Dataset for CDS BCL2L11 of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6TRU4_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6TRU4_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K6TRU4_BCL2L11      acagttgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K6TRU4_BCL2L11      acagttgcagcctgcggagagacctccccagctcagacctggggccccta
                        **************************************************

A0A2K6TRU4_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6TRU4_BCL2L11      cctccctacagacagagccaca----------------------------
                        **********************                            

A0A2K6TRU4_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6TRU4_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6TRU4_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6TRU4_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6TRU4_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6TRU4_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6TRU4_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6TRU4_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A2K6TRU4_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggctg---
A0A2K6TRU4_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggatgagg
                        ******************************************** **   

A0A2K6TRU4_BCL2L11      --actgg-------------------------------------------
A0A2K6TRU4_BCL2L11      ccactggatcctcccttgcccttcgtagggaggttcagtgcccacttgag
                          *****                                           

A0A2K6TRU4_BCL2L11      -gactag--------------
A0A2K6TRU4_BCL2L11      tggttagcaaaatcaagctga
                         *  ***              

© 1998-2020Legal notice