Dataset for CDS BAD of organism Sinocyclocheilus grahami

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A672LB88_BAD-01      atggataacacactgcatgaccatcaagatgattccagcacc------tg
A0A672R7P6_BAD-01      atggataaaagattgcatgaccatcgaaatgattccagcacc------tt
A0A672RGH0_BAD-01      atggcacaaatgttcagtatctcggacaatgagtcagagaccgagacatc
A0A672SAE4_BAD-01      atggcacaaatgttcagtatctctgacaatgagtcggacaccgagacatc
A0A672SAE4_BAD-02      atggcacaaatgttcagtatctctgacaatgagtcggacaccgagacatc
                       ****   * *   *   *  *       **** **    ***      * 

A0A672LB88_BAD-01      gaatgacaaaaagaaa-------ggaagagaagagacaatcaaaaaccaa
A0A672R7P6_BAD-01      gaatgacagaaagaaa-------ggaagagaagagacaatcaatacccgt
A0A672RGH0_BAD-01      ggaagactgtgaggaatcgggccaggtgaaaaataacagtggatcaccac
A0A672SAE4_BAD-01      ggaagactgtgaggactcggacctgacaaaaaataacagtggatcaccgc
A0A672SAE4_BAD-02      ggaagactgtgaggactcggacctgacaaaaaataacagtggatcaccgc
                       * * ***    ** *         *   * **   *** *  *   **  

A0A672LB88_BAD-01      ggacaaca--tcaggatcaaaccttgccaaacatttctcctcaagggcgt
A0A672R7P6_BAD-01      ggacaaca--tcaggatcaaaccttgccaaacatttctcctcaaggacgt
A0A672RGH0_BAD-01      agagaacg---cagcatctcgctgtgcctggtaggctgaaaggagaacaa
A0A672SAE4_BAD-01      agaaaacaaaccatgatctcgctgtgcctgataggctgaaaggagaacaa
A0A672SAE4_BAD-02      agaaaacaaaccatgatctcgctgtgcctgataggctgaaaggagaacaa
                        ** ***    **  ***   *  ****    *          **  *  

A0A672LB88_BAD-01      gtgcggctctattcggagtctcaggtgtat-acggtgagccgctggcagg
A0A672R7P6_BAD-01      gtgcggctctattcggagtctcaggtgtat-atggtcagccgctggcagg
A0A672RGH0_BAD-01      ctagggagacaccggaatctttccatgaatgatgaggacctgctgg----
A0A672SAE4_BAD-01      ctagggagacacaggaatctttcgatgaatgatgaggacctgctgg----
A0A672SAE4_BAD-02      ctagggagacacaggaatctttcgatgaatgatgaggacctgctgg----
                        *  **    *   * *   *    ** ** * *   * * *****    

A0A672LB88_BAD-01      aagcagagccccaggatggagcattggtggaggagaacggaggaacggga
A0A672R7P6_BAD-01      aagctgagccccaggatggagcatcggcggaggagaacggaggaacggga
A0A672RGH0_BAD-01      ------------agaccggggca---gcagatgaaggcgatttggttgga
A0A672SAE4_BAD-01      ------------agactggggct---gcagatgaaggcgatttggttgga
A0A672SAE4_BAD-02      ------------agactggggct---gcagatgaaggcgatttggttgga
                                   **   ** **    *  ** **   **        ***

A0A672LB88_BAD-01      gatggacttccattcagaggtcgttctcagtctgctcctgctgctctgtg
A0A672R7P6_BAD-01      gatggacttccattcagaggtcgttctcagtctgctcctgctgcgctgtg
A0A672RGH0_BAD-01      ggtga---tcctttcaggcctagatcccgctcggctcctcctgctttgtg
A0A672SAE4_BAD-01      ggtga---tccattcaggcctagatctcgctcggctcctcctgctttgtg
A0A672SAE4_BAD-02      ggtga---tccattcaggcctagatctcgctcggctcctcctgctttgtg
                       * **    *** *****   * * ** *  ** ****** ****  ****

A0A672LB88_BAD-01      gaaagcaaagaagtacgggcgacagctgaggagaatgagcgatgaatttg
A0A672R7P6_BAD-01      gaaagcaaagaagtacggacggcagctgaggagaatgagcgatgaatttg
A0A672RGH0_BAD-01      ggcagctaagaaatatggccaacagctaaggagaatgagtgatgagtttg
A0A672SAE4_BAD-01      ggcagctaagaaatatggtcgacagctaaggagaatgagtgatgagtttg
A0A672SAE4_BAD-02      ggcagctaagaaatatggtcgacagctaaggagaatgagtgatgagtttg
                       *  *** ***** ** ** *  ***** *********** ***** ****

A0A672LB88_BAD-01      acacatggctcgacaaagg------ggaggtcaaaagagc--gaaca---
A0A672R7P6_BAD-01      acacatggcttgacaaagg------agaggtcaaaagagc--gaaca---
A0A672RGH0_BAD-01      acatcctccttgataaagggatgaagagggtgaagagtgcaggaacaaca
A0A672SAE4_BAD-01      acatcctccttgataaagggatgaagagggtgaagagtgcaggaacaaca
A0A672SAE4_BAD-02      acatcctccttgataaagggatgaagagggtgaagagtgcaggaacaaca
                       ***     ** ** *****         *** ** ** **  *****   

A0A672LB88_BAD-01      -gccagaaacagacctaccgaggatggttctcgttcctctggagttccaa
A0A672R7P6_BAD-01      -gtcagaaacagacctaccgaggatggttctcgttcctctggagttccaa
A0A672RGH0_BAD-01      cgtcagatgcggcagtcccccagctggttggccttcctttggagtcacaa
A0A672SAE4_BAD-01      cgtcagatgcagcagtcacccagctggttcgctttcctttggagtcacaa
A0A672SAE4_BAD-02      cgtcagatgcagcagtcacccagctggttcgctttcctttggagtcacaa
                        * ****  * *   *  *   * *****  * ***** ******  ***

A0A672LB88_BAD-01      aga---agaggaggg---------cagagaatga
A0A672R7P6_BAD-01      aga---cgaggaggg---------cagagaatga
A0A672RGH0_BAD-01      agagtctgatgctgagtcacgccccgctgagtga
A0A672SAE4_BAD-01      agagtctgatgcggagtcgcgccccgcagagtga
A0A672SAE4_BAD-02      agagtctgatgcggagtcgcgccccgcagagtga
                       ***    ** *  *          *   ** ***

© 1998-2021Legal notice