Dataset for CDS BAD of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673HRQ3_BAD-01      --------------------------------------------------
A0A673J9C6_BAD-01      atgaagacttaccggagtgttggcccgatgcagttagtgtctgtgctctc
A0A673I6H5_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
                                                                         

A0A673HRQ3_BAD-01      --------------------------------------------------
A0A673J9C6_BAD-01      aatctcacgcaggattcgctcgtgctctgctgctgtctcggcgctcgcca
A0A673I6H5_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
                                                                         

A0A673HRQ3_BAD-01      --------------------------------------------------
A0A673J9C6_BAD-01      tcttccataacctcgcgaccacagtctatgctcacgacgcactcttgaga
A0A673I6H5_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
                                                                         

A0A673HRQ3_BAD-01      --------------------------------------------------
A0A673J9C6_BAD-01      acacagcgcccgccggagagagagagaaagagagagagggggaaaatact
A0A673I6H5_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
                                                                         

A0A673HRQ3_BAD-01      --------------------------------------------------
A0A673J9C6_BAD-01      ggagcttttacttccgtgctcagtatcctgcactgtgtgtgagctggaag
A0A673I6H5_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
                                                                         

A0A673HRQ3_BAD-01      --------------------------------------------------
A0A673J9C6_BAD-01      tgaattgtagttgcgctgctactccacataacacgggtgcgtgtcaggac
A0A673I6H5_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
                                                                         

A0A673HRQ3_BAD-01      --------------------------------------------------
A0A673J9C6_BAD-01      agcagcaggaatccaaacagggccagtgagtccaaacatccagacaccca
A0A673I6H5_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
                                                                         

A0A673HRQ3_BAD-01      --------------------------------------------------
A0A673J9C6_BAD-01      gatcacccggaagactgtacgtaggacgccgacagactcaagaaatcgtt
A0A673I6H5_BAD-01      --------------------------------------------------
A0A673J5Q9_BAD-01      --------------------------------------------------
                                                                         

A0A673HRQ3_BAD-01      -----atggcacaaatgttcagtatctctgacaatgagtcagagacc--g
A0A673J9C6_BAD-01      taatcatggcacaaatgttcagtatctctgacaatgagtcagacaca--g
A0A673I6H5_BAD-01      -----atggataaaagattgcatggccatcaatatgattccagcaccttg
A0A673J5Q9_BAD-01      -----atggataacacattgcatgaccatcaagatgattccagcacctgg
                            ****   * *  **   *  *  * *  **** **    **   *

A0A673HRQ3_BAD-01      agacatcagaagactgtgaggaatcaggccaggtgaaaaataacagtgga
A0A673J9C6_BAD-01      agacatcggaagactgtgaggactcggacctgacaaaaaataacagtgga
A0A673I6H5_BAD-01      aatgacaaaaagaaaggaag-----agaagagacaatcaatacccatgga
A0A673J5Q9_BAD-01      aatgacaaaaagaaaggaag-----agaagagacaatcaaaaaccaagga
                       *   *    ****  *  **      *    *   *  ** * *   ***

A0A673HRQ3_BAD-01      tcaccacagag---aaagc------agcatctcgct----gtgcctgata
A0A673J9C6_BAD-01      tcacagcagaaaacaaacc------atgatctcgct----gtgcctgata
A0A673I6H5_BAD-01      caacatcagga-tcaaacctcgccaaacatttctcctcaaggacgtgtgc
A0A673J5Q9_BAD-01      caacatcagga-tcaaaccttgccaaacatttctcctcaagggcgtgtgc
                         **  ***     *** *      *  ** ** *     *  * **   

A0A673HRQ3_BAD-01      ggctgaaaggagaacaactagggagacaccggaatctttccatgaatgat
A0A673J9C6_BAD-01      ggctgaaaggagaacaactagggagacacaggaatctttcgatgaatgat
A0A673I6H5_BAD-01      ggctcta-----------ttcggagtctcaggtgtat--------atggt
A0A673J5Q9_BAD-01      ggctcta-----------ttcggagtctcaggtgtat--------acggt
                       ****  *           *  **** * * **  * *        * * *

A0A673HRQ3_BAD-01      gaggacctgctgg----------------agaccggggca---gcagatg
A0A673J9C6_BAD-01      gaggacctgctgg----------------agactggggca---gcagatg
A0A673I6H5_BAD-01      cag---ccgctggcaggaagcggtgccccaggatggagcatcggcggagg
A0A673J5Q9_BAD-01      gag---ccgctggcaggaagcagagccccaggatggagcattggcggagg
                        **   * *****                **   ** ***   ** ** *

A0A673HRQ3_BAD-01      aaggcgatttggttggaggtga---tcctttcaggcctagatctcgctcg
A0A673J9C6_BAD-01      aaggtgatttggttggaggtga---tccattcaggcctagatctcgctcg
A0A673I6H5_BAD-01      agaacggaggaacgggagatgggcttccattcagaggtcgttctcaatct
A0A673J5Q9_BAD-01      agaacggaggaacgggagatggacttccattcagaggtcgttctcaatct
                       *    *        **** **    *** *****   * * ****  ** 

A0A673HRQ3_BAD-01      gctcctcctgctttgtgggcagctaagaaatatggccaacagctaaggag
A0A673J9C6_BAD-01      gctcctcctgctttgtgggcagctaagaaatatggtcgacagctaaggag
A0A673I6H5_BAD-01      gctcctgctgcgctgtggaaagcaaagaagtacggacggcagctgaggag
A0A673J5Q9_BAD-01      gctcctgctgtgctgtggaaagcgaagaagtacgggcgacagctgaggag
                       ****** ***   *****  *** ***** ** ** *  ***** *****

A0A673HRQ3_BAD-01      aatgagtgatgagtttgacatcctccttgataaagggatgaagagggtga
A0A673J9C6_BAD-01      aatgagtgatgagtttgacatcctccttgataaagggatgaagagggtga
A0A673I6H5_BAD-01      aatgagcgatgaatttgacacatggcttgacaaagg------agaggtca
A0A673J5Q9_BAD-01      aatgagcgatgaatttgacacatggctcgacaaagg------ggaggtca
                       ****** ***** *******     ** ** *****         *** *

A0A673HRQ3_BAD-01      agagcgcaggaacaacacgtcagatgcggcagtcccccagctggttggcc
A0A673J9C6_BAD-01      agagtgcaggaacaacacgtcagatgcagcagtcacccagctggttcgct
A0A673I6H5_BAD-01      aaagagc--gaaca----gtcagaaacagacctaccgaggatggttctcg
A0A673J5Q9_BAD-01      aaagagc--gaaca----gccagaaacagacctaccgaggatggttctcg
                       * ** **  *****    * ****  * *   *  *   * *****  * 

A0A673HRQ3_BAD-01      ttcctttggagtcacaaagagtctgatgctgagtcgcgccccgcagagtg
A0A673J9C6_BAD-01      ttcctttggagtcacaaagagtctgatgcagagtcgcgccccgcagagtg
A0A673I6H5_BAD-01      ttcctctggagttccaaaga---------agaggaggg---cagagaatg
A0A673J5Q9_BAD-01      ttcctctggagtcccaaaga---------agaggaggg---cagagaatg
                       ***** ******  ******          ***  * *   *  *** **

A0A673HRQ3_BAD-01      a
A0A673J9C6_BAD-01      a
A0A673I6H5_BAD-01      a
A0A673J5Q9_BAD-01      a
                       *

© 1998-2020Legal notice