Dataset for CDS BBC3 of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6QZT2_BBC3-03      ataaaatttggcgtggggtctgcccgggcatgtccat-------------
A0A2K6QZT2_BBC3-04      ataaaatttggcgtggggtctgcccgggcatgtccat-------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccag
                                                                          

A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      ggcttcttctgcgacgtgggtcccctgccagatttgtggccccagggagc
                                                                          

A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      ---atggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A2K6QZT2_BBC3-02      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
                                                                          

A0A2K6QZT2_BBC3-03      --------------------------------------gccaggtgccca
A0A2K6QZT2_BBC3-04      --------------------------------------gccaggtgccca
A0A2K6QZT2_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2K6QZT2_BBC3-02      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
                                                              *** ******* 

A0A2K6QZT2_BBC3-03      ggg-----------------------------------------------
A0A2K6QZT2_BBC3-04      ggg-----------------------------------------------
A0A2K6QZT2_BBC3-01      cggcagtgtcctgcggcctctgcgagcccggcctggctgccacccccgct
A0A2K6QZT2_BBC3-02      cggcagtgtcctgcggcctctgcgagcccggcctggctgccacccccgct
                         **                                               

A0A2K6QZT2_BBC3-03      -----------------------cttcttctgcgac--------------
A0A2K6QZT2_BBC3-04      -----------------------cttcttctgcgac--------------
A0A2K6QZT2_BBC3-01      gcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacc
A0A2K6QZT2_BBC3-02      gcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacc
                                               ** * ****** *              

A0A2K6QZT2_BBC3-03      ------------------gtgggtcccctgccagatttg-----------
A0A2K6QZT2_BBC3-04      ------------------gtgggtcccctgccagatttg-----------
A0A2K6QZT2_BBC3-01      cgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgca
A0A2K6QZT2_BBC3-02      cgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgca
                                          * *** **** **  *  * *           

A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      -------------------------tggtcctcagccctcgctctcgctg
A0A2K6QZT2_BBC3-01      gccggccccgaggcccacgcccggacggtcctcagccctcgctctcgctg
A0A2K6QZT2_BBC3-02      gccggccccgaggcccacgcccggacggtcctcagccctcgctctcgctg
                                                                          

A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      gcggagcagcacctggagtcgccggtgcccagcgccccgggggccctggc
A0A2K6QZT2_BBC3-01      gcggagcagcacctggagtcgccggtgcccagcgccccgggggccctggc
A0A2K6QZT2_BBC3-02      gcggagcagcacctggagtcgccggtgcccagcgccccgggggccctggc
                                                                          

A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      gggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagt
A0A2K6QZT2_BBC3-01      gggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagt
A0A2K6QZT2_BBC3-02      gggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagt
                                                                          

A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      gggcccgggagatcggggcccagctgcggcggatggcggacgacctcaac
A0A2K6QZT2_BBC3-01      gggcccgggagatcggggcccagctgcggcggatggcggacgacctcaac
A0A2K6QZT2_BBC3-02      gggcccgggagatcggggcccagctgcggcggatggcggacgacctcaac
                                                                          

A0A2K6QZT2_BBC3-03      ----------------tgagacaagaggagcagcagcgacaccgcccctc
A0A2K6QZT2_BBC3-04      gcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctc
A0A2K6QZT2_BBC3-01      gcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctc
A0A2K6QZT2_BBC3-02      gcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctc
                                         *********************************

A0A2K6QZT2_BBC3-03      gccctggagggtcctgtacaatctcattatgggactcctgcccttaccca
A0A2K6QZT2_BBC3-04      gccctggagggtcctgtacaatctcattatgggactcctgcccttaccca
A0A2K6QZT2_BBC3-01      gccctggagggtcctgtacaatctcattatgggactcctgcccttaccca
A0A2K6QZT2_BBC3-02      gccctggagggtcctgtacaatctcattatgggactcctgcccttaccca
                        **************************************************

A0A2K6QZT2_BBC3-03      ggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcc
A0A2K6QZT2_BBC3-04      ggggccacagagcccccgaaatggagcccaattag---------------
A0A2K6QZT2_BBC3-01      ggggccacagagcccccgaaatggagcccaattag---------------
A0A2K6QZT2_BBC3-02      ggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcc
                        ***********************************               

A0A2K6QZT2_BBC3-03      cggtggacgtcagggactcggggggcaggcccctcccacctcctgacacc
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      cggtggacgtcagggactcggggggcaggcccctcccacctcctgacacc
                                                                          

A0A2K6QZT2_BBC3-03      ctggccagcgcgggggactttctctgcaccatgtag
A0A2K6QZT2_BBC3-04      ------------------------------------
A0A2K6QZT2_BBC3-01      ------------------------------------
A0A2K6QZT2_BBC3-02      ctggccagcgcgggggactttctctgcaccatgtag
                                                            

© 1998-2022Legal notice