Dataset for CDS classical BH3-containing proteins of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q5U777_PMAIP1-01       atg-------------------cccgggagaaaggc-------gcgtcgg
O88498_BCL2L11-01      atg-------------------gccaagcaaccttctgatgtaaattctg
O88498_BCL2L11-02      atg-------------------gccaagcaaccttctgatgtaaattctg
P62817_HRK-01          atgt----------------------------------------------
Q80ZG6_BBC3-01         atggcccgcgcacgcca-------ggagggcagctc---tccggagcccg
Q925D2_BIK-01          atgtcagaggcgagactaatggccagagacattatc---aa-gactcttc
Q8K589_BMF-01          atg--------gagcca-----cctcagtg------------------tg
O35147_BAD-01          atg--------ggaacc-----ccaaagcagccctc---gctggctcctg
Q6P7C5_BAD-01          atg--------ggaacc-----ccaaagcagccctc---gctggctcctg

Q5U777_PMAIP1-01       aacgcgccattgaacccaacg--------------------cgggcagag
O88498_BCL2L11-01      agtgtgacagagaaggtggacaattgcagcctgctgagaggcctccccag
O88498_BCL2L11-02      agtgtgacagagaaggtggacaattgcagcctgctgagaggcctccccag
P62817_HRK-01          ---------------------gcccgtgtcc----------ccggcatcg
Q80ZG6_BBC3-01         tagagggcctagcccgcgacagcccgcgtcc----------tttcccgct
Q925D2_BIK-01          tacacgacc---------ag-----gtcccc----------caacctgca
Q8K589_BMF-01          tggaggaactagaagatgat-----gtgttc----------cagccag--
O35147_BAD-01          cacacgccctaggct-tgag-----gaagtc----------cgatccc--
Q6P7C5_BAD-01          cacacgccctaggct-tgag-----gaagtc----------cgatccc--

Q5U777_PMAIP1-01       ttaccgcctgaattc---------------gcagct--------------
O88498_BCL2L11-01      ctcaggcctggggcccctacctccctacagacagaatcgcaaggtaatcc
O88498_BCL2L11-02      ctcaggcctggggcccctacctccctacagacagaatcgca---------
P62817_HRK-01          cggccgc---gggcccccg-----------gccgtg---tg---------
Q80ZG6_BBC3-01         cggccgcctgatgccctcc-----------gctgtatcctg---------
Q925D2_BIK-01          gtggtctctggggctccca-----------gcatga---ag---------
Q8K589_BMF-01          --aggatggggagcc----------------aggga---ca---------
O35147_BAD-01          --ggaatccggagcc----------------tgggg---ag---------
Q6P7C5_BAD-01          --ggaatccggagcc----------------tgggg---ag---------

Q5U777_PMAIP1-01       ---cagctcaggaa------------------------------------
O88498_BCL2L11-01      cgacggcgaaggggaccgctgcccccacggcagccctcagggcccgctgg
O88498_BCL2L11-02      --------------------------------------------------
P62817_HRK-01          ---cggttgcggcga--------cgctcgc--cccgggctgc--------
Q80ZG6_BBC3-01         ---cggcctctgcgagcccggcctgcccgctgcccctgctgcccctgcct
Q925D2_BIK-01          ---gagcctgtggg----------------------ggttga--------
Q8K589_BMF-01          ---cagcctgggagcttgctctctgctgacctgtttgcccag--------
O35147_BAD-01          ---cgacgcgggag----------gaaggc------ggtgga--------
Q6P7C5_BAD-01          ---cgacgcgggag----------gaaggc------ggtgga--------

Q5U777_PMAIP1-01       -------gattggagataaagtgtactgcacgtg----------------
O88498_BCL2L11-01      ccccaccggccagccctggtccttttgctaccagatccccacttttcatc
O88498_BCL2L11-02      --------------------------------------------------
P62817_HRK-01          ----gctgggcggcgg------cgcaggtgaccg-cgctg---cggctgc
Q80ZG6_BBC3-01         tgctgccggccgccta------cctctgcgcccc-caccgccccgcctgc
Q925D2_BIK-01          -------ggacgtcag-------tcctgtgagag-acttggatt------
Q8K589_BMF-01          -------agccagctggattgtcccctcagtcgg-cttcagctcttcccg
O35147_BAD-01          -------gaccagcag-------cccagagtatg-ttccagatc------
Q6P7C5_BAD-01          -------gaccagcag-------cccagagtatg-ttccagatc------

Q5U777_PMAIP1-01       -------------------------------gagtgcaccggacat----
O88498_BCL2L11-01      tttgtgagaagatcttctctgctgtcccggtcctccagtgggtatttctc
O88498_BCL2L11-02      --------------------------------------------------
P62817_HRK-01          ag--------gcgctgggcgacgagctgcaccgacgcgccatgagg----
Q80ZG6_BBC3-01         cgtcaccgccgccctggggggc------ccccgctggcctgggggt----
Q925D2_BIK-01          -----------------tcatgaggt---gcctggagagcagaaac----
Q8K589_BMF-01          cttacccactgctgtggtcctgggctccggcctgtaagccaggaagacaa
O35147_BAD-01          ------------------ccagagtttgagccgagtgagcaggaagacgc
Q6P7C5_BAD-01          ------------------ccagagtttgagccgagtgagcaggaagacgc

Q5U777_PMAIP1-01       ---aactgcggttctggcgcagatgcctg-----------------gcaa
O88498_BCL2L11-01      ttttgacacagacaggagcccggcacccatg-------------------
O88498_BCL2L11-02      ---------agacaggagcccggcacccatg-------------------
P62817_HRK-01          ---cgtcgcgcgc--ggccccgggacccgct---------------gccc
Q80ZG6_BBC3-01         ---caccgcagcc--ggccccgaggcccgcgcccggacggtcctcagccc
Q925D2_BIK-01          --------caggt--ggccctgaggct-a-----------------gcct
Q8K589_BMF-01          ggccacc-cagac-----cctcagccc-a-----------------gcct
O35147_BAD-01          tagtactacagataggggcctgggcccta-----------------gcct
Q6P7C5_BAD-01          tagtactacagataggggcctgggcccta-----------------gcct
                                          *     *                        

Q5U777_PMAIP1-01       gaagtcgcgaaagagcacgatgaga---------------------agaa
O88498_BCL2L11-01      --agttgtgacaagtcaaca--------------------------caaa
O88498_BCL2L11-02      --agttgtgacaagtcaaca--------------------------caaa
P62817_HRK-01          gcgct---------------------------------------------
Q80ZG6_BBC3-01         tcgctgtcaccagcccagc---------------------------agca
Q925D2_BIK-01          gcatcggcgatgagatggaccggtgtctt-----------------cgga
Q8K589_BMF-01          -ccc------caagccagggtgtcatgctgccttgtggggtgacagagga
O35147_BAD-01          -cactgaggaccagccaggtccctacctggcccc------------aggt
Q6P7C5_BAD-01          -cactgaggaccagccaggtccctacctggcccc------------aggt

Q5U777_PMAIP1-01       gcccaag----cccaacccgggtgccagcag-------------------
O88498_BCL2L11-01      ccccaagtcctccttgccaggcctt----------------caaccatta
O88498_BCL2L11-02      ccccaagtcctccttgccaggcctt----------------caaccatta
P62817_HRK-01          ------gctgcccgcgctccgcg-cccgctggccctggc-----------
Q80ZG6_BBC3-01         cctagagtcgcccgtgcccagcgccccggaggccctggcgggaggcccca
Q925D2_BIK-01          gcccccg----tctggtccagctgcctgggattgctatgcacagacttgc
Q8K589_BMF-01          accccagagactcttttacggcaac--------gctggctacaggcttcc
O35147_BAD-01          ctcctggggagcatcgttcagcagc--------agccgggacaggcagc-
Q6P7C5_BAD-01          ctcctggggagcatcgttcagcagc--------agccgggacaggcagc-
                             *             *                             

Q5U777_PMAIP1-01       ---------------------acctgaagga-------------------
O88498_BCL2L11-01      tctca----------------gtgcaatggc-------------------
O88498_BCL2L11-02      tctca----------------gtgcaatggc-------------------
P62817_HRK-01          ------------------tgtgcgcggccgc-------------------
Q80ZG6_BBC3-01         cccaagctgccccgggagtgcgtgtggagga-------------------
Q925D2_BIK-01          tgccacctacagccagacgggtgtcagaggt-------------------
Q8K589_BMF-01          tctccctgccagttt------ccccgcaggc-------------------
O35147_BAD-01          ---caataacagtca------tcatggaggcgctgggactatggagaccc
Q6P7C5_BAD-01          ---caataacagtca------tcatggaggt-------------------

Q5U777_PMAIP1-01       --------------------------------------------------
O88498_BCL2L11-01      --------------------------------------------------
O88498_BCL2L11-02      --------------------------------------------------
P62817_HRK-01          --------------------------------------------------
Q80ZG6_BBC3-01         --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
O35147_BAD-01          ggagtcgccacagttcgtacccagcggggactgaggaagatgaagggatg
Q6P7C5_BAD-01          --------------------------------------------------

Q5U777_PMAIP1-01       ---------------------------------------cgagtgtgatc
O88498_BCL2L11-01      ---------------ttccataaggcagtctcagga---ggaacctgaag
O88498_BCL2L11-02      ---------------ttccataaggcagtctcagga---ggaacctgaag
P62817_HRK-01          ------------------gcaggtggcggcgctggc------ggcctggc
Q80ZG6_BBC3-01         ------------------ggaggagtgggcccgggagatcggggcccagc
Q925D2_BIK-01          --------------attttcagaag------cttgattggaagcctcacc
Q8K589_BMF-01          ----------tcagcccttggggagcagccccctgaaggacagttccttc
O35147_BAD-01          gaggaggagcttagcccttttcgaggacgctcgcgctcggc-tcccccca
Q6P7C5_BAD-01          --------------------------------------------------

Q5U777_PMAIP1-01       aactgcggagaa------------------------------ttggagac
O88498_BCL2L11-01      atctgcgcccagagatacggatcgcacaggagctgcggcggatcggagac
O88498_BCL2L11-02      atctgcgcccagagatacggatcgcacaggagctgcggcggatcggagac
P62817_HRK-01          tgct-----cgg--------------------------------------
Q80ZG6_BBC3-01         tgcggaggatgg--------------------------------------
Q925D2_BIK-01          aacctcagggaaaatatc--------------------------------
Q8K589_BMF-01          agcaccgagcagaggtacagatcgccagaaagcttcagtgcattgcagac
O35147_BAD-01          atctctgggcagcgcagcgctatggccgtgagctccgaagaatgagcgat
Q6P7C5_BAD-01          --------------------------------------------------

Q5U777_PMAIP1-01       -----------------aaagtgaatttacggcaga--------------
O88498_BCL2L11-01      --------gagttc---aatgagacttacacgaggagggcgtttgcaaac
O88498_BCL2L11-02      --------gagttc---aatgagacttacacgaggagggcgtttgcaaac
P62817_HRK-01          -----------------caggcgg----agcgcgtag-------------
Q80ZG6_BBC3-01         -----------------cggacgacctcaacgcgcagtacgagcggcgga
Q925D2_BIK-01          --------tggtcc--tggagagtcttcactcctggcgcctgggtgtcac
Q8K589_BMF-01          --------cagttccatcg----gcttcata----------tgcaacaac
O35147_BAD-01          gaatttgagggttccttcaagggacttcctcgcccaaagagcgcaggcac
Q6P7C5_BAD-01          --------aggttcctc------acttccat-------------------

Q5U777_PMAIP1-01       -------------------------------------------aacttct
O88498_BCL2L11-01      gattaccgagaggcggaagaccacccgcaaatggttatcttacaactgtt
O88498_BCL2L11-02      gattaccgagaggcggaagaccacccgcaaatggttatcttacaactgtt
P62817_HRK-01          --------------------------------------------------
Q80ZG6_BBC3-01         gacaagaagagcaacatcgacaccgacc------ctcgccctggagggtc
Q925D2_BIK-01          ctgaccaggacc----ctgggcagctgt------ttcccatggtgctgct
Q8K589_BMF-01          accagcagaaccgagaccgagca-----------t--------ggcggca
O35147_BAD-01          tgcaacacagatgcgacaaagcgccagt------t--------ggacgcg
Q6P7C5_BAD-01          --------------------------------------------------

Q5U777_PMAIP1-01       gaattttatttcc------aagctcttcaatttaataac-----------
O88498_BCL2L11-01      acgattcatcttccg--------tctggtctggagaagg-----------
O88498_BCL2L11-02      acgattcatcttccg--------tctggtctggagaagg-----------
P62817_HRK-01          --------------------------------------------------
Q80ZG6_BBC3-01         atgtataatctcttcatgggactcctccccttacccagggatcctggagc
Q925D2_BIK-01          ggtcttcttgctgctgggtggggcctggcatt------------------
Q8K589_BMF-01          ggtcttcctcttcct--tcaaaacctggccttgaacagacgagaaaacag
O35147_BAD-01          cattatccagtcctg--gtgggatcgaaatttggggaaaggaggctcca-
Q6P7C5_BAD-01          cattttcctgtc----------------------------------cca-

Q5U777_PMAIP1-01       ------------------ctga
O88498_BCL2L11-01      ----------------cactga
O88498_BCL2L11-02      ----------------cactga
P62817_HRK-01          ----------------------
Q80ZG6_BBC3-01         cccagaaatggagcccaactag
Q925D2_BIK-01          --------tgcagcttcagtga
Q8K589_BMF-01          ggaaggggtgggtccctggtga
O35147_BAD-01          --------ctccctcccagtga
Q6P7C5_BAD-01          --------tgtcccc----tga

© 1998-2021Legal notice