
A0A673I6H5_BAD-01       --------------------------------------------------
A0A673J5Q9_BAD-01       --------------------------------------------------
                                                                          

A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       --------------------------------------------------
A0A673JJ10_BMF-01       --------------------------------------------------
A0A673HRQ3_BAD-01       --------------------------------------------------
A0A673J9C6_BAD-01       acacagcgcccgccggagagagagagaaagagagagagggggaaaatact
A0A673I6H5_BAD-01       --------------------------------------------------
A0A673J5Q9_BAD-01       --------------------------------------------------
                                                                          

A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       --------------------------------------------------
A0A673JJ10_BMF-01       --------------------------------------------------
A0A673HRQ3_BAD-01       --------------------------------------------------
A0A673J9C6_BAD-01       ggagcttttacttccgtgctcagtatcctgcactgtgtgtgagctggaag
A0A673I6H5_BAD-01       --------------------------------------------------
A0A673J5Q9_BAD-01       --------------------------------------------------
                                                                          

A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       --------------------------------------------------
A0A673JJ10_BMF-01       --------------------------------------------------
A0A673HRQ3_BAD-01       --------------------------------------------------
A0A673J9C6_BAD-01       tgaattgtagttgcgctgctactccacataacacgggtgcgtgtcaggac
A0A673I6H5_BAD-01       --------------------------------------------------
A0A673J5Q9_BAD-01       --------------------------------------------------
                                                                          

A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       --------------------------------------------------
A0A673JJ10_BMF-01       --------------------------------------------------
A0A673HRQ3_BAD-01       --------------------------------------------------
A0A673J9C6_BAD-01       agcagcaggaatccaaacagggccagtgagtccaaacatccagacaccca
A0A673I6H5_BAD-01       --------------------------------------------------
A0A673J5Q9_BAD-01       --------------------------------------------------
                                                                          

A0A673IWZ7_BCL2L11      --------------------------------------------------
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       --------------------------------------------------
A0A673JJ10_BMF-01       --------------------------------------------------
A0A673HRQ3_BAD-01       --------------------------------------------------
A0A673J9C6_BAD-01       gatcacccggaagactgtacgtaggacgccgacagactcaagaaatcgtt
A0A673I6H5_BAD-01       --------------------------------------------------
A0A673J5Q9_BAD-01       --------------------------------------------------
                                                                          

A0A673IWZ7_BCL2L11      -----ccggtggcggagctgtcttgcgctctgaacactttgacttccctc
A0A673NIJ7_BCL2L11      --------------------------------------------------
A0A673HDR4_BMF-01       -----atgaggatgaggatgatgtgcgcaggaagggtctacagcgctggc
A0A673JJ10_BMF-01       -----atgatgaggaagacg------------aacagcttcctcactg--
A0A673HRQ3_BAD-01       -----atggcacaaatgttc------------agtatctctgacaatgag
A0A673J9C6_BAD-01       taatcatggcacaaatgttc------------agtatctctgacaatgag
A0A673I6H5_BAD-01       -----atggataaaagattg------------catggccatcaatatgat
A0A673J5Q9_BAD-01       -----atggataacacattg------------catgaccatcaagatgat
                                                                          

A0A673IWZ7_BCL2L11      agccgagcgatggggacccgttaaggggagggattgccatgtcaaatagt
A0A673NIJ7_BCL2L11      -----------------ccgttaaggggagggatttccatgtcgaatagt
A0A673HDR4_BMF-01       cttcctccc----------------------gcgtt-cagat--------
A0A673JJ10_BMF-01       -------ctgtgaaacaccgctaagaaacaagagct-cagag--------
A0A673HRQ3_BAD-01       tcagagacc--gagacatcagaagactgtgaggaat-caggccaggtgaa
A0A673J9C6_BAD-01       tcagacaca--gagacatcggaagactgtgaggact-cggacctgacaaa
A0A673I6H5_BAD-01       tccagcaccttgaatgacaaaaagaaaggaag------agaagagacaat
A0A673J5Q9_BAD-01       tccagcacctggaatgacaaaaagaaaggaag------agaagagacaat
                                                       *                  

A0A673IWZ7_BCL2L11      caccagtcgaggtcaccg--atgtcccgaaccttctccaggtcctctagt
A0A673NIJ7_BCL2L11      caccagtcgaggtcaccg--atgtgccgaaccttctccaggtcctctagt
A0A673HDR4_BMF-01       -----aaagcagaccgagacagcagggagaccccctctatcccccagcgg
A0A673JJ10_BMF-01       -aacagagacggcccacg--agga---gaggtgggacaaacggctaac--
A0A673HRQ3_BAD-01       aaataacagtggatcaccacagag---aaagc------agcatctcgct-
A0A673J9C6_BAD-01       aaataacagtggatcacagcagaaaacaaacc------atgatctcgct-
A0A673I6H5_BAD-01       caatacccatggacaacatcagga-tcaaacctcgccaaacatttctcct
A0A673J5Q9_BAD-01       caaaaaccaaggacaacatcagga-tcaaaccttgccaaacatttctcct
                                   *        *                 *           

A0A673IWZ7_BCL2L11      ----------------ggctatttttccgtcgacagcgattctgtgccaa
A0A673NIJ7_BCL2L11      ----------------ggctatttttccgtcgacagcgattctgtgccaa
A0A673HDR4_BMF-01       catgctgccctgccgagtgcatgtggagcccagacgctt-tctctacggt
A0A673JJ10_BMF-01       ----------------agacacggacgctttgaagacagatcgacgcaga
A0A673HRQ3_BAD-01       ----------------gtgcctgataggctgaaaggagaacaactaggga
A0A673J9C6_BAD-01       ----------------gtgcctgataggctgaaaggagaacaactaggga
A0A673I6H5_BAD-01       ca-------------aggacgtgtgcggctcta-----------ttcgga
A0A673J5Q9_BAD-01       ca-------------agggcgtgtgcggctcta-----------ttcgga
                                                                          

A0A673IWZ7_BCL2L11      gttcc----------------ccactaatgcccaatatttcc--------
A0A673NIJ7_BCL2L11      gttcc----------------ccgctaatgcccaatatttcc--------
A0A673HDR4_BMF-01       aacacaggactgc------tgctgctagcgccgcctagccgctctcgg--
A0A673JJ10_BMF-01       ctgccagaactgtgctgaattcagcgagagatggagatatg---------
A0A673HRQ3_BAD-01       gacaccggaatct------ttccatgaatgatgaggacctgctgg-----
A0A673J9C6_BAD-01       gacacaggaatct------ttcgatgaatgatgaggacctgctgg-----
A0A673I6H5_BAD-01       gtctcaggtgtat--------------atggtcag---ccgctggcagga
A0A673J5Q9_BAD-01       gtctcaggtgtat--------------acggtgag---ccgctggcagga
                            *                        *                    

A0A673IWZ7_BCL2L11      -------------------------gaagcgcaagacggccaaaatgatg
A0A673NIJ7_BCL2L11      -------------------------gaagcgcaagacggccaaaatgatg
A0A673HDR4_BMF-01       --------------------------------------------------
A0A673JJ10_BMF-01       -gcaccattccaggaagggccaagagcactttttcatggaaatgctgga-
A0A673HRQ3_BAD-01       -----------agaccggggca---gcagatgaaggcgatttggttggag
A0A673J9C6_BAD-01       -----------agactggggca---gcagatgaaggtgatttggttggag
A0A673I6H5_BAD-01       agcggtgccccaggatggagcatcggcggaggagaacggaggaacgggag
A0A673J5Q9_BAD-01       agcagagccccaggatggagcattggcggaggagaacggaggaacgggag
                                                                          

A0A673IWZ7_BCL2L11      aggtatggtctgccgaacctagccacc------agcacgtgcagatggca
A0A673NIJ7_BCL2L11      aggtatggtttgccgaacctagccacc------agcacgcgcagatggcg
A0A673HDR4_BMF-01       ---------cctccagacgtggttctccggcagaacctgcgcatgatgga
A0A673JJ10_BMF-01       ------tttcgttcacacttc---ccc------gcattgttcgaacc-cg
A0A673HRQ3_BAD-01       gtga---tcctttcaggcctagatctc------gctcggctcctcctgct
A0A673J9C6_BAD-01       gtga---tccattcaggcctagatctc------gctcggctcctcctgct
A0A673I6H5_BAD-01       atgggcttccattcagaggtcgttctc------aatctgctcctgctgcg
A0A673J5Q9_BAD-01       atggacttccattcagaggtcgttctc------aatctgctcctgctgtg
                                     *     *      *           *  *        

A0A673IWZ7_BCL2L11      gcacctgtcggagc-----catggggccggagatggcggtcgctcgggag
A0A673NIJ7_BCL2L11      gcacctgtgggagc-----catggggccggagatggcggtcgctcgggag
A0A673HDR4_BMF-01       tccggcg-gagagc------------gtggagaccctcatcgggcagaag
A0A673JJ10_BMF-01       tc--ccg-gatagcacacaaaacgcagaagaggac-----ggagggacac
A0A673HRQ3_BAD-01       tt--gtg-ggcagc------------taagaaata-----tggccaacag
A0A673J9C6_BAD-01       tt--gtg-ggcagc------------taagaaata-----tggtcgacag
A0A673I6H5_BAD-01       ct--gtg-gaaagc------------aaagaagta-----cggacggcag
A0A673J5Q9_BAD-01       ct--gtg-gaaagc------------gaagaagta-----cgggcgacag
                              *    ***               **          *      * 

A0A673IWZ7_BCL2L11      ctgcgccgcattggagacgagttcaaccgtctgtactgtcagggggc---
A0A673NIJ7_BCL2L11      ctgcggcgcattggagacgagttcaaccgcctgtactgtcagggggc---
A0A673HDR4_BMF-01       ctccagctgatcggagatcagttcta-t----------------------
A0A673JJ10_BMF-01       cagaagaaaaggaa-gatgaacgtga-tgtgggaattagcgtggagattc
A0A673HRQ3_BAD-01       ctaaggagaatgagtgatgagtttga-catcctccttgataaagggatga
A0A673J9C6_BAD-01       ctaaggagaatgagtgatgagtttga-catcctccttgataaagggatga
A0A673I6H5_BAD-01       ctgaggagaatgagcgatgaatttga-cacatggcttgacaaagg-----
A0A673J5Q9_BAD-01       ctgaggagaatgagcgatgaatttga-cacatggctcgacaaagg-----
                        *        *     **  *     *                        

A0A673IWZ7_BCL2L11      ----------------cggtgca----------------ggcgggaacaa
A0A673NIJ7_BCL2L11      ----------------cggtgca----------------ggtgggaacaa
A0A673HDR4_BMF-01       -----------------------------------------caggagcac
A0A673JJ10_BMF-01       agattggacgtaaactgcgtgaaatgggggatcagtttcagcaggaacat
A0A673HRQ3_BAD-01       aga-------------gggtgaagag-------------cgcaggaacaa
A0A673J9C6_BAD-01       aga-------------gggtgaagag-------------tgcaggaacaa
A0A673I6H5_BAD-01       -ag-------------aggtcaaaag-------------agc--gaaca-
A0A673J5Q9_BAD-01       -gg-------------aggtcaaaag-------------agc--gaaca-
                                                                    ** ** 

A0A673IWZ7_BCL2L11      cgc---------------ggcccagctg----------------------
A0A673NIJ7_BCL2L11      cgg---------------ggcccagctg----------------------
A0A673HDR4_BMF-01       ------------------atgatggt------------------------
A0A673JJ10_BMF-01       cttcagctggtaatactgatttcagatgagactagtttcttttcctcaag
A0A673HRQ3_BAD-01       c-----------------acgtcaga------------------------
A0A673J9C6_BAD-01       c-----------------acgtcaga------------------------
A0A673I6H5_BAD-01       --------------------gtcaga------------------------
A0A673J5Q9_BAD-01       --------------------gccaga------------------------
                                                *                         

A0A673IWZ7_BCL2L11      --cgcgctccc---aacgaacacg----ccatcatcatgtggatgaacga
A0A673NIJ7_BCL2L11      --cgcgctccc---aacgaacacg----ccatcatcatgtggatgaacga
A0A673HDR4_BMF-01       --gacgctcctttacacaaaagtgttttccgt------gtgccgtgtttg
A0A673JJ10_BMF-01       tctgtggtttt---cactgcagtggtttctgtcacgatgtgcaatgacat
A0A673HRQ3_BAD-01       --tgcggcagt---cccccagctggttggcct------------------
A0A673J9C6_BAD-01       --tgcagcagt---cacccagctggttcgctt------------------
A0A673I6H5_BAD-01       --aacagacct---accgaggatggttctcgt------------------
A0A673J5Q9_BAD-01       --aacagacct---accgaggatggttctcgt------------------
                                        *      *       *                  

A0A673IWZ7_BCL2L11      ccttatcggacgtgtagtacagtttttcctgcgaag-----------gag
A0A673NIJ7_BCL2L11      ctttatcggacgtgtagtacagtttttcctgcgaag-----------aag
A0A673HDR4_BMF-01       ttttggccggactgtttcc-------------------------------
A0A673JJ10_BMF-01       catcgtctgtt--atttcaatgctgcatatgcaaatgctcagtgggagag
A0A673HRQ3_BAD-01       --tcctttgga--gtcacaaagagtctgatgctgagtcgcgccccgcaga
A0A673J9C6_BAD-01       --tcctttgga--gtcacaaagagtctgatgcagagtcgcgccccgcaga
A0A673I6H5_BAD-01       --tcctctgga--gttccaaaga---------agaggaggg---cagaga
A0A673J5Q9_BAD-01       --tcctctgga--gtcccaaaga---------agaggaggg---cagaga
                          *     *     *                                   

A0A673IWZ7_BCL2L11      atga----------------------------------------------
A0A673NIJ7_BCL2L11      atga----------------------------------------------
A0A673HDR4_BMF-01       -tga----------------------------------------------
A0A673JJ10_BMF-01       atgacatcatttttggtttacccgagttatattgtgtttttgttgtagtt
A0A673HRQ3_BAD-01       gtga----------------------------------------------
A0A673J9C6_BAD-01       gtga----------------------------------------------
A0A673I6H5_BAD-01       atga----------------------------------------------
A0A673J5Q9_BAD-01       atga----------------------------------------------
                         ***                                              

A0A673IWZ7_BCL2L11      ---------
A0A673NIJ7_BCL2L11      ---------
A0A673HDR4_BMF-01       ---------
A0A673JJ10_BMF-01       aaaaactag
A0A673HRQ3_BAD-01       ---------
A0A673J9C6_BAD-01       ---------
A0A673I6H5_BAD-01       ---------
A0A673J5Q9_BAD-01       ---------
                                 

© 1998-2020Legal notice