Dataset for CDS BMF of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6L919_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6L919_BMF-03      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6L919_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc

A0A2K6L919_BMF-01      ggaggacggggagccgggggcccaacctgggagctcgctctctgccgatc
A0A2K6L919_BMF-03      ggaggacggggagccgggggcccaacctgggagctcgctctctgccgatc
A0A2K6L919_BMF-02      ggaggacggggagccgggggcccaacctgggagctcgctctctgccgatc

A0A2K6L919_BMF-01      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A2K6L919_BMF-03      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A2K6L919_BMF-02      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc

A0A2K6L919_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6L919_BMF-03      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6L919_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga

A0A2K6L919_BMF-01      caaggctacccagaccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6L919_BMF-03      caaggctacccagaccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6L919_BMF-02      caaggctacccagaccctcggcccagcctcccccagccaaggtgttatgc

A0A2K6L919_BMF-01      tgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgct
A0A2K6L919_BMF-03      tgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgct
A0A2K6L919_BMF-02      tgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgct

A0A2K6L919_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A2K6L919_BMF-03      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A2K6L919_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg

A0A2K6L919_BMF-01      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6L919_BMF-03      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6L919_BMF-02      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg

A0A2K6L919_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
A0A2K6L919_BMF-03      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
A0A2K6L919_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag

A0A2K6L919_BMF-01      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K6L919_BMF-03      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K6L919_BMF-02      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct

A0A2K6L919_BMF-01      gcacaaccttgctttgaatggagaagagaataggaacggggcgggcccta
A0A2K6L919_BMF-03      gcacaaccttgctttgaatggagaagagaataggaacggggcgggcccta
A0A2K6L919_BMF-02      gcacaaccttgctttgaatggagaagagaataggaacggggcgggcccta

A0A2K6L919_BMF-01      g-------------------------------------------------
A0A2K6L919_BMF-03      g-------------------------------------------------
A0A2K6L919_BMF-02      ggcccttgacctggaatgggggccgttgtcaaacactgttgaaggggagg

A0A2K6L919_BMF-01      -----------gtga
A0A2K6L919_BMF-03      -----------gtga
A0A2K6L919_BMF-02      ctgatgtgtctgtga

© 1998-2022Legal notice