Dataset for CDS classical BH3-containing proteins of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q5U777_PMAIP1-01       atgcc---------------------------------------------
P62817_HRK-01          atgt----------------------------------------------
Q80ZG6_BBC3-01         atggcccgcgcacgcca-----ggagggcagctctc-----cggagcccg
O88498_BCL2L11-01      atg-------------------gccaagcaaccttctgatgtaaattctg
Q925D2_BIK-01          atgtcagaggcgagactaatggccagagacattatc---aa-gactcttc
Q8K589_BMF-01          atg--------gagcca-----cctcagtg------------------tg
O35147_BAD-01          atg--------ggaacc-----ccaaagcagccctc---gctggctcctg
Q6P7C5_BAD-01          atg--------ggaacc-----ccaaagcagccctc---gctggctcctg
                       ***                                               

Q5U777_PMAIP1-01       --------------------------------------------------
P62817_HRK-01          ---------------------gcccgtgtccccggcatcgcggccgc---
Q80ZG6_BBC3-01         tagagggcctagcccgcgacagcccgcgtcctttcccgctcggccgcctg
O88498_BCL2L11-01      agtgtgacagagaaggtgga-----caattgcagcctg------------
Q925D2_BIK-01          tacacgacc---------ag-----gtcccccaacctgcagtggtctctg
Q8K589_BMF-01          tggaggaactagaagatgat-----gtgttccagccag----aggatggg
O35147_BAD-01          cacacgccctaggct-tgag-----gaagtccgatccc----ggaatccg
Q6P7C5_BAD-01          cacacgccctaggct-tgag-----gaagtccgatccc----ggaatccg
                                                                         

Q5U777_PMAIP1-01       ----------cgggagaaaggcgcgtcggaa-----------cgcgccat
P62817_HRK-01          gggcccccggccgtg---tgcggttgcggcga--------cgctcgc--c
Q80ZG6_BBC3-01         atgccctccgctgtatcctgcggcctctgcgagcccggcctgcccgctgc
O88498_BCL2L11-01      ------------------------ctgagag--------------gcctc
Q925D2_BIK-01          gggctcccagcatga---aggagcctgtggg-------------------
Q8K589_BMF-01          gagcc-----aggga---cacagcctgggagcttgctctctgctgacctg
O35147_BAD-01          gagcc-----tgggg---agcgacgcgggag----------gaaggc---
Q6P7C5_BAD-01          gagcc-----tgggg---agcgacgcgggag----------gaaggc---
                                                   *                     

Q5U777_PMAIP1-01       tgaacccaa---------------cgcgggcagagttaccgcctgaattc
P62817_HRK-01          ccgggctgc------------gctgggcggcgg------cgcaggtgacc
Q80ZG6_BBC3-01         ccctgctgcccctgccttgctgccggccgccta------cctctgcgccc
O88498_BCL2L11-01      cccagctca---------------ggcctgggg-------cccctacctc
Q925D2_BIK-01          ---ggttga---------------ggacgtcag-------tcctgtgaga
Q8K589_BMF-01          tttgcccag---------------agccagctggattgtcccctcagtcg
O35147_BAD-01          ---ggtgga---------------gaccagcag-------cccagagtat
Q6P7C5_BAD-01          ---ggtgga---------------gaccagcag-------cccagagtat
                                                                         

Q5U777_PMAIP1-01       gc------------------------------------agctcagctcag
P62817_HRK-01          gcgctg---cggctgcag--------gcgctgggcgacgagctgcaccga
Q80ZG6_BBC3-01         ccaccgccccgcctgccgtcaccgccgccctggggggc------ccccgc
O88498_BCL2L11-01      cctacagaca--------------------gaatcgcaaggtaatcccga
Q925D2_BIK-01          gacttggatt-----------------------tcatgaggt---gcctg
Q8K589_BMF-01          gcttcagctcttcccgcttacccactgctgtggtcctgggctccggcctg
O35147_BAD-01          gttccagatc------------------------ccagagtttgagccga
Q6P7C5_BAD-01          gttccagatc------------------------ccagagtttgagccga
                                                                      *  

Q5U777_PMAIP1-01       gaagattggagataaagtgtactgcacgtggagtgcaccggacataactg
P62817_HRK-01          cgcgccatgagg-------cgtcgcgcgc--ggccccgggacc-------
Q80ZG6_BBC3-01         tggcctgggggt-------caccgcagcc--ggccccgaggcc-------
O88498_BCL2L11-01      cggcgaaggggaccgctgcccccacggc---agccctcagggcccgctgg
Q925D2_BIK-01          gagagcagaaac------------caggt--ggccctgaggct-agcctg
Q8K589_BMF-01          taagccaggaagacaaggccacc-cagac-----cctcagccc-agcct-
O35147_BAD-01          gtgagcaggaagacgctagtactacagataggggcctgggccctagcct-
Q6P7C5_BAD-01          gtgagcaggaagacgctagtactacagataggggcctgggccctagcct-
                                               *          *   *          

Q5U777_PMAIP1-01       cggttctggc--------------------gcagatgcctggc-------
P62817_HRK-01          cgct------------------------------gcccgcgct-------
Q80ZG6_BBC3-01         cgcgcccggacggtc---------------ctcagccctcgctgtcacca
O88498_BCL2L11-01      ccccaccggccagccctggtccttttgctaccagatccccacttttcatc
Q925D2_BIK-01          catcggcgatgag-----------------atggaccggtgtctt-----
Q8K589_BMF-01          ccc------caag-----------------ccagggtgtcatgctgcctt
O35147_BAD-01          cactgaggaccag-----------------ccaggtccctacctggcccc
Q6P7C5_BAD-01          cactgaggaccag-----------------ccaggtccctacctggcccc
                       *                                                 

Q5U777_PMAIP1-01       ---------------------------aagaagtcgcgaaag--------
P62817_HRK-01          ------------------------------gctgcccgc-----------
Q80ZG6_BBC3-01         gcccagcagcacct-------------agagtcgcccgt-----------
O88498_BCL2L11-01      tttgtgagaagatcttctctgctgtcccggtcctccagtgggtatttctc
Q925D2_BIK-01          ---------------------------cggagcccccg----tctg----
Q8K589_BMF-01          gtggggtgacag---------------aggaaccccagagactctt----
O35147_BAD-01          ---------------------------aggtctcctggggagcatc----
Q6P7C5_BAD-01          ---------------------------aggtctcctggggagcatc----
                                                         *  *            

Q5U777_PMAIP1-01       ---------------------agcac---------gatgagaagaagccc
P62817_HRK-01          -----------------gctccgcg-cccgctggccctggc---------
Q80ZG6_BBC3-01         -----------------gcccagcgccccggaggccctggcgggaggccc
O88498_BCL2L11-01      ttttgacacagacaggagcccggcacccatg----agttgtgacaagtca
Q925D2_BIK-01          -----------------gtccagctgcctgggattgctatgcacagactt
Q8K589_BMF-01          -----------------ttacggcaac--------gctggctacaggctt
O35147_BAD-01          -----------------gttcagcagc--------agccgggacaggcag
Q6P7C5_BAD-01          -----------------gttcagcagc--------agccgggacaggcag
                                             **                          

Q5U777_PMAIP1-01       aagcccaacccgggtgccagcagacctga--agga---------------
P62817_HRK-01          --------------------tgtgcgcggccgcgc---------------
Q80ZG6_BBC3-01         cacccaagctgccccgggagtgcgtgtggaggagg---------------
O88498_BCL2L11-01      acacaaaccccaagtcc------tccttgccaggc---------------
Q925D2_BIK-01          gctgccacctacagccagacgggtgtcag--aggt---------------
Q8K589_BMF-01          cctctccctgccagttt------ccccgc--aggc---------------
O35147_BAD-01          c----caataacagtca------tcatgg--aggcgctgggactatggag
Q6P7C5_BAD-01          c----caataacagtca------tcatgg--aggt---------------
                                                        *                

Q5U777_PMAIP1-01       --------------------------------------------------
P62817_HRK-01          --------------------------------------------------
Q80ZG6_BBC3-01         --------------------------------------------------
O88498_BCL2L11-01      ------------------------------------------cttcaacc
Q925D2_BIK-01          --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
O35147_BAD-01          acccggagtcgccacagttcgtacccagcggggactgaggaagatgaagg
Q6P7C5_BAD-01          --------------------------------------------------
                                                                         

Q5U777_PMAIP1-01       -------------------------cgagtgtgatc--------------
P62817_HRK-01          ------------------------aggtggcggcgctggc------ggcc
Q80ZG6_BBC3-01         ------------------------aggagtgggcccgggagatcggggcc
O88498_BCL2L11-01      attatctcagtgcaatggcttccataaggcagtctcagga---ggaacct
Q925D2_BIK-01          ------------------attttcagaag------cttgattggaagcct
Q8K589_BMF-01          --------------tcagcccttggggagcagccccctgaaggacagttc
O35147_BAD-01          gatggaggaggagcttagcccttttcgaggacgctcgcgctcggc-tccc
Q6P7C5_BAD-01          --------------------------------------------------
                                                                         

Q5U777_PMAIP1-01       ----------------------------------aactgcggagaattgg
P62817_HRK-01          t---------------------------------ggctgct-----cggc
Q80ZG6_BBC3-01         c---------------------------------agctgcggaggatggc
O88498_BCL2L11-01      gaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcgg
Q925D2_BIK-01          caccaacctcagggaaaatatc----------------------------
Q8K589_BMF-01          cttcagcaccgagcagaggtacagatcgccagaaagcttcagtgcattgc
O35147_BAD-01          cccaatctctgggcagcgcagcgctatggccgtgagctccgaagaatgag
Q6P7C5_BAD-01          --------------------------------------------------
                                                                         

Q5U777_PMAIP1-01       agacaaagt---gaatttacggcagaaacttc------------------
P62817_HRK-01          aggc----------------------gg----agcgcgtag---------
Q80ZG6_BBC3-01         ggac----------------------gacctcaacgcgcagtacgagcgg
O88498_BCL2L11-01      agac--------gagttcaat---gagacttacacgaggagggcgtttgc
Q925D2_BIK-01          ------------tggtcc--tggagagtcttcactcctggcgcctgggtg
Q8K589_BMF-01          agac--------cagttccatcg----gcttcata----------tgcaa
O35147_BAD-01          cgatgaatttgagggttccttcaagggacttcctcgcccaaagagcgcag
Q6P7C5_BAD-01          ------------aggttcctc------acttccat---------------
                                                                         

Q5U777_PMAIP1-01       --------------------------------------------------
P62817_HRK-01          --------------------------------------------------
Q80ZG6_BBC3-01         cggagacaagaagagcaacatcgacaccgac------------cctcgcc
O88498_BCL2L11-01      aaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaac
Q925D2_BIK-01          tcacctgaccaggacc----ctgggcagctg------------tttccca
Q8K589_BMF-01          caacaccagcagaaccgagaccgagca-----------------t-----
O35147_BAD-01          gcactgcaacacagatgcgacaaagcgccag------------tt-----
Q6P7C5_BAD-01          --------------------------------------------------
                                                                         

Q5U777_PMAIP1-01       --------tgaattttatttcc-------aagctcttcaatttaataac-
P62817_HRK-01          --------------------------------------------------
Q80ZG6_BBC3-01         ctggagggtcatgtataatctcttcatgggactcctccccttacccaggg
O88498_BCL2L11-01      tgttacgattcatcttcc--------------gtctggtctggagaagg-
Q925D2_BIK-01          tggtgctgctggtcttcttgctgctgggtggggcctggcatt--------
Q8K589_BMF-01          ---ggcggcaggtcttcctcttcct--tcaaaacctggccttgaacagac
O35147_BAD-01          ---ggacgcgcattatccagtcctg--gtgggatcgaaatttggggaaag
Q6P7C5_BAD-01          ----------cattttcctgtc----------------------------
                                                                         

Q5U777_PMAIP1-01       ----------------------------ctga
P62817_HRK-01          --------------------------------
Q80ZG6_BBC3-01         atcctggagccccagaaatggagcccaactag
O88498_BCL2L11-01      --------------------------cactga
Q925D2_BIK-01          ------------------tgcagcttcagtga
Q8K589_BMF-01          gagaaaacagggaaggggtgggtccctggtga
O35147_BAD-01          gaggctcca---------ctccctcccagtga
Q6P7C5_BAD-01          ------cca---------tgtcccc----tga
                                                       

© 1998-2020Legal notice