Dataset for CDS classical BH3-containing proteins of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6NC45_PMAIP1-      at------------------------------------------------
A0A2K6NC45_PMAIP1-      at------------------------------------------------
A0A2K6QK74_BIK-01       at--------------------------gtctggagtaag----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaa---gttctgagtgtg----------
A0A2K6RAW1_BMF-01       atggagcca-------------------tctcggtgtgtggaggag----
A0A2K6RAW1_BMF-02       atggagcca-------------------tctcggtgtgtggaggag----
A0A2K6QZT2_BBC3-04      at------------------------------aaaatttggcgtggggtc
A0A2K6QZT2_BBC3-01      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
A0A2K6PUL3_BAD-01       atgttccaga------------------tcccagagtttga---------
A0A2K6PUL3_BAD-02       atgttccaga------------------tcccagagtttga---------
                        **                                                

A0A2K6NC45_PMAIP1-      -----------------------------------gcctggaaagaaggc
A0A2K6NC45_PMAIP1-      -----------------------------------gcctggaaagaaggc
A0A2K6QK74_BIK-01       -----------------------------------acccg----------
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6QIL2_BCL2L11      -----------------------------------accgagaaggtagac
A0A2K6RAW1_BMF-01       ---ctggaagatgatgtgttcca------------gccggaggacgggga
A0A2K6RAW1_BMF-02       ---ctggaagatgatgtgttcca------------gccggaggacgggga
A0A2K6QZT2_BBC3-04      tgcccggg------catgtccat------------gccaggtgcccaggg
A0A2K6QZT2_BBC3-01      ggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccctcgg
A0A2K6PUL3_BAD-01       -----------------------------------gcctagtgagcagga
A0A2K6PUL3_BAD-02       -----------------------------------gcctagtgagcagga
                                                            **            

A0A2K6NC45_PMAIP1-      -------------------------------------------gcgcaag
A0A2K6NC45_PMAIP1-      -------------------------------------------gcgcaag
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6QIL2_BCL2L11      -----------------------------------------------aat
A0A2K6RAW1_BMF-01       ---------------------------gccgggggcccaacctgggagct
A0A2K6RAW1_BMF-02       ---------------------------gccgggggcccaacctgggagct
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      cagtgtcctgcggcctctgcgagcccggcctggctgccacccccgctgcc
A0A2K6PUL3_BAD-01       ---------------------------------------------agact
A0A2K6PUL3_BAD-02       ---------------------------------------------agact
                                                                          

A0A2K6NC45_PMAIP1-      aacgcgcaaccga-------------------------------------
A0A2K6NC45_PMAIP1-      aacgcgcaaccga-------------------------------------
A0A2K6QK74_BIK-01       -----tctccagagacatcttgatggagacc-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6QIL2_BCL2L11      tgcagcctgcgga-----------gaggcct-------------------
A0A2K6RAW1_BMF-01       cgctctctgccgatctgtttgcccagagcctacttgactgccc-------
A0A2K6RAW1_BMF-02       cgctctctgccgatctgtttgcccagagcctacttgactgccc-------
A0A2K6QZT2_BBC3-04      -----------------------------cttcttctgcgac--------
A0A2K6QZT2_BBC3-01      cccgccctgctgc---------ccgctgcctacctctgcgcccccaccgc
A0A2K6PUL3_BAD-01       ccagctctgcaga---------gaggggcct-------------------
A0A2K6PUL3_BAD-02       ccagctctgcaga---------gaggggcct-------------------
                                                                          

A0A2K6NC45_PMAIP1-      ------------------------------gcccagcgcg----------
A0A2K6NC45_PMAIP1-      ------------------------------gcccagcgcg----------
A0A2K6QK74_BIK-01       ------------------------------ctcctgtatga---------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6QIL2_BCL2L11      ------------------------------ccccagctca----------
A0A2K6RAW1_BMF-01       ------------------------------cctcagccgact--------
A0A2K6RAW1_BMF-02       ------------------------------cctcagccgact--------
A0A2K6QZT2_BBC3-04      ------------------------gtgggtcccctgccagatttg-----
A0A2K6QZT2_BBC3-01      cccacccgccgtcaccgccgccctggggggcccccgctggcctgggggtc
A0A2K6PUL3_BAD-01       ---------------------------gggccccagcccggcagggg---
A0A2K6PUL3_BAD-02       ---------------------------gggccccagcccggcagggg---
                                                         * *              

A0A2K6NC45_PMAIP1-      ----------------------------------ggctcaggcag-----
A0A2K6NC45_PMAIP1-      ----------------------------------ggctcaggcag-----
A0A2K6QK74_BIK-01       ------gcagctcctgga----------------acccctaaccatggag
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6QIL2_BCL2L11      ----------------------------------gacctggggcccctac
A0A2K6RAW1_BMF-01       ------tcagctcttccctctcacccactgctgtggccctggccttcgac
A0A2K6RAW1_BMF-02       ------tcagctcttccctctcacccactgctgtggccctggccttcgac
A0A2K6QZT2_BBC3-04      -------------------------------tg-gtcctcagccctcgct
A0A2K6QZT2_BBC3-01      cccgcagccggccccgaggcccacgcccggacg-gtcctcagccctcgct
A0A2K6PUL3_BAD-01       ------acaggccctcagactccggcaagcatc-atcgccaggccccagg
A0A2K6PUL3_BAD-02       ------acaggccctcagactccggcaagcatc-atcgccaggccccagg
                                                            *             

A0A2K6NC45_PMAIP1-      ---------------gacctgcagggacggcagggacggcgaggga----
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       gttcttggtgtgactgaccctgaagaggacctggaccctatggaggactt
A0A2K6QIL2_BCL2L11      ctccct----------acagacagaaccacaaggtaatcccgaagacaat
A0A2K6QIL2_BCL2L11      ctccct----------acagacagaaccacaaggtaatcccgaagacaat
A0A2K6RAW1_BMF-01       ccaccagcca-----ggaagacaaggctacccagaccctcggcccagcct
A0A2K6RAW1_BMF-02       ccaccagcca-----ggaagacaaggctacccagaccctcggcccagcct
A0A2K6QZT2_BBC3-04      ctcgctggcg-----ga------gcagcacctggagtcgccggtgcccag
A0A2K6QZT2_BBC3-01      ctcgctggcg-----ga------gcagcacctggagtcgccggtgcccag
A0A2K6PUL3_BAD-01       cctcctgtgg-----gacgccagtcaccagcaggagcagccaaccagcag
A0A2K6PUL3_BAD-02       cctcctgtgg-----gacgccagtcaccagcaggagcagccaaccagcag
                                                                          

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       cgatcctt------------------------------------------
A0A2K6QIL2_BCL2L11      ca------------------------------------------------
A0A2K6QIL2_BCL2L11      ca------------------------------------------------
A0A2K6RAW1_BMF-01       cccccagc------------------------------------------
A0A2K6RAW1_BMF-02       cccccagc------------------------------------------
A0A2K6QZT2_BBC3-04      cgccc---------------------------------------------
A0A2K6QZT2_BBC3-01      cgccc---------------------------------------------
A0A2K6PUL3_BAD-01       cagccatca-----------------------------------------
A0A2K6PUL3_BAD-02       cagccatcatggagggagagcttggtattatcctgctgaatctgaggact
                                                                          

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-02       ctgaaaatcccagtgcaaggatgctcgcggaagcatcagcagggatgtct
                                                                          

A0A2K6NC45_PMAIP1-      ----------------------------------------------ccaa
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       ----------------------------------------------tgga
A0A2K6QIL2_BCL2L11      ----------------------------------------------cgga
A0A2K6QIL2_BCL2L11      ----------------------------------------------cgga
A0A2K6RAW1_BMF-01       ----------------------------------------------caag
A0A2K6RAW1_BMF-02       ----------------------------------------------caag
A0A2K6QZT2_BBC3-04      ----------------------------------------------cggg
A0A2K6QZT2_BBC3-01      ----------------------------------------------cggg
A0A2K6PUL3_BAD-01       ----------------------------------------------tgga
A0A2K6PUL3_BAD-02       gccccagccactgactcagaagcccaactcgcagagaatgtaaagctgga
                                                                          

A0A2K6NC45_PMAIP1-      gccggattagggattgggatgcagctgcatttc-----accagaggc---
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       g---------tgtatggagga---cagtgacatgttggccctgcggc---
A0A2K6QIL2_BCL2L11      g------------gtgaaggg---gacagctgc-----ccccacggc---
A0A2K6QIL2_BCL2L11      g------------gtgaaggg---gacagctgc-----ccccacggc---
A0A2K6RAW1_BMF-01       gtgttatgctgccttgtggggtaactgaggaac-----cccagcgactgt
A0A2K6RAW1_BMF-02       gtgttatgctgccttgtggggtaactgaggaac-----cccagcgactgt
A0A2K6QZT2_BBC3-04      g---------gccctggcggg---cggtcccac-----ccaggcggc---
A0A2K6QZT2_BBC3-01      g---------gccctggcggg---cggtcccac-----ccaggcggc---
A0A2K6PUL3_BAD-01       g---------gcgctg--ggg---ctgtggaga-----cccggagtc---
A0A2K6PUL3_BAD-02       g---------gcgctg--ggg---ctgtggaga-----cccggagtc---
                                                                          

A0A2K6NC45_PMAIP1-      ----------------------------aaaaagctcctctcctcctccc
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6RAW1_BMF-01       tttatggcaatgctggctaccggcttcctctccctgccagtttcccggca
A0A2K6RAW1_BMF-02       tttatg--------------------------------------------
A0A2K6QZT2_BBC3-04      -------------------------------------------cccggg-
A0A2K6QZT2_BBC3-01      -------------------------------------------cccggg-
A0A2K6PUL3_BAD-01       -------------------------------------------gccacag
A0A2K6PUL3_BAD-02       -------------------------------------------gccacag
                                                                          

A0A2K6NC45_PMAIP1-      cacttgcccttccgcggggccacgaggaacaagtgcaag-----------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       ----tggcctgcatcggggatgagatggacgtgagcctc-----------
A0A2K6QIL2_BCL2L11      -----agccctca--gggcccgctggccccaccggccagccctggccctt
A0A2K6QIL2_BCL2L11      -----agccctca--gggcccgctggccccaccggccagccctggccctt
A0A2K6RAW1_BMF-01       gtcttgcccatcg--ggga-gcagccccccgaagggcag-----------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6QZT2_BBC3-04      -----agtccgcg--ggga-ggaggaaca-gtgggcccg-----------
A0A2K6QZT2_BBC3-01      -----agtccgcg--ggga-ggaggaaca-gtgggcccg-----------
A0A2K6PUL3_BAD-01       ctcctaccccgcg--gggacggaggaggacgaagggatg-----------
A0A2K6PUL3_BAD-02       ctcctaccccgcg--gggacggaggaggacgaagggatg-----------
                                                                          

A0A2K6NC45_PMAIP1-      --tagctcgaagtcgagtgt-gctactcaactcaggagatttggagacaa
A0A2K6NC45_PMAIP1-      ---agctcgaagtcgagtgt-gctactcaactcaggagatttggagacaa
A0A2K6QK74_BIK-01       -agggccccgcgcctggcccagctctctgaggtggccatgcacagcctag
A0A2K6QIL2_BCL2L11      ttgctaccagatccccgct--tttcatctttatgagaagatcctccctgc
A0A2K6QIL2_BCL2L11      ttgctaccagatccccgct--tttcatctttatgagaagatcctccctgc
A0A2K6RAW1_BMF-01       -tggcaacatcgagcagag--gtacagattgcccgaaagcttcagtgcat
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6QZT2_BBC3-04      -ggagatcggggcccagct--gcggcggatggcggacgacctcaacgcgc
A0A2K6QZT2_BBC3-01      -ggagatcggggcccagct--gcggcggatggcggacgacctcaacgcgc
A0A2K6PUL3_BAD-01       -gagga--ggagcccagcc--cctttcggggccgctcgcgctccgcgccc
A0A2K6PUL3_BAD-02       -gagga--ggagcccagcc--cctttcggggccgctcgcgctccgcgccc
                                                                          

A0A2K6NC45_PMAIP1-      actgaacttccggcagaaactttt-------------gaatctgatagcc
A0A2K6NC45_PMAIP1-      actgaacttccggcagaaactttt-------------gaatctgatagcc
A0A2K6QK74_BIK-01       gtctggctttcatctacgaccagaccgacgacatcagggatgttcttaca
A0A2K6QIL2_BCL2L11      tgtctcgatcctccagtgggtatttctcttttgacacagacaggagccca
A0A2K6QIL2_BCL2L11      tgtctcgatcctccagtgggtatttctcttttgacacagacaggagccca
A0A2K6RAW1_BMF-01       tgcagaccagttccaccggcttcatgtgcagcaacaccagcagaa---cc
A0A2K6RAW1_BMF-02       ----------------------------------caccagcagaa---cc
A0A2K6QZT2_BBC3-04      agta-----cgagcggcggagacaagaggagcagcagcgacaccg---c-
A0A2K6QZT2_BBC3-01      agta-----cgagcggcggagacaagaggagcagcagcgacaccg---c-
A0A2K6PUL3_BAD-01       cctaacctctgggcagc----------------acagcgatatgg---c-
A0A2K6PUL3_BAD-02       cctaacctctgggcagc----------------acagcgatatgg---c-
                                                                        * 

A0A2K6NC45_PMAIP1-      aaactcttctgctca--------------ggaa-----------------
A0A2K6NC45_PMAIP1-      aaactcttctgctca--------------ggaa-----------------
A0A2K6QK74_BIK-01       agtttcatggacggcttcaccacccttaaggagaacataatgaggttctg
A0A2K6QIL2_BCL2L11      gcacccatgagttgt--------------gacaaatcaacacaaacccca
A0A2K6QIL2_BCL2L11      gcacccatgagttgt--------------gacaaatcaacacaaacccca
A0A2K6RAW1_BMF-01       gaaatcgcgtgtggt--------------ggcagat--------------
A0A2K6RAW1_BMF-02       gaaatcgcgtgtggt--------------ggcagat--------------
A0A2K6QZT2_BBC3-04      -----ccctcgccct--------------ggagggt----------cctg
A0A2K6QZT2_BBC3-01      -----ccctcgccct--------------ggagggt----------cctg
A0A2K6PUL3_BAD-01       -----cgcgagctcc--------------ggaggatgagtgacgagtttg
A0A2K6PUL3_BAD-02       -----cgcgagctcc--------------ggaggatga------------
                             *                       *                    

A0A2K6NC45_PMAIP1-      --------------------------cctgactgcatcaaaaacttgcat
A0A2K6NC45_PMAIP1-      --------------------------cctga-------------------
A0A2K6QK74_BIK-01       gagatccct------gaatcccgggtcccaggtgtcccgcgaacaggtgc
A0A2K6QIL2_BCL2L11      --------------agtcctccttgcc-----------------------
A0A2K6QIL2_BCL2L11      --------------agtcctccttgcc-----------------------
A0A2K6RAW1_BMF-01       -----------------cctcctcttc-----------------------
A0A2K6RAW1_BMF-02       -----------------cctcctcttc-----------------------
A0A2K6QZT2_BBC3-04      tacaatctcattatgggactcctgccc------------------ttacc
A0A2K6QZT2_BBC3-01      tacaatctcattatgggactcctgccc------------------ttacc
A0A2K6PUL3_BAD-01       tggactcctttaagggacttcctcgcccgaagagcgcgggtacagcgacg
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      aaggggactccaaacgagaatttttctcaggaggtgcacgtttcatcaat
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QK74_BIK-01       tgctggcgctgctgctgctgctggcggcgctgctcagcgggggcctgcac
A0A2K6QIL2_BCL2L11      ---aggccttcaaccactatctc---------------------------
A0A2K6QIL2_BCL2L11      ---aggccttcaaccactatctc---------------------------
A0A2K6RAW1_BMF-01       ------ctgcacaaccttgcttt------------------------gaa
A0A2K6RAW1_BMF-02       ------ctgcacaaccttgcttt------------------------gaa
A0A2K6QZT2_BBC3-04      caggggccacagagccccc----------------------------gaa
A0A2K6QZT2_BBC3-01      caggggccacagagccccc----------------------------gaa
A0A2K6PUL3_BAD-01       cagatgcggcaaagctccagctggacgcgagtcttccagtcctggtggga
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      ttgaagaaagattgcattgtaattgg--------------
A0A2K6NC45_PMAIP1-      ----------------------------------------
A0A2K6QK74_BIK-01       ctgctgctcaagtga-------------------------
A0A2K6QIL2_BCL2L11      -agtgcaatgggta---------------tttttgaataa
A0A2K6QIL2_BCL2L11      -agtgcaatggttagagaaatagaggaagttgtcgtgtag
A0A2K6RAW1_BMF-01       tggagaagagaataggaacggggcgggccctaggtga---
A0A2K6RAW1_BMF-02       tggagaagagaatag-------------------------
A0A2K6QZT2_BBC3-04      atggagcccaattag-------------------------
A0A2K6QZT2_BBC3-01      atggagcccaattag-------------------------
A0A2K6PUL3_BAD-01       tcggaacttgggcaggggaagctccgccccctcccagtga
A0A2K6PUL3_BAD-02       ----------------------------------------
                                                                

© 1998-2020Legal notice