Dataset for CDS classical BH3-containing proteins of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6NC45_PMAIP1-      atg-----------------------cctggaaagaag------------
A0A2K6NC45_PMAIP1-      atg-----------------------cctggaaagaag------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6QIL2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------------
A0A2K6RAW1_BMF-02       atggagcc----------------atctcggtgtgtgg------------
A0A2K6RAW1_BMF-01       atggagcc----------------atctcggtgtgtgg------------
A0A2K6QK74_BIK-01       atgt-----------------------ctggagtaaga------------
A0A2K6QZT2_BBC3-03      ataaaattt---------------ggcgtggggtctgcccgggcatgtcc
A0A2K6QZT2_BBC3-04      ataaaattt---------------ggcgtggggtctgcccgggcatgtcc
A0A2K6QZT2_BBC3-02      ataaaattt---------------ggcgtggggtctgcccgggcatgtcc
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6PUL3_BAD-01       atgttccag---------------atcccagagtttga------------
A0A2K6PUL3_BAD-02       atgttccag---------------atcccagagtttga------------
                                                                          

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QZT2_BBC3-03      at------------------------------------------------
A0A2K6QZT2_BBC3-04      at------------------------------------------------
A0A2K6QZT2_BBC3-02      atgccaggtgcccagggcttcttctgcgacgtgggtcccctgccagattt
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-02      gtggccccagggagcgccatggcccgcgcacgccaggagggcagctcccc
A0A2K6QZT2_BBC3-01      ------------------atggcccgcgcacgccaggagggcagctcccc
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-02      ggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgctcg
A0A2K6QZT2_BBC3-01      ggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgctcg
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      --------gcgcgcaagaacgcg---------------------------
A0A2K6NC45_PMAIP1-      --------gcgcgcaagaacgcg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6QIL2_BCL2L11      ----ccgagaaggtagacaattg---------------------------
A0A2K6RAW1_BMF-02       --------aggagctggaagatg---------------------------
A0A2K6RAW1_BMF-01       --------aggagctggaagatg---------------------------
A0A2K6QK74_BIK-01       -----cccgtctccagagacatc---------------------------
A0A2K6QZT2_BBC3-03      ---gccaggtgcccaggg--------------------------------
A0A2K6QZT2_BBC3-04      ---gccaggtgcccaggg--------------------------------
A0A2K6QZT2_BBC3-02      gccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctg
A0A2K6QZT2_BBC3-01      gccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctg
A0A2K6PUL3_BAD-01       ---gcctagtgagcaggaagact---------------------------
A0A2K6PUL3_BAD-02       ---gcctagtgagcaggaagact---------------------------
                                                                          

A0A2K6NC45_PMAIP1-      --------------------------------------caacc-------
A0A2K6NC45_PMAIP1-      --------------------------------------caacc-------
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6QIL2_BCL2L11      --------------------------------------cagcctgcg---
A0A2K6RAW1_BMF-02       -------------------------------atgtgttccagccggagga
A0A2K6RAW1_BMF-01       -------------------------------atgtgttccagccggagga
A0A2K6QK74_BIK-01       ---------------------------ttgatggagaccctcctgtatga
A0A2K6QZT2_BBC3-03      --------------------------------------cttcttctgcga
A0A2K6QZT2_BBC3-04      --------------------------------------cttcttctgcga
A0A2K6QZT2_BBC3-02      gctgccacccccgctgcccccgccctgctgcccgctgcctacctctgcgc
A0A2K6QZT2_BBC3-01      gctgccacccccgctgcccccgccctgctgcccgctgcctacctctgcgc
A0A2K6PUL3_BAD-01       --------------------------------------ccagctctgcag
A0A2K6PUL3_BAD-02       --------------------------------------ccagctctgcag
                                                              *           

A0A2K6NC45_PMAIP1-      ---------------------------------gag------------cc
A0A2K6NC45_PMAIP1-      ---------------------------------gag------------cc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6QIL2_BCL2L11      ---------------------------------gagaggcct-----ccc
A0A2K6RAW1_BMF-02       c--------------------------------ggggagccgggg--gcc
A0A2K6RAW1_BMF-01       c--------------------------------ggggagccgggg--gcc
A0A2K6QK74_BIK-01       ---------------------------------gcagctcctggaacccc
A0A2K6QZT2_BBC3-03      c--------------------------------gtg------ggt--ccc
A0A2K6QZT2_BBC3-04      c--------------------------------gtg------ggt--ccc
A0A2K6QZT2_BBC3-02      ccccaccgccccacccgccgtcaccgccgccctggg------ggg--ccc
A0A2K6QZT2_BBC3-01      ccccaccgccccacccgccgtcaccgccgccctggg------ggg--ccc
A0A2K6PUL3_BAD-01       a--------------------------------gaggggcctggg--ccc
A0A2K6PUL3_BAD-02       a--------------------------------gaggggcctggg--ccc
                                                         *              **

A0A2K6NC45_PMAIP1-      cagcgcgggct-------------------------------caggcagg
A0A2K6NC45_PMAIP1-      cagcgcgggct-------------------------------caggcag-
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6QIL2_BCL2L11      cagctcagacctgg------------ggcccctacctccctacagacaga
A0A2K6RAW1_BMF-02       caacctgggag-------------------ctcgctctctgccgatctgt
A0A2K6RAW1_BMF-01       caacctgggag-------------------ctcgctctctgccgatctgt
A0A2K6QK74_BIK-01       taaccatggaggttcttggtgtgactgaccctgaag--------------
A0A2K6QZT2_BBC3-03      ctgccagatttg--------------------------------------
A0A2K6QZT2_BBC3-04      ctgccagatttg------------------------------------tg
A0A2K6QZT2_BBC3-02      ccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacg
A0A2K6QZT2_BBC3-01      ccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacg
A0A2K6PUL3_BAD-01       cagcccggcagggg---------acaggccctcagactccggcaagcatc
A0A2K6PUL3_BAD-02       cagcccggcagggg---------acaggccctcagactccggcaagcatc
                           *                                              

A0A2K6NC45_PMAIP1-      acctgcag-------------------------------------ggacg
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      accacaag------------------------------------------
A0A2K6QIL2_BCL2L11      accacaag------------------------------------------
A0A2K6QIL2_BCL2L11      accacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgcc
A0A2K6QIL2_BCL2L11      accacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgcc
A0A2K6QIL2_BCL2L11      accacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgcc
A0A2K6QIL2_BCL2L11      accacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgcc
A0A2K6QIL2_BCL2L11      accacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgcc
A0A2K6QIL2_BCL2L11      accaca--------------------------------------------
A0A2K6QIL2_BCL2L11      accacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgcc
A0A2K6QIL2_BCL2L11      accacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgcc
A0A2K6RAW1_BMF-02       ttgcccag--------------------------agcctacttgactgcc
A0A2K6RAW1_BMF-01       ttgcccag--------------------------agcctacttgactgcc
A0A2K6QK74_BIK-01       ------ag--------------------------gacctg-------gac
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      gtcctcag--------------------------ccctcg-------ctc
A0A2K6QZT2_BBC3-02      gtcctcag--------------------------ccctcg-------ctc
A0A2K6QZT2_BBC3-01      gtcctcag--------------------------ccctcg-------ctc
A0A2K6PUL3_BAD-01       atcgccag--------------------------gcccca-------ggc
A0A2K6PUL3_BAD-02       atcgccag--------------------------gcccca-------ggc
                                                                          

A0A2K6NC45_PMAIP1-      gcagggacggcgagggaccaagccggattagggattgggatgcagctgca
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      cccacggcagc--------------cctcagggcccg-----ctggcccc
A0A2K6QIL2_BCL2L11      cccacggcagc--------------cctcagggcccg-----ctggcccc
A0A2K6QIL2_BCL2L11      cccacggcagc--------------cctcagggcccg-----ctggcccc
A0A2K6QIL2_BCL2L11      cccacggcagc--------------cctcagggcccg-----ctggcccc
A0A2K6QIL2_BCL2L11      cccacggcagc--------------cctcagggcccg-----ctggcccc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      cccacggcagc--------------cctcagggcccg-----ctggcccc
A0A2K6QIL2_BCL2L11      cccacggcagc--------------cctcagggcccg-----ctggcccc
A0A2K6RAW1_BMF-02       ccctcagccga--------------cttcagctcttc-----------cc
A0A2K6RAW1_BMF-01       ccctcagccga--------------cttcagctcttc-----------cc
A0A2K6QK74_BIK-01       cctatggagga--------------cttcgatccttt-------ggagtg
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      tcgctggcggagcagcacctggagtcgccggtgcccagcgccccgggggc
A0A2K6QZT2_BBC3-02      tcgctggcggagcagcacctggagtcgccggtgcccagcgccccgggggc
A0A2K6QZT2_BBC3-01      tcgctggcggagcagcacctggagtcgccggtgcccagcgccccgggggc
A0A2K6PUL3_BAD-01       ctcctgtggga--------------cgccagtcaccagca----ggagca
A0A2K6PUL3_BAD-02       ctcctgtggga--------------cgccagtcaccagca----ggagca
                                                                          

A0A2K6NC45_PMAIP1-      tttcaccagaggcaaaaagct-----------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      accggccagccctggcccttttgctaccagatccccgcttttcatcttta
A0A2K6QIL2_BCL2L11      accggccagccctggcccttttgctaccagatccccgcttttcatcttta
A0A2K6QIL2_BCL2L11      accggccagccctggcccttttgctaccagatccccgcttttcatcttta
A0A2K6QIL2_BCL2L11      accggccagccctggcccttttgctaccagatccccgcttttcatcttta
A0A2K6QIL2_BCL2L11      accggccagccctggcccttttgctaccagatccccgcttttcatcttta
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      accggccagccctggcccttttgctaccagatccccgcttttcatcttta
A0A2K6QIL2_BCL2L11      accggccagccctggcccttttgctaccagatccccgcttttcatcttta
A0A2K6RAW1_BMF-02       tctcacccactgctgtg---------------------------------
A0A2K6RAW1_BMF-01       tctcacccactgctgtg---------------------------------
A0A2K6QK74_BIK-01       tatggaggacagtgacatgtt-----------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      cctggcgggcggtcccaccca-----------------------------
A0A2K6QZT2_BBC3-02      cctggcgggcggtcccaccca-----------------------------
A0A2K6QZT2_BBC3-01      cctggcgggcggtcccaccca-----------------------------
A0A2K6PUL3_BAD-01       gccaaccagcagcagccatca-----------------------------
A0A2K6PUL3_BAD-02       gccaaccagcagcagccatcatggagggagagcttggtattatcctgctg
                                                                          

A0A2K6NC45_PMAIP1-      -cctctcctcctccccacttgcccttccgcggggccacgaggaacaagtg
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
A0A2K6QIL2_BCL2L11      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
A0A2K6QIL2_BCL2L11      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
A0A2K6QIL2_BCL2L11      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
A0A2K6QIL2_BCL2L11      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
A0A2K6QIL2_BCL2L11      tgagaagatcctccctgctgtctcgatcctccagtgggtatttctctttt
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      -----ggcggccccgggagtccgcggggaggaggaacagtgggcccggga
A0A2K6QZT2_BBC3-02      -----ggcggccccgggagtccgcggggaggaggaacagtgggcccggga
A0A2K6QZT2_BBC3-01      -----ggcggccccgggagtccgcggggaggaggaacagtgggcccggga
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-02       aatctgaggactctgaaaatcccagtgcaaggatgctcgcggaagcatca
                                                                          

A0A2K6NC45_PMAIP1-      caagtagctcgaagtcgagtgtgctactca--------------------
A0A2K6NC45_PMAIP1-      -----agctcgaagtcgagtgtgctactca--------------------
A0A2K6QIL2_BCL2L11      -------acaggagcccagc------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      gacacagacaggagcccagc------------------------------
A0A2K6QIL2_BCL2L11      gacacagacaggagcccagc------------------------------
A0A2K6QIL2_BCL2L11      gacacagacaggagcccagc------------------------------
A0A2K6QIL2_BCL2L11      gacacagacaggagcccagc------------------------------
A0A2K6QIL2_BCL2L11      gacacagacaggagcccagc------------------------------
A0A2K6QIL2_BCL2L11      -----agacaggagcccagc------------------------------
A0A2K6QIL2_BCL2L11      gacacagacaggagcccagc------------------------------
A0A2K6QIL2_BCL2L11      gacacagacaggagcccagc------------------------------
A0A2K6RAW1_BMF-02       ------------gccctggccttcgacccacca-----------------
A0A2K6RAW1_BMF-01       ------------gccctggccttcgacccacca-----------------
A0A2K6QK74_BIK-01       ------------ggccctgcggctggcct---------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      gatcggggcccagctgcggcggatggcggacgacctcaacgcgcag----
A0A2K6QZT2_BBC3-02      gatcggggcccagctgcggcggatggcggacgacctcaacgcgcag----
A0A2K6QZT2_BBC3-01      gatcggggcccagctgcggcggatggcggacgacctcaacgcgcag----
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-02       gcagggatgtctgccccagccactgactcagaagcccaactcgcagagaa
                                                                          

A0A2K6NC45_PMAIP1-      -------------actcaggagatttggagacaaactgaacttcc--ggc
A0A2K6NC45_PMAIP1-      -------------actcaggagatttggagacaaactgaacttcc--ggc
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6QIL2_BCL2L11      -------------acccatgagtt---gtgacaaatcaa---cacaaacc
A0A2K6RAW1_BMF-02       -------------gccaggaagac---aaggctacccagaccctc--ggc
A0A2K6RAW1_BMF-01       -------------gccaggaagac---aaggctacccagaccctc--ggc
A0A2K6QK74_BIK-01       -------------gcatcggggat---gagatggacgtgagcctcagggc
A0A2K6QZT2_BBC3-03      ------------------tgagac---aagaggagcagcag-c----gac
A0A2K6QZT2_BBC3-04      --------tacgagcggcggagac---aagaggagcagcag-c----gac
A0A2K6QZT2_BBC3-02      --------tacgagcggcggagac---aagaggagcagcag-c----gac
A0A2K6QZT2_BBC3-01      --------tacgagcggcggagac---aagaggagcagcag-c----gac
A0A2K6PUL3_BAD-01       --------tggaggcgctggggct---gtggagacccggagtc----gcc
A0A2K6PUL3_BAD-02       tgtaaagctggaggcgctggggct---gtggagacccggagtc----gcc
                                                                          

A0A2K6NC45_PMAIP1-      agaaacttttgaatct-------------------------------gat
A0A2K6NC45_PMAIP1-      agaaacttttgaatct-------------------------------gat
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6QIL2_BCL2L11      ccaagtcctccttgcc-------------------------------agg
A0A2K6RAW1_BMF-02       ccagcctcccccagccaaggtgttatgctgccttgtggggtaactgagga
A0A2K6RAW1_BMF-01       ccagcctcccccagccaaggtgttatgctgccttgtggggtaactgagga
A0A2K6QK74_BIK-01       cccgcgcctggcc-c--------------------agctctctgaggtgg
A0A2K6QZT2_BBC3-03      accgcccctcgcc-ct----------------------------ggaggg
A0A2K6QZT2_BBC3-04      accgcccctcgcc-ct----------------------------ggaggg
A0A2K6QZT2_BBC3-02      accgcccctcgcc-ct----------------------------ggaggg
A0A2K6QZT2_BBC3-01      accgcccctcgcc-ct----------------------------ggaggg
A0A2K6PUL3_BAD-01       acagctcctaccc-cgcggggacggaggaggacgaagggatggaggagga
A0A2K6PUL3_BAD-02       acagctcctaccc-cgcggggacggaggaggacgaagggatggaggagga
                                                                          

A0A2K6NC45_PMAIP1-      agccaaactcttctgctcaggaacct------------------------
A0A2K6NC45_PMAIP1-      agccaaactcttctgctcaggaacct------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaatg------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaatg------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaatg------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaatg------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaatg------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaat-------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaatg------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaatg------------------------
A0A2K6QIL2_BCL2L11      ccttcaaccactatctcagtgcaatg------------------------
A0A2K6RAW1_BMF-02       accccagcgactgttttatg------------------------------
A0A2K6RAW1_BMF-01       accccagcgactgttttatggcaatgctggctaccggcttcctctccctg
A0A2K6QK74_BIK-01       ccatgcacagcctaggtctggctttcatctacgaccagaccgacgacatc
A0A2K6QZT2_BBC3-03      tcctgtacaatctcattatgggactc------------------------
A0A2K6QZT2_BBC3-04      tcctgtacaatctcattatgggactc------------------------
A0A2K6QZT2_BBC3-02      tcctgtacaatctcattatgggactc------------------------
A0A2K6QZT2_BBC3-01      tcctgtacaatctcattatgggactc------------------------
A0A2K6PUL3_BAD-01       gcc----cagcccctttcggggccgc------------------------
A0A2K6PUL3_BAD-02       gcc----cagcccctttcggggccgc------------------------
                                                                          

A0A2K6NC45_PMAIP1-      ---------------------------------------------gactg
A0A2K6NC45_PMAIP1-      ---------------------------------------------ga---
A0A2K6QIL2_BCL2L11      -------------------------------gtagtcatcctagaggata
A0A2K6QIL2_BCL2L11      ---------------------------------------cttccaggagg
A0A2K6QIL2_BCL2L11      -------------------------------g-------tt---------
A0A2K6QIL2_BCL2L11      -------------------------------g-------ctaactgggac
A0A2K6QIL2_BCL2L11      -------------------------------g-------cttccaggagg
A0A2K6QIL2_BCL2L11      -------------------------------g-------cttccaggagg
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      -------------------------------g-------cttccaggagg
A0A2K6QIL2_BCL2L11      -------------------------------g-------cttccaggagg
A0A2K6QIL2_BCL2L11      -------------------------------g-------cttccaggagg
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       ccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcag
A0A2K6QK74_BIK-01       agggatgttcttacaagtttcatggacggcttcaccacccttaaggagaa
A0A2K6QZT2_BBC3-03      -------------------ctg-----------cccttacccaggggcca
A0A2K6QZT2_BBC3-04      -------------------ctg-----------cccttacccaggggcca
A0A2K6QZT2_BBC3-02      -------------------ctg-----------cccttacccaggggcca
A0A2K6QZT2_BBC3-01      -------------------ctg-----------cccttacccaggggcca
A0A2K6PUL3_BAD-01       -------------------tcgcgctccgcgccccctaacctctgggcag
A0A2K6PUL3_BAD-02       -------------------tcgcgctccgcgccccctaacctctgggcag
                                                                          

A0A2K6NC45_PMAIP1-      catcaaaaacttgcataaggggactccaaacgagaatttt----------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      taggtgatactt---cattgtgg---------------------------
A0A2K6QIL2_BCL2L11      caggctgaacctgcagatatgcg---------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      tag-----------------------------------------------
A0A2K6QIL2_BCL2L11      caggctgaacctgcagatatgcg---------------------------
A0A2K6QIL2_BCL2L11      caggctgaacctgcagatatgcg---------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      caggctgaacctgcagatatgcg---------------------------
A0A2K6QIL2_BCL2L11      caggctgaacctgcagatatgcg---------------------------
A0A2K6QIL2_BCL2L11      caggctgaacctgcagatatgcg---------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       tggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcattgc
A0A2K6QK74_BIK-01       cataatgaggttctggagatccctgaatcccgggtcccaggtgtcc----
A0A2K6QZT2_BBC3-03      ca---------------gagcccccgaaatggag----------------
A0A2K6QZT2_BBC3-04      ca---------------gagcccccgaaatggag----------------
A0A2K6QZT2_BBC3-02      ca---------------gagcccccgaaatggag----------------
A0A2K6QZT2_BBC3-01      ca---------------gagcccccgaaatggag----------------
A0A2K6PUL3_BAD-01       cacagcgatatggccgcgagctccggaggatgagtgacgagtttgtggac
A0A2K6PUL3_BAD-02       cacagcgatatggccgcgagctccggaggatga-----------------
                                                                          

A0A2K6NC45_PMAIP1-      ---------------------tctcaggaggtgcacgtttcatcaatttg
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ---------------------tttggatttatatttactggcttagattt
A0A2K6QIL2_BCL2L11      ---------------------cccgga--gatacggatcgcccaagagtt
A0A2K6QIL2_BCL2L11      ------------------------aga--gaaataga-------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ---------------------cccgga--gatacggatcgcccaagagtt
A0A2K6QIL2_BCL2L11      ---------------------cccgga--gatacggatcgcccaagagtt
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ---------------------cccgga--gatacggatcgcccaagagtt
A0A2K6QIL2_BCL2L11      ---------------------cccgga--gatacggatcgcccaagagtt
A0A2K6QIL2_BCL2L11      ---------------------cccgga--gatacggatcgcccaagagtt
A0A2K6RAW1_BMF-02       -------------------------------caccagcagaaccgaaatc
A0A2K6RAW1_BMF-01       agaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatc
A0A2K6QK74_BIK-01       ---------------------cgcgaacaggtgctgctggcgctgctgct
A0A2K6QZT2_BBC3-03      ---------------------cccaattaggtgcctgcacccgcccggtg
A0A2K6QZT2_BBC3-04      ---------------------cccaattag--------------------
A0A2K6QZT2_BBC3-02      ---------------------cccaattaggtgcctgcacccgcccggtg
A0A2K6QZT2_BBC3-01      ---------------------cccaattag--------------------
A0A2K6PUL3_BAD-01       tcctttaagggacttcctcgcccgaagagcgcgggtacagcgacgcagat
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      aagaaagattgcattgtaattgg---------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      gtatgtggtttggatttatatttaccaccacagtcaagatacagaacaac
A0A2K6QIL2_BCL2L11      gcg-gcgaatcggagacgagtttaacgct---------------tactat
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      gcg-gcgaatcggagacgagtttaacgct---------------tactat
A0A2K6QIL2_BCL2L11      gcg-gcgaatcggagacgagtttaacgct---------------tactat
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      gcg-gcgaatcggagacgagtttaacgct---------------tactat
A0A2K6QIL2_BCL2L11      gcg-gcgaatcggagacgagtttaacgct---------------tactat
A0A2K6QIL2_BCL2L11      gcg-gcgaatcggagacgagtttaacgct---------------tactat
A0A2K6RAW1_BMF-02       gcgtgtggtggc----------agatcctcctcttcctgcacaaccttgc
A0A2K6RAW1_BMF-01       gcgtgtggtggc----------agatcctcctcttcctgcacaaccttgc
A0A2K6QK74_BIK-01       gctgctggcggc------------------------------------gc
A0A2K6QZT2_BBC3-03      gacgtcagggactcggggggcaggcccctcccacctcctgacaccctggc
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-02      gacgtcagggactcggggggcaggcccctcccacctcctgacaccctggc
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6PUL3_BAD-01       gcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcgga
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      tcaaccacagggatttctcatga---------------------------
A0A2K6QIL2_BCL2L11      gcaaggaggttg-----gcaaaact-------------------------
A0A2K6QIL2_BCL2L11      -------ggaagttgtcgtgtag---------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      gcaaggaggatgtctct---------------------------------
A0A2K6QIL2_BCL2L11      gcaaggaggtta-----gagaaatag------------------------
A0A2K6QIL2_BCL2L11      -------gggtatttttgaataa---------------------------
A0A2K6QIL2_BCL2L11      gcaaggagggtatttttgaataattaccaagcagccgaagaacacccaca
A0A2K6QIL2_BCL2L11      gcaaggagggtatttttgaataattaccaagcagccgaagaacacccaca
A0A2K6QIL2_BCL2L11      gcaaggagggtatttttgaataattaccaagcagccgaagaacacccaca
A0A2K6RAW1_BMF-02       tttgaatggagaagagaatag-----------------------------
A0A2K6RAW1_BMF-01       tttgaatggagaagagaataggaacggggcgggccctaggtga-------
A0A2K6QK74_BIK-01       tgctcagcggg--------ggcctgcacctgctgctcaagtga-------
A0A2K6QZT2_BBC3-03      cagcgcggggg--------actttctctgcaccatgtag-----------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-02      cagcgcggggg--------actttctctgcaccatgtag-----------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6PUL3_BAD-01       acttgggcagg--------ggaagctccgccccctcccagtga-------
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ----------------------cctggcatcctccacctga---------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------tccacctg----------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      aatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaa
A0A2K6QIL2_BCL2L11      aatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaa
A0A2K6QIL2_BCL2L11      aatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaa
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
                                                                          

A0A2K6NC45_PMAIP1-      --------
A0A2K6NC45_PMAIP1-      --------
A0A2K6QIL2_BCL2L11      --------
A0A2K6QIL2_BCL2L11      --------
A0A2K6QIL2_BCL2L11      --------
A0A2K6QIL2_BCL2L11      --------
A0A2K6QIL2_BCL2L11      ---attaa
A0A2K6QIL2_BCL2L11      --------
A0A2K6QIL2_BCL2L11      --------
A0A2K6QIL2_BCL2L11      tgcattga
A0A2K6QIL2_BCL2L11      tgcattga
A0A2K6QIL2_BCL2L11      tgcattga
A0A2K6RAW1_BMF-02       --------
A0A2K6RAW1_BMF-01       --------
A0A2K6QK74_BIK-01       --------
A0A2K6QZT2_BBC3-03      --------
A0A2K6QZT2_BBC3-04      --------
A0A2K6QZT2_BBC3-02      --------
A0A2K6QZT2_BBC3-01      --------
A0A2K6PUL3_BAD-01       --------
A0A2K6PUL3_BAD-02       --------
                                

© 1998-2020Legal notice