Dataset for CDS classical BH3-containing proteins of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6S6C4_PMAIP1-      atg-----------------------------------------------
A0A2K6TBD7_BIK-01       atgtctgaagacagacccctctccagcgacatcttgatggagactctcct
A0A2K6TRU4_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagtt-----
A0A2K6TRU4_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagtt-----
A0A2K6TW78_BMF-02       atgga-----------------gc-c---------------atct-----
A0A2K6TW78_BMF-01       atgga-----------------gc-c---------------atct-----
A0A2K6TW78_BMF-03       atgga-----------------gc-c---------------atct-----
A0A2K6STD6_BBC3-02      atgaa-----------------atgt---------------ggca-----
A0A2K6TG62_BAD-03       atgtt-----------------ccag---------------atcc-----
A0A2K6TG62_BAD-01       atgtt-----------------ccag---------------atcc-----
                        ***                                               

A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6TBD7_BIK-01       gtgtgagcagtttgtggatcccctgaccatggaggttgtcggtgggagtg
A0A2K6TRU4_BCL2L11      -------ctgagtgtga--------------------------ccgagaa
A0A2K6TRU4_BCL2L11      -------ctgagtgtga--------------------------ccgagaa
A0A2K6TW78_BMF-02       -------cagtgtgtggaggagctggaggatgatgtgttccagccagagg
A0A2K6TW78_BMF-01       -------cagtgtgtggaggagctggaggatgatgtgttccagccagagg
A0A2K6TW78_BMF-03       -------cagtgtgtggaggagctggaggatgatgtgttccagccagagg
A0A2K6STD6_BBC3-02      -------tggggtctgcctgggc-----------atgtccatgccaagtg
A0A2K6TG62_BAD-03       -------cagagtttga-------------------------gccgagtg
A0A2K6TG62_BAD-01       -------cagagtttga-------------------------gccgagtg
                                                                          

A0A2K6S6C4_PMAIP1-      -----------------------------------cctgggaagaaggcg
A0A2K6TBD7_BIK-01       accctgaagag---------------gacccggactctgtggaggaccct
A0A2K6TRU4_BCL2L11      ggtaga--------------------cagttgcagcctgcggagag----
A0A2K6TRU4_BCL2L11      ggtaga--------------------cagttgcagcctgcggagag----
A0A2K6TW78_BMF-02       atggggagccagggacccaacccgggagcttgctctctgctga------c
A0A2K6TW78_BMF-01       atggggagccagggacccaacccgggagcttgctctctgctga------c
A0A2K6TW78_BMF-03       atggggagccagggacccaacccgggagcttgctctctgctga------c
A0A2K6STD6_BBC3-02      cccag---------------------ggcttcttccttgacgtgggtccc
A0A2K6TG62_BAD-03       agcaggaa------------------gactccagctctgcagagaggggc
A0A2K6TG62_BAD-01       agcaggaa------------------gactccagctctgcagagaggggc
                                                             **           

A0A2K6S6C4_PMAIP1-      c------------gcaagagcgcgcaaccgagccccgcgcgggctccagc
A0A2K6TBD7_BIK-01       ttggaatgcatggagaacagtgacgcactggccctgcagctggc------
A0A2K6TRU4_BCL2L11      -----------------------------acctcc----ccagctcagac
A0A2K6TRU4_BCL2L11      -----------------------------acctcc----ccagctcagac
A0A2K6TW78_BMF-02       ctgtttgcc----cagagcctactggactgccccctcagccggcttcagc
A0A2K6TW78_BMF-01       ctgtttgcc----cagagcctactggactgccccctcagccggcttcagc
A0A2K6TW78_BMF-03       ctgtttgcc----cagagcctactggactgccccctcagccggcttcagc
A0A2K6STD6_BBC3-02      ctg----cc----agatgtgtggttctcagccctc-------gctctcgc
A0A2K6TG62_BAD-03       ctgagcccc----agcaccgcaggggacagccccc----caggctctggc
A0A2K6TG62_BAD-01       ctgagcccc----agcaccgcaggggacagccccc----caggctctggc
                                                                  **      

A0A2K6S6C4_PMAIP1-      --------------------------------agacctt---------ga
A0A2K6TBD7_BIK-01       --------ctgcatcgcggaccagatggatgtgagcctc---------ag
A0A2K6TRU4_BCL2L11      -----------------------ctggggcccctacctccctacagacag
A0A2K6TRU4_BCL2L11      -----------------------ctggggcccctacctccctacagacag
A0A2K6TW78_BMF-02       tcttccc-tctcaccc---actgctgtggccctggccttc---------g
A0A2K6TW78_BMF-01       tcttccc-tctcaccc---actgctgtggccctggccttc---------g
A0A2K6TW78_BMF-03       tcttccc-tctcaccc---actgctgtggccctggccttc---------g
A0A2K6STD6_BBC3-02      tggcggagcagcacctggagtcgcccgtgccca-gcgccccg------gg
A0A2K6TG62_BAD-03       --------aagcatc----gacgccaggccccaggcctcccg------gg
A0A2K6TG62_BAD-01       --------aagcatc----gacgccaggccccaggcctcccg------gg
                                                           *              

A0A2K6S6C4_PMAIP1-      agtcg--------------agtgtgccattca------------------
A0A2K6TBD7_BIK-01       ggccc--------------ggaggctggcccagctctacgaggtggccac
A0A2K6TRU4_BCL2L11      agccacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgc
A0A2K6TRU4_BCL2L11      agccaca-------------------------------------------
A0A2K6TW78_BMF-02       acccaccagcca--ggaagacaaggctacccagaccctcagcccagcctc
A0A2K6TW78_BMF-01       acccaccagcca--ggaagacaaggctacccagaccctcagcccagcctc
A0A2K6TW78_BMF-03       acccaccagcca--ggaagacaaggctacccagaccctcagcccagcctc
A0A2K6STD6_BBC3-02      gg--------ccctggcgggcggtcccacccag------------gcggc
A0A2K6TG62_BAD-03       ggacgccagtcaccagcagggacagccaaccag----------cagcagc
A0A2K6TG62_BAD-01       ggacgccagtcaccagcagggacagccaaccag----------cagcagc
                                                                          

A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6TBD7_BIK-01       gtacagcccgggtctc----------------------------------
A0A2K6TRU4_BCL2L11      ccccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K6TW78_BMF-02       ccccagccaaggtgtcatgctgccttgtg--------------------g
A0A2K6TW78_BMF-01       ccccagccaaggtgtcatgctgccttgtg--------------------g
A0A2K6TW78_BMF-03       ccccagccaaggtgtcatgctgccttgtg--------------------g
A0A2K6STD6_BBC3-02      ccc----------------------------------------------g
A0A2K6TG62_BAD-03       caccatggagagaatcccagtgcaaagatgctctcgaaagcatcagcagg
A0A2K6TG62_BAD-01       cacca---------------------------------------------
                                                                          

A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6TBD7_BIK-01       ------------------------------------------------gc
A0A2K6TRU4_BCL2L11      ttttgctaccagatccccgcttttcatctttg--------tgagaagatc
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K6TW78_BMF-02       ggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggc
A0A2K6TW78_BMF-01       ggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggc
A0A2K6TW78_BMF-03       ggtgactgaggaaccccagcgactcttttatg------------------
A0A2K6STD6_BBC3-02      ggagtccg-----c------------------------------------
A0A2K6TG62_BAD-03       gatgtctg-----ccccagccactgactcaga------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
                                                                          

A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6TBD7_BIK-01       tttcatccttgaccggaccgacatcagggatgttcttagcggtgtcgtgg
A0A2K6TRU4_BCL2L11      ctccgtgctgtctcgatcctccagtgggtatttctcttttgacacag---
A0A2K6TRU4_BCL2L11      ---------------------------------------------ag---
A0A2K6TW78_BMF-02       ttcctctccctgccagtttcccggcagtcttgccccttggggagcagccc
A0A2K6TW78_BMF-01       ttcctctccctgccagtttcccggcagtcttgccccttggggagcagccc
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------ggggaggag---
A0A2K6TG62_BAD-03       ----------agcccaacacacagagaatgtaaagctggaggcgctg---
A0A2K6TG62_BAD-01       ------------------------------------tggaggcgctg---
                                                                          

A0A2K6S6C4_PMAIP1-      ------------------------------------------------ac
A0A2K6TBD7_BIK-01       atgttttcgctgacttccaggaggacatagtgaggctctgg-----agat
A0A2K6TRU4_BCL2L11      --------------------------acaggagccca---------gcac
A0A2K6TRU4_BCL2L11      --------------------------acaggagccca---------gcac
A0A2K6TW78_BMF-02       cctgaagggc---------agtggcaacatcgagcagaggtacagattgc
A0A2K6TW78_BMF-01       cctgaagggc---------agtggcaacatcgagcagaggtacagattgc
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K6STD6_BBC3-02      ------gagc---------agtgggctcgggagatcg---------gggc
A0A2K6TG62_BAD-03       ------gagc---------cgtggagacacggagtcgccacagctcgtac
A0A2K6TG62_BAD-01       ------gagc---------cgtggagacacggagtcgccacagctcgtac
                                                                          

A0A2K6S6C4_PMAIP1-      tcaggagatttgg-------------------------------------
A0A2K6TBD7_BIK-01       ccctgagctctgggtcctgggtgtccggcaa-------------------
A0A2K6TRU4_BCL2L11      ccatgagttgtga----caaat----------------------------
A0A2K6TRU4_BCL2L11      ccatgagttgtga----caaat----------------------------
A0A2K6TW78_BMF-02       ccgaaagcttcag----tgcattgcagaccagttccaccggcttcatgtg
A0A2K6TW78_BMF-01       ccgaaagcttcag----tgcattgcagaccagttccaccggcttcatgtg
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K6STD6_BBC3-02      cc---agctgcgg----cggatggcggacgacctcaacgcgcagtacgag
A0A2K6TG62_BAD-03       cc---cgcaggga----cggaggg-ggacga-----------------ag
A0A2K6TG62_BAD-01       cc---cgcaggga----cggaggg-ggacga-----------------ag
                                                                          

A0A2K6S6C4_PMAIP1-      --------------------------agacaaactgaatttc------cg
A0A2K6TBD7_BIK-01       ----------------------------acaggccgt----------gct
A0A2K6TRU4_BCL2L11      ------------------------caacacaaaccc--------------
A0A2K6TRU4_BCL2L11      ------------------------caacacaaaccc--------------
A0A2K6TW78_BMF-02       ---------------cagcaacaccagcagaaccgaaatcgtgtgtggtg
A0A2K6TW78_BMF-01       ---------------cagcaacaccagcagaaccgaaatcgtgtgtggtg
A0A2K6TW78_BMF-03       ---------------------caccagcagaaccgaaatcgtgtgtggtg
A0A2K6STD6_BBC3-02      cggcggagacaagaagagcagccgcaacaccgcccctcaccctggagggt
A0A2K6TG62_BAD-03       ggatggag-------gaggagcc------cagcccttttc-------ggg
A0A2K6TG62_BAD-01       ggatggag-------gaggagcc------cagcccttttc-------ggg
                                                         *                

A0A2K6S6C4_PMAIP1-      gcagaaacttctgaatctgatatccaaactcttc----------------
A0A2K6TBD7_BIK-01       gctggcgctcctggcgctgctgctggcgatgttc----------agcggg
A0A2K6TRU4_BCL2L11      -caagtcctccttgccagg---ccttcaaccact----------atctca
A0A2K6TRU4_BCL2L11      -caagtcctccttgccagg---ccttcaaccact----------atctca
A0A2K6TW78_BMF-02       gcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaaca
A0A2K6TW78_BMF-01       gcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaaca
A0A2K6TW78_BMF-03       gcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaaca
A0A2K6STD6_BBC3-02      cctgtacaatctcatcatgggactcctgcccttt------------ccca
A0A2K6TG62_BAD-03       gccgttcgcgctcggcac----cccccaacctct------gggcagcaca
A0A2K6TG62_BAD-01       gccgttcgcgctcggcac----cccccaacctct------gggcagcaca
                         *        **                                      

A0A2K6S6C4_PMAIP1-      ---------------tgctcaggaacctga--------------------
A0A2K6TBD7_BIK-01       ggtctgcgcctgc--tgctcaagtga------------------------
A0A2K6TRU4_BCL2L11      gtgcaatggctg---------actgg------------------------
A0A2K6TRU4_BCL2L11      gtgcaatggatgagg----ccactggatcctcccttgcccttcgtaggga
A0A2K6TW78_BMF-02       ggaatggggc-----aggtccgagg--tga--------------------
A0A2K6TW78_BMF-01       ggaatggggc-----aggtccgagg--tga--------------------
A0A2K6TW78_BMF-03       ggaatggggc-----aggtccgag--------------------------
A0A2K6STD6_BBC3-02      g-----gggccacagagccccagagatgga--------------------
A0A2K6TG62_BAD-03       gcgatatggccgc-gagctccggaggatga--------------------
A0A2K6TG62_BAD-01       gcgatatggccgc-gagctccggaggatgagtgacgagtttgtggactcc
                                                                          

A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------gactag------------------------
A0A2K6TRU4_BCL2L11      ggttcagtgcccacttgagtggttagcaaaatcaagctga----------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K6STD6_BBC3-02      ----------------gcccaattag------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-01       ttcaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcg
                                                                          

A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-01       gcaaagctccagctggacgcgagtcatccagtcctggtgggatcggaact
                                                                          

A0A2K6S6C4_PMAIP1-      --------------------------------
A0A2K6TBD7_BIK-01       --------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------
A0A2K6TW78_BMF-02       --------------------------------
A0A2K6TW78_BMF-01       --------------------------------
A0A2K6TW78_BMF-03       --------------------------------
A0A2K6STD6_BBC3-02      --------------------------------
A0A2K6TG62_BAD-03       --------------------------------
A0A2K6TG62_BAD-01       tgggcaggggaggctccgctccctcccagtga
                                                        

© 1998-2020Legal notice