Dataset for CDS classical BH3-containing proteins of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3W979_BCL2L11-01      atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtgg
G3WDQ2_BMF-01          atg--------------gagtct--cctcattatgtggaagagctggagg
G3VRY3_BAD-01          atgttccagatatc--cgagtttgagcccagt--------gagcccggag
G3VRY3_BAD-02          atgttccagatatc--cgagtttgagcccagt--------gagcccggag
                       ***                 * *     *           * *   *  *

G3W979_BCL2L11-01      acaat---tgcagcctacagaaaggcctactcaacctca----actcaga
G3WDQ2_BMF-01          acgatgtgttccacccagagga-----ctcagagcctgg---tgctcagc
G3VRY3_BAD-01          aagac-ccttctgcctccactg-----cccccagcctcgccccgctcagg
G3VRY3_BAD-02          aagac-ccttctgcctccactg-----cccccagcctcgccccgctcagg
                       *  *    * *  **   *          *  * ***       ***** 

G3W979_BCL2L11-01      ccaggggcccctacctctatacaaacacaatatcaaggtaattcaggtga
G3WDQ2_BMF-01          cagggggcct--------------------------------------ga
G3VRY3_BAD-01          ccaggacccc--------------------------------------ga
G3VRY3_BAD-02          ccaggacccc--------------------------------------ga
                       *  **  **                                       **

G3W979_BCL2L11-01      aggggacagc--tgctcacctagcagccctca-----------gggaccg
G3WDQ2_BMF-01          cctcgccagctctgtttgcccag-agccagcctgactatatgctggatgg
G3VRY3_BAD-01          -----gcagc-------acctgg-agcccacc--accatgagggcgccgg
G3VRY3_BAD-02          -----gcagc-------acctgg-agcccacc--accatgagaagggggg
                             ****        **  * ****  *              *   *

G3W979_BCL2L11-01      tttgcaccacccac-----------------tagccctagcccgtttgct
G3WDQ2_BMF-01          gctgcagcttttcc--------------------ctcttaccc-actgct
G3VRY3_BAD-01          cgcggggaggcctc--------gcct-----gatctcctaccc-cccgct
G3VRY3_BAD-02          agcccagaagtcccagacccatgtctcaaaagagctcaaagcc-tctgct
                                    *                    * *    **    ***

G3W979_BCL2L11-01      acc------agatccccacttttcatctttgtaagaagatccccactgct
G3WDQ2_BMF-01          gtggcccagggcttcg-----ctcagttggccaggaaga----caaggcc
G3VRY3_BAD-01          a-----------------------------------agg----gagggct
G3VRY3_BAD-02          agtcaagggagattaggaaaaggcagtttcgagggtagg----gagggct
                                                           **      *  ** 

G3W979_BCL2L11-01      gcctcgatcttctagtgggtatttctcttttgacacagacaggagtccag
G3WDQ2_BMF-01          actcagaccctcagtccagcctccc----------caagccagggt---g
G3VRY3_BAD-01          cccggg------aggcgagc--ccc----------gaagcggaggccgag
G3VRY3_BAD-02          cccggg------aggcgagc--ccc----------gaagcggaggccgag
                        *   *            *     *           *  *    *    *

G3W979_BCL2L11-01      --------cgcctatgagttgtgataaatctacacaaactccaagccctc
G3WDQ2_BMF-01          tcatgctgccttgtggagttaccgaagaaccccaccgact------cttt
G3VRY3_BAD-01          gcagagcagtccgagggg-----gaggaagagcgcggcct------cttc
G3VRY3_BAD-02          gcagagcagtccgagggg-----gaggaagagcgcggcct------cttc
                                      * *         *    * *   **      * * 

G3W979_BCL2L11-01      cttgtcaagccttca-atcattatctaagtgcaatggatacagcttc---
G3WDQ2_BMF-01          tatggcaacgctggatatcgacttcccctcccagctaattttccttcgag
G3VRY3_BAD-01          cggggc--cgctccagctcagcgccccctatc------------------
G3VRY3_BAD-02          cggggc--cgctccagctcagcgccccctatc------------------
                          * *    **  *  **     *      *                  

G3W979_BCL2L11-01      -------catgaggcagtctca-------gtcaatacctgcagatatgcg
G3WDQ2_BMF-01          cctgaggcttggagcggagcctcccgaggagcagtgggagca-----tcg
G3VRY3_BAD-01          -------ctctgggcggcgc---------ggcattatg-gca-----gcg
G3VRY3_BAD-02          -------ctctgggcggcgc---------ggcattatg-gca-----gcg
                              *     ** *              ** *    ***      **

G3W979_BCL2L11-01      accagaaatttggattgcacaa-gaattgcgacgtattggagatgaattt
G3WDQ2_BMF-01          agctgaggtgcagattgcccga-aagcttcagtgcatcgc----gga-cc
G3VRY3_BAD-01          agct---gcgcaggatgagcgacgagttccactgcaccttcaaggga-c-
G3VRY3_BAD-02          agct---gcgcaggatgagcgacgagttccactgcaccttcaaggga-c-
                       * *         *  **  * *  *  * *   * *        * *   

G3W979_BCL2L11-01      aatgcttcttatccaagaaggggttttttggataataactatcaagcagc
G3WDQ2_BMF-01          agttccacaggctccacatgcag----------cggca-------ccagc
G3VRY3_BAD-01          --ttcccc--gcccgaagagcgc----------aggcactgcgagccaga
G3VRY3_BAD-02          --ttcccc--gcccgaagagcgc----------aggcactgcgagccaga
                         * *  *     * *   *                 *        *** 

G3W979_BCL2L11-01      agatgatcatcaccaaatggttattttacggctattacattacatca---
G3WDQ2_BMF-01          aga--accaaaacc--atgtgtggtggcagatcctcctcttccttcacaa
G3VRY3_BAD-01          tgc--gtcggagcc--atggctg------gacccgcaccttc-----cag
G3VRY3_BAD-02          tgc--gtcggagcc--atggctg------gacccgcaccttc-----cag
                        *     *    **  ***  *       *         **         

G3W979_BCL2L11-01      -tccgccttg-------tttggagaatgc-------------------ag
G3WDQ2_BMF-01          tttggccttgaacaga----gaggagaacaggaatggggcaggccctagg
G3VRY3_BAD-01          tcttggttcgggcggaatttggggaaagggagcgtcggtccttccc--ac
G3VRY3_BAD-02          tcttggttcgggcggaatttggggaaagggagcgtcggtccttccc--ac
                           *  * *          *  **                         

G3W979_BCL2L11-01      tga
G3WDQ2_BMF-01          tga
G3VRY3_BAD-01          tga
G3VRY3_BAD-02          tga

© 1998-2020Legal notice