Dataset for CDS BCL2L11 of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671M057_BCL2L11      atgtctgacacgtccagagagcaaacgccgggc---------------cg
A0A671SJ75_BCL2L11      gtaagtgata---ctacaacacaaacgctggccaatggcccggcctcgcg
                         *   *** *   * * *   ******* ** *               **

A0A671M057_BCL2L11      gggaagcggagagagcgccggtggcggagctgtcgtgcgctccgggtact
A0A671SJ75_BCL2L11      gggaagcggagagagcgccggtggcggagctgtcttgcgctccgggcact
                        ********************************** *********** ***

A0A671M057_BCL2L11      ttgacttccctcagccgagcgatggggacccgttaaggggagggatttcc
A0A671SJ75_BCL2L11      ttgacttccctcagccgagcgatggggacccgttaaggggagggattgcc
                        *********************************************** **

A0A671M057_BCL2L11      atgtcgaatagtcaccagtcgaggtcaccgatgtgccgaaccttctccag
A0A671SJ75_BCL2L11      atgtcaaatagtcaccagtcgaggtcaccgatgtcccgaaccttctccag
                        ***** **************************** ***************

A0A671M057_BCL2L11      gtcctctagtggctatttttccgtcgacagcgattctgtgccaggttccc
A0A671SJ75_BCL2L11      gtcctctagtggctatttttccgtcgacagcgattctatgccaagttccc
                        ************************************* ***** ******

A0A671M057_BCL2L11      cgctaatgcccaatatttccgaagcgcaagacggccaaaatgatgaggta
A0A671SJ75_BCL2L11      cgctaatgcccaatatttccgaagcgcaagacggccaaaatgatgaggta
                        **************************************************

A0A671M057_BCL2L11      tggtttgccgaacctagccaccagcacgcacagatggcggcacctgtggg
A0A671SJ75_BCL2L11      tggtctgccgaacctagccaccagcacgtgcagatggcagcacctgtcgg
                        **** ***********************  ******** ******** **

A0A671M057_BCL2L11      agccatggggccggagatggcggtcgctcgggagctgcggcgcattggag
A0A671SJ75_BCL2L11      agccatggggccggagatggcggtcgctcgggagctgcggcgcattggag
                        **************************************************

A0A671M057_BCL2L11      acgagttcaaccgcctgtactgtcagggggccggtgcaggtgggaacaac
A0A671SJ75_BCL2L11      acgagttcaaccgtctgtactgtcagggggccggtgcaggcgggaacaac
                        ************* ************************** *********

A0A671M057_BCL2L11      ggggcccagctgcgcgctcccaacgaacacgccatcatcatgtggatgaa
A0A671SJ75_BCL2L11      gcggcccagctgcgcgctcccaacgaacacgccatcatcatgtggatgaa
                        * ************************************************

A0A671M057_BCL2L11      cgaccttatcggacgtgtagtacagtttttcctgcgaagaagatga
A0A671SJ75_BCL2L11      cgaccttatcggacgtgtagtacagtttttcctgcgaaggagatga
                        *************************************** ******

© 1998-2020Legal notice