Dataset for CDS BBC3 of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6KS56_BBC3-01      atgccgcgcaccagaggcagctcccccggacccgtagagggctggccgcg
A0A2K6KS56_BBC3-02      --------------------------------------------------
                                                                          

A0A2K6KS56_BBC3-01      acggccgtcgccccttcccgctcggcctgtcctgcggcctctgcgagccc
A0A2K6KS56_BBC3-02      --------------------------------------------------
                                                                          

A0A2K6KS56_BBC3-01      ggccggctgccgcccccgctgcccccgccctgctcgcccgcctgccacct
A0A2K6KS56_BBC3-02      --------------------------------------------------
                                                                          

A0A2K6KS56_BBC3-01      ctgcgcccccaccgcccacgccgtcccgcgccgcccctggggcgctggcc
A0A2K6KS56_BBC3-02      --------------------------------------------ctggc-
                                                                    ***** 

A0A2K6KS56_BBC3-01      tggtcccgcagccgccccgggcccacgcccggaggtgagtgcccgcccgc
A0A2K6KS56_BBC3-02      --------------------------------------------------
                                                                          

A0A2K6KS56_BBC3-01      cccccgggttgataggagtcgggcgcacctggagtcgcggtgccagcccc
A0A2K6KS56_BBC3-02      -------------------ggagcgcacctggagtcgcggtgccagcccc
                                            * ****************************

A0A2K6KS56_BBC3-01      ggggccctggcgggcggtccaccaggcggccccgggagtcgcggggagga
A0A2K6KS56_BBC3-02      ggggccct----------------ggcggccccgggagtcgcggggagga
                        ********                **************************

A0A2K6KS56_BBC3-01      ggcgaagtgggccgggaatcggggcccagctgcggcggatggcgagacga
A0A2K6KS56_BBC3-02      ggcgaagtgggccgggaatcggggcccagctgcggcggatggcgagacga
                        **************************************************

A0A2K6KS56_BBC3-01      ctcaacgcgcagtacagacggcggagacaagaggagcagcagcgacaccg
A0A2K6KS56_BBC3-02      ctcaacgcgcagtacagacggcggagacaagaggagcagcagcgacaccg
                        **************************************************

A0A2K6KS56_BBC3-01      cccctcgccctggagggtcctgtacaatctcattatgggactcctgccct
A0A2K6KS56_BBC3-02      cccctcgccctggagggtcctgtacaatctcattatgggactcctgccct
                        **************************************************

A0A2K6KS56_BBC3-01      tacccaggggccacagagcccccgaaatggagcccaattaggtgcctgca
A0A2K6KS56_BBC3-02      tacccaggggccacagagcccccgaaatggagcccaattag---------
                        *****************************************         

A0A2K6KS56_BBC3-01      cccgcccggtggacgtcagggactcggggggcaggcccctcccacctcct
A0A2K6KS56_BBC3-02      --------------------------------------------------
                                                                          

A0A2K6KS56_BBC3-01      gacaccctggccagcgcgggggactttctctgcaccatgtag
A0A2K6KS56_BBC3-02      ------------------------------------------
                                                                  

© 1998-2020Legal notice