Dataset for CDS BCL2L11 of organism Salmo trutta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673WET2_BCL2L11      atgtccgattcgtccagacaacaaaatcagtccaatggctcgacc-----
A0A673XGV4_BCL2L11      ----caaaataaaatatataaaaagag-aggctactactgcaacctgtgg
                            *  * *     * * ** ** *  ** * * *    * ***     

A0A673WET2_BCL2L11      ---atcctaattgagagagggaaatacggagaattgaatcccggtggcgg
A0A673XGV4_BCL2L11      gtggcgataatggaccaaggggaaagcggagagtcgcatcccggtggcgg
                               **** **   **** **  ****** * * *************

A0A673WET2_BCL2L11      agcagcctccggtgccgaaccgactgacaacccccagttcagcgaaaggg
A0A673XGV4_BCL2L11      agctgcctcccgtgccgaaccgtctgacaacccccagtcctgcgaagggg
                        *** ****** *********** *************** * ***** ***

A0A673WET2_BCL2L11      accagcagtcacggggaggaataatgatgccgaatagtctgcttggtttc
A0A673XGV4_BCL2L11      accagcagtcactgggaggaataatgattccgaatagtctgcttggtttc
                        ************ *************** *********************

A0A673WET2_BCL2L11      cagtcgaggtcgccgttgttcagaacactgtccaggtcatccagtggata
A0A673XGV4_BCL2L11      cagtcgaggtcgccggtgttcagaacactgtccagatcctccagtggata
                        *************** ******************* ** ***********

A0A673WET2_BCL2L11      tttttcgttcgacagcgattctattccaagctccccgctattgaaagata
A0A673XGV4_BCL2L11      tttttcgttcgacagcgattctattccaagctccccgctattgaaagat-
                        ************************************************* 

A0A673WET2_BCL2L11      acaagtcgacacagactccgagcccatctagccaagtcatgactcacgca
A0A673XGV4_BCL2L11      --aaatcgacacagactccgagcccatctagccaagtcattacccacgca
                          ** *********************************** ** ******

A0A673WET2_BCL2L11      ctgcagcgcatgtctcaagcacaggagaccaatcgagattatg-------
A0A673XGV4_BCL2L11      ctgcagcgcatgtctcgagcactggagaccgggcgagattatggtaaggc
                        **************** ***** *******   **********       

A0A673WET2_BCL2L11      --atgcgtggcccaaccccctccacccctatagaccacggccaccgccaa
A0A673XGV4_BCL2L11      acacgtgtggcccaaccccctccggccctatagatcacgcccaccaccga
                          * * *****************  ********* **** ***** ** *

A0A673WET2_BCL2L11      ctgcaggggacatgtggccagagacactgatcggtcaggagcttcagcgc
A0A673XGV4_BCL2L11      ctgcgggggacatgcggccagagatactcatcggtcaggagcttcagcgc
                        **** ********* ********* *** *********************

A0A673WET2_BCL2L11      attggagacgagtttaacgatctcgtcatacat---cgccttgctgaagg
A0A673XGV4_BCL2L11      attggagatgagtttaacaacctcatcatacataggcgccttgcaggtag
                        ******** ********* * *** ********   ******** *   *

A0A673WET2_BCL2L11      aaacggtcaagttgcccaggaaaacctgcagcagatgcaccaagagcccg
A0A673XGV4_BCL2L11      aaacggtcaggttgcccaggggaacctgcagcacatgcaccaagagcccg
                        ********* **********  *********** ****************

A0A673WET2_BCL2L11      ccttcctactgtggatggggctcctgattggacgactattacagatcatc
A0A673XGV4_BCL2L11      ccttcctactgtggatgagtcttctgattggacgactattacagataatc
                        ***************** * ** *********************** ***

A0A673WET2_BCL2L11      ctgcagagaagatga
A0A673XGV4_BCL2L11      ctgcggagaagatga
                        **** **********

© 1998-2020Legal notice