Dataset for CDS BAD of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671PX91_BAD-01      atggataacacattgcatgaccatcaagatgattccagcacc------tg
A0A671SBB4_BAD-01      atggataaaagattgcatgaccatcaaaatgattccagcacc------tt
A0A671NP27_BAD-01      atggcacaaatgttcagcatctctgacaatgagtcggacacagagacatc
A0A671RUV0_BAD-01      atggcacaaatgttcagtatctctgacaatgagtcagagaccgagacatc
                       ****   * *  **      *  * *  **** **    **       * 

A0A671PX91_BAD-01      gaatgacaaaaagaaa-------ggaagagaagagacaatcaaaaaccaa
A0A671SBB4_BAD-01      gaatgacaaaaagaaa-------ggaagagaagagacaatcaatacccat
A0A671NP27_BAD-01      ggaagactgtgaggactcggacctgacaaaaaataacagtggatcaccgc
A0A671RUV0_BAD-01      ggaagactgtgaggaatcaggccaggcgaaaaataacagtggatcaccac
                       * * ***    ** *         *   * **   *** *  *   **  

A0A671PX91_BAD-01      ggaca--acatcaggatcaaaccttgccaaacatttctcctcaagggcgt
A0A671SBB4_BAD-01      ggaca--acatcaggatcaaaccttgccaaacatttctcctcaaggacgt
A0A671NP27_BAD-01      agaaaacaaaccatgatctggctgtgcctgataggctgaaaggagaacaa
A0A671RUV0_BAD-01      agag---aaagcagcatctcgctgtgcctgataggctgaaaggagaacaa
                        **    * * **  ***   *  ****  * *          **  *  

A0A671PX91_BAD-01      gtgcggctctattcggagtctcaggtgtat-acggtgagccgctggcagg
A0A671SBB4_BAD-01      gtgcggttctattcggagtctcaggtgtat-atggtcagccgctggcagg
A0A671NP27_BAD-01      ctagggagacacaggaatctttcgatgaatgatgagaacctgctgg----
A0A671RUV0_BAD-01      ctagggagacaccggaatctttccatgaatgatgaggacctgctgg----
                        *  **    *   * *   *    ** ** * *   * * *****    

A0A671PX91_BAD-01      aagcagagccccaggatggagcattggcggaggagaacggaggaacggga
A0A671SBB4_BAD-01      aagcagagccccaggatggagcatcggcggaggagaacggaggaacggga
A0A671NP27_BAD-01      ------------agactggggca---gcagatgaaggcgatttggttgga
A0A671RUV0_BAD-01      ------------agaccggggca---gcagatgaaggcgatttggttgga
                                   **   ** ***   ** ** **   **        ***

A0A671PX91_BAD-01      gatggacttccattcagaggtcgttctcaatctgctcctgctgcgctgtg
A0A671SBB4_BAD-01      gatggacttccattcagaggtcgttctcaatctgctcctgctgcgctgtg
A0A671NP27_BAD-01      agtga---tccattcaggcctagatctcgctcggctcctcctgctttgtg
A0A671RUV0_BAD-01      ggtga---tcctttcaggcctagatctcgctcggctcctcctgctttgtg
                         **    *** *****   * * ****  ** ****** ****  ****

A0A671PX91_BAD-01      gaaagcaaagaagtacgggcgacagctgaggagaatgagcgatgaatttg
A0A671SBB4_BAD-01      gaaagcaaagaagtacggacggcagctgaggagaatgagcgatgaatttg
A0A671NP27_BAD-01      ggcagctaagaaatatggtcgacagctaaggagaatgagtgatgagtttg
A0A671RUV0_BAD-01      ggcagctaagaaatatggccaacagctaaggagaatgagtgatgagtttg
                       *  *** ***** ** ** *  ***** *********** ***** ****

A0A671PX91_BAD-01      acacatggctcgacaaaggggaggtcaaaagagcgaacagc---------
A0A671SBB4_BAD-01      acacatggcttgacaaaggagaggtcaaaagagcgaacagt---------
A0A671NP27_BAD-01      acatcctccttgataaagg---gatgaagagggtgaagagtgcaggaaca
A0A671RUV0_BAD-01      acatcctccttgataaagg---gatgaagagggtgaagagcgcaggaact
                       ***     ** ** *****   * * ** ** * *** **          

A0A671PX91_BAD-01      ------cagaaacagacctaccgaggatggttctcgttcctctggagtcc
A0A671SBB4_BAD-01      ------cagaaacagacctaccgtggatggttctcgttcctcttgagttc
A0A671NP27_BAD-01      acacgtcagatgcagcagtcacccagctggttcgctttcctttggagtca
A0A671RUV0_BAD-01      acacggcagatgcggcagtcccccagctggttggccttcctttggagtca
                             ****  * *   *  *   * *****  * ***** * ****  

A0A671PX91_BAD-01      caaagaa---gaggaggg---------cagagaatga
A0A671SBB4_BAD-01      caaagaa---gaggaggg---------cagagaatga
A0A671NP27_BAD-01      caaagagtctgatgcggagtctcgccccgcagagtga
A0A671RUV0_BAD-01      caaagagtctgatgctgagtcgcgccccgcagagtga
                       ******    ** *  *          *  *** ***

© 1998-2020Legal notice