Dataset for CDS classical BH3-containing proteins of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671M057_BCL2L11      atgtctgaca-------cgtccagagagcaaacgccgggc----------
A0A671SJ75_BCL2L11      gtaagtgata----------ctacaacacaaacgctggccaatggcccgg
A0A671M0H4_BMF-01       atggatgagg------------atgaggatgatgtgcgca----------
A0A671M0H4_BMF-02       atggatgagg------------atgaggatgatgtgcgca----------
A0A671MNR9_BMF-01       atggatgagg------------atgaggatgatgtgcgca----------
A0A671PX91_BAD-01       atggataacacattgcatgaccatcaagatgattccagca----------
A0A671SBB4_BAD-01       atggataaaagattgcatgaccatcaaaatgattccagca----------
A0A671NP27_BAD-01       atggcacaaatgttcagcatctctgacaatgagtcggaca----------
A0A671RUV0_BAD-01       atggcacaaatgttcagtatctctgacaatgagtcagaga----------
                         *     *                       *                  

A0A671M057_BCL2L11      -----cggggaagcggagagagcgccgg-------------tggcggagc
A0A671SJ75_BCL2L11      cctcgcggggaagcggagagagcgccgg-------------tggcggagc
A0A671M0H4_BMF-01       -----ggaagggtctacagcgctggccttcctcccgcgttcagataaagc
A0A671M0H4_BMF-02       -----ggaagggtctacagcgctggccttcctcccgcgttcagataaagc
A0A671MNR9_BMF-01       -----ggaagggtctacagcactggccttcctcccgcgttcagataaagc
A0A671PX91_BAD-01       -----cc------tggaatgacaa-----------------aaagaaa--
A0A671SBB4_BAD-01       -----cc------ttgaatgacaa-----------------aaagaaa--
A0A671NP27_BAD-01       -----cagagacatcggaagactg-----------------tgaggactc
A0A671RUV0_BAD-01       -----ccgagacatcggaagactg-----------------tgaggaatc
                                                                          

A0A671M057_BCL2L11      tgtcgtgcgctccgggtactttgacttccctcagccgagcgatggggacc
A0A671SJ75_BCL2L11      tgtcttgcgctccgggcactttgacttccctcagccgagcgatggggacc
A0A671M0H4_BMF-01       agaccgagacagcagggaca------ccccctgtatcccccagcggcatg
A0A671M0H4_BMF-02       agaccgagacagcagggaca------ccccctgtatcccccagcggcatg
A0A671MNR9_BMF-01       agaccgagacagcagggaga------ccccctctatcccccagcggcatg
A0A671PX91_BAD-01       -----ggaagagaagagacaatcaaaaaccaaggaca--acatcaggatc
A0A671SBB4_BAD-01       -----ggaagagaagagacaatcaatacccatggaca--acatcaggatc
A0A671NP27_BAD-01       ggacctgacaaaaaataacagtggatcaccgcagaaaacaaaccatgatc
A0A671RUV0_BAD-01       aggccaggcgaaaaataacagtggatcaccacagag---aaagcagcatc
                                         *          **           *     *  

A0A671M057_BCL2L11      cgttaaggggagggatttccatgtcgaatagtcaccagtcgaggtcaccg
A0A671SJ75_BCL2L11      cgttaaggggagggattgccatgtcaaatagtcaccagtcgaggtcaccg
A0A671M0H4_BMF-01       c---------------tgccctgccgagtgcat----gtcgagcccac--
A0A671M0H4_BMF-02       c---------------tgccctgccgagtgcat----gtcgagcccac--
A0A671MNR9_BMF-01       c---------------tgccctgccgagtgaat----gtggagcccag--
A0A671PX91_BAD-01       a---------------aaccttgccaaacattt-ctcctcaagggcg---
A0A671SBB4_BAD-01       a---------------aaccttgccaaacattt-ctcctcaaggacg---
A0A671NP27_BAD-01       t---------------ggctgtgcctgataggc-tgaaaggagaaca---
A0A671RUV0_BAD-01       t---------------cgctgtgcctgataggc-tgaaaggagaaca---
                                          *  ** *                **  *    

A0A671M057_BCL2L11      atgtgccgaaccttctccaggtcctctagtggctatttttccgtcgacag
A0A671SJ75_BCL2L11      atgtcccgaaccttctccaggtcctctagtggctatttttccgtcgacag
A0A671M0H4_BMF-01       -----acgctttctctacgggaacgcagg----attgttacttctagcgt
A0A671M0H4_BMF-02       -----acgctttctctacgggaacgcagg----attgttacttctagcgt
A0A671MNR9_BMF-01       -----acgctttctctacggtaacacagg----actgctgctgctagcgc
A0A671PX91_BAD-01       -------------tgtgcggctctattcg----gagtctcaggtgtat-a
A0A671SBB4_BAD-01       -------------tgtgcggttctattcg----gagtctcaggtgtat-a
A0A671NP27_BAD-01       -------------actagggagacacagg----aatctttcgatgaatga
A0A671RUV0_BAD-01       -------------actagggagacaccgg----aatctttccatgaatga
                                       *   *        *         *           

A0A671M057_BCL2L11      cgattctgtgccaggttccccgctaa----------------tgcccaat
A0A671SJ75_BCL2L11      cgattctatgccaagttccccgctaa----------------tgcccaat
A0A671M0H4_BMF-01       ctc------------ccagccgctctcag---------------------
A0A671M0H4_BMF-02       ctc------------ccagccgctctcag---------------------
A0A671MNR9_BMF-01       cgc------------ctagccgctctcgg---------------------
A0A671PX91_BAD-01       cgg------------tgagccgctggcaggaagcagagccccaggatgga
A0A671SBB4_BAD-01       tgg------------tcagccgctggcaggaagcagagccccaggatgga
A0A671NP27_BAD-01       tga------------gaacctgctgg----------------agactggg
A0A671RUV0_BAD-01       tga------------ggacctgctgg----------------agaccggg
                                           * ***                          

A0A671M057_BCL2L11      atttccgaagcgcaagacggccaaaatgatgaggtatggtttgccgaacc
A0A671SJ75_BCL2L11      atttccgaagcgcaagacggccaaaatgatgaggtatggtctgccgaacc
A0A671M0H4_BMF-01       ----------------------------------------cctccagacg
A0A671M0H4_BMF-02       ----------------------------------------cctccagacg
A0A671MNR9_BMF-01       ----------------------------------------cctccagacg
A0A671PX91_BAD-01       gcattggcggaggagaacggaggaacgggagatggacttccattcagagg
A0A671SBB4_BAD-01       gcatcggcggaggagaacggaggaacgggagatggacttccattcagagg
A0A671NP27_BAD-01       gca---gcagatgaaggcgatttggttggaagtga---tccattcaggcc
A0A671RUV0_BAD-01       gca---gcagatgaaggcgatttggttggaggtga---tcctttcaggcc
                                                                    *     

A0A671M057_BCL2L11      tag----ccaccagcacgcacagatggcggcacctgtgg-----------
A0A671SJ75_BCL2L11      tag----ccaccagcacgtgcagatggcagcacctgtcg-----------
A0A671M0H4_BMF-01       tggttctccggcaggacctgcggatgatggacccagcggtggcgcggccc
A0A671M0H4_BMF-02       tggttctccggcaggacctgcggatgatggacccagcggtggcgcggccc
A0A671MNR9_BMF-01       tggttctccggcagaacctgcgcatgatggatccggcgg-----------
A0A671PX91_BAD-01       tcgttctcaatctgctcctgctg--------cgctgtgg-----------
A0A671SBB4_BAD-01       tcgttctcaatctgctcctgctg--------cgctgtgg-----------
A0A671NP27_BAD-01       tagatctcgctcggctcctcctg--------ctttgtgg-----------
A0A671RUV0_BAD-01       tagatctcgctcggctcctcctg--------ctttgtgg-----------
                        * *    *   * *  *   *              *  *           

A0A671M057_BCL2L11      -----gagccatggggccggagatggcggtcgctcgggagctgcggcgca
A0A671SJ75_BCL2L11      -----gagccatggggccggagatggcggtcgctcgggagctgcggcgca
A0A671M0H4_BMF-01       gagcggagcgt-------ggagaccctcatcgggcagaagctccagctga
A0A671M0H4_BMF-02       gagcggagcgt-------ggagaccctcatcgggcagaagctccagctga
A0A671MNR9_BMF-01       ----agagcgt-------ggagaccctcatcgggcagaagctccagctga
A0A671PX91_BAD-01       ----aaagcaa-------agaagta-----cgggcgacagctgaggagaa
A0A671SBB4_BAD-01       ----aaagcaa-------agaagta-----cggacggcagctgaggagaa
A0A671NP27_BAD-01       ----gcagcta-------agaaata-----tggtcgacagctaaggagaa
A0A671RUV0_BAD-01       ----gcagcta-------agaaata-----tggccaacagctaaggagaa
                              ***          **          *  *   ****   *   *

A0A671M057_BCL2L11      ttggagacgagttcaaccgcctgtac-----------tgtcagggggccg
A0A671SJ75_BCL2L11      ttggagacgagttcaaccgtctgtac-----------tgtcagggggccg
A0A671M0H4_BMF-01       tcggagatcagttc-----------------------tatcaggagcaca
A0A671M0H4_BMF-02       tcggagatcagttc-----------------------tatcaggagcaca
A0A671MNR9_BMF-01       tcggagatcagttc-----------------------tatcaggagcaca
A0A671PX91_BAD-01       tgagcgatgaatttgacacatggctcgacaaaggggaggtcaaaagagcg
A0A671SBB4_BAD-01       tgagcgatgaatttgacacatggcttgacaaaggagaggtcaaaagagcg
A0A671NP27_BAD-01       tgagtgatgagtttgacatcctccttgataaagg---gatgaagagggtg
A0A671RUV0_BAD-01       tgagtgatgagtttgacatcctccttgataaagg---gatgaagagggtg
                        *  * **  * **                          * *   *    

A0A671M057_BCL2L11      gtgcaggtgggaacaacggggcccagctgcgcgctcccaacgaacacgcc
A0A671SJ75_BCL2L11      gtgcaggcgggaacaacgcggcccagctgcgcgctcccaacgaacacgcc
A0A671M0H4_BMF-01       tgatg-----gtgagtcgggt--cgggtcaggagatcctgtgaacgtgtt
A0A671M0H4_BMF-02       tgatg-----gtgagtcgggt--cgggtcaggagatcctgtgaacgtgtt
A0A671MNR9_BMF-01       tgatgcatcacagaaaccaaa--ggaaccgggagccgctgtggtggcgcg
A0A671PX91_BAD-01       aacagc-----------------cagaaacagacctaccgaggatg-gtt
A0A671SBB4_BAD-01       aacagt-----------------cagaaacagacctaccgtggatg-gtt
A0A671NP27_BAD-01       aagagtgcaggaacaacacgt--cagatgcagcagtcacccagctg-gtt
A0A671RUV0_BAD-01       aagagcgcaggaactacacgg--cagatgcggcagtcccccagctg-gtt
                                                                       *  

A0A671M057_BCL2L11      atca-tcatgtggatgaacga---------------ccttatcggacgtg
A0A671SJ75_BCL2L11      atca-tcatgtggatgaacga---------------ccttatcggacgtg
A0A671M0H4_BMF-01       ttctgtgcgctgg-atcataatcgcattatgtcttgctttagcgctcgtt
A0A671M0H4_BMF-02       ttctgtgcgctgg-atcataatcgcattatgtcttgctttagcgctcgtt
A0A671MNR9_BMF-01       t----ggcggtggcgttcta--cacgcttttatttggaagagagccca--
A0A671PX91_BAD-01       ctcgttcctctggagtcccaa-------------------agaa---g--
A0A671SBB4_BAD-01       ctcgttcctcttgagttccaa-------------------agaa---g--
A0A671NP27_BAD-01       cgctttcctttggagtcacaa-------------------agagtctg--
A0A671RUV0_BAD-01       ggccttcctttggagtcacaa-------------------agagtctg--
                                  * *                           *         

A0A671M057_BCL2L11      tagtacagtttttcctgcgaagaaga------------------------
A0A671SJ75_BCL2L11      tagtacagtttttcctgcgaaggaga------------------------
A0A671M0H4_BMF-01       tacacaaaagcgttttccatgtgccgtgtttgttttggacggactgtttc
A0A671M0H4_BMF-02       tacacaaaagcgttttccatgtgccgtgtttgttttggacggactgtttc
A0A671MNR9_BMF-01       -acgcaagagcaaatcgcagg-----------------------------
A0A671PX91_BAD-01       -aggaggg---------cagagaa--------------------------
A0A671SBB4_BAD-01       -aggaggg---------cagagaa--------------------------
A0A671NP27_BAD-01       -atgcggagtctcgccccgcagag--------------------------
A0A671RUV0_BAD-01       -atgctgagtcgcgccccgcagag--------------------------
                         *               *                                

A0A671M057_BCL2L11      -tga
A0A671SJ75_BCL2L11      -tga
A0A671M0H4_BMF-01       ctga
A0A671M0H4_BMF-02       ctga
A0A671MNR9_BMF-01       -tga
A0A671PX91_BAD-01       -tga
A0A671SBB4_BAD-01       -tga
A0A671NP27_BAD-01       -tga
A0A671RUV0_BAD-01       -tga
                         ***

© 1998-2020Legal notice