Dataset for CDS BAD of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3VRY3_BAD-01      atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccact
G3VRY3_BAD-02      atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccact
G3VRY3_BAD-03      atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccact
                   ************************************************************

G3VRY3_BAD-01      gcccccagcctcgccccgctcaggccaggaccccgagcagcacctggagcccaccaccat
G3VRY3_BAD-02      gcccccagcctcgccccgctcaggccaggaccccgagcagcacctggagcccaccaccat
G3VRY3_BAD-03      gcccccagcctcgccccgctcaggccaggaccccgagcagcacctggagcccaccaccat
                   ************************************************************

G3VRY3_BAD-01      gagggcgccggcgcggggaggcctcgcctgatctcctaccccccgctaagggagggctcc
G3VRY3_BAD-02      gagggcgccggcgcggggaggcctcgcctgatctcctaccccccgctaagggagggctcc
G3VRY3_BAD-03      gagggcgccggcgcggggaggcctcgcctgatctcctaccccccgctaagggagggctcc
                   ************************************************************

G3VRY3_BAD-01      cgggaggcgagccccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgc
G3VRY3_BAD-02      cgggaggcgagccccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgc
G3VRY3_BAD-03      cgggaggcgagccccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgc
                   ************************************************************

G3VRY3_BAD-01      ggcctcttccggggccgctccagctcagcgccccctatcctctgggcggcgcggcattat
G3VRY3_BAD-02      ggcctcttccggggccgctccagctcagcgccccctatcctctgggcggcgcggcattat
G3VRY3_BAD-03      ggcctcttccggggccgctccagctcagcgccccctatcctctgggcggcgcggcattat
                   ************************************************************

G3VRY3_BAD-01      ggcagcgagctgcgcaggatgagcgacgagttccactgcaccttcaagggacttccccgc
G3VRY3_BAD-02      ggcagcgagctgcgcaggatgagcgacgagttccactgcaccttcaagggacttccccgc
G3VRY3_BAD-03      ggcagcgagctgcgcaggatgagcgacgagttccactgcaccttcaagggacttccccgc
                   ************************************************************

G3VRY3_BAD-01      ccgaagagcgcaggcactgcgagccagatgcgtcggagccatggctggacccgcaccttc
G3VRY3_BAD-02      ccgaagagcgcaggcactgcgagccagatgcgtcggagccatggctggacccgcaccttc
G3VRY3_BAD-03      ccgaagagcgcaggcactgcgagccagatgcgtcggagccatggctggacccgcaccttc
                   ************************************************************

G3VRY3_BAD-01      cagtcttggttcgggcggaatttggggaaagggagcgtcggtccttcccactga
G3VRY3_BAD-02      cagtcttggttcgggcggaatttggggaaagggagcgtcggtccttcccactga
G3VRY3_BAD-03      cagtcttggttcgggcggaatttggggaaagggagcgtcggtccttcccactga
                   ******************************************************

© 1998-2022Legal notice