Dataset for CDS BBC3 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q80ZG6_BBC3-01      ------------------------------------------------atggcccgcgca
Q80ZG6_BBC3-02      atgttggcgtttgtcacccggaggggtgtctgcgctccagggagcgccatggcccgcgca
                                                                    ************

Q80ZG6_BBC3-01      cgccaggagggcagctctccggagcccgtagagggcctagcccgcgacagcccgcgtcct
Q80ZG6_BBC3-02      cgccaggagggcagctctccggagcccgtagagggcctagcccgcgacagcccgcgtcct
                    ************************************************************

Q80ZG6_BBC3-01      ttcccgctcggccgcctgatgccctccgctgtatcctgcggcctctgcgagcccggcctg
Q80ZG6_BBC3-02      ttcccgctcggccgcctgatgccctccgctgtatcctgcggcctctgcgagcccggcctg
                    ************************************************************

Q80ZG6_BBC3-01      cccgctgcccctgctgcccctgccttgctgccggccgcctacctctgcgcccccaccgcc
Q80ZG6_BBC3-02      cccgctgcccctgctgcccctgccttgctgccggccgcctacctctgcgcccccaccgcc
                    ************************************************************

Q80ZG6_BBC3-01      ccgcctgccgtcaccgccgccctggggggcccccgctggcctgggggtcaccgcagccgg
Q80ZG6_BBC3-02      ccgcctgccgtcaccgccgccctggggggcccccgctggcctgggggtcaccgcagccgg
                    ************************************************************

Q80ZG6_BBC3-01      ccccgaggcccgcgcccggacggtcctcagccctcgctgtcaccagcccagcagcaccta
Q80ZG6_BBC3-02      ccccgaggcccgcgcccggacggtcctcagccctcgctgtcaccagcccagcagcaccta
                    ************************************************************

Q80ZG6_BBC3-01      gagtcgcccgtgcccagcgccccggaggccctggcgggaggccccacccaagctgccccg
Q80ZG6_BBC3-02      gagtcgcccgtgcccagcgccccggaggccctggcgggaggccccacccaagctgccccg
                    ************************************************************

Q80ZG6_BBC3-01      ggagtgcgtgtggaggaggaggagtgggcccgggagatcggggcccagctgcggaggatg
Q80ZG6_BBC3-02      ggagtgcgtgtggaggaggaggagtgggcccgggagatcggggcccagctgcggaggatg
                    ************************************************************

Q80ZG6_BBC3-01      gcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaacatcgacaccga
Q80ZG6_BBC3-02      gcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaacatcgacaccga
                    ************************************************************

Q80ZG6_BBC3-01      ccctcgccctggagggtcatgtataatctcttcatgggactcctccccttacccagggat
Q80ZG6_BBC3-02      ccctcgccctggagggtcatgtataatctcttcatgggactcctccccttacccagggat
                    ************************************************************

Q80ZG6_BBC3-01      cctggagccccagaaatggagcccaactag
Q80ZG6_BBC3-02      cctggagccccagaaatggagcccaactag
                    ******************************

© 1998-2022Legal notice