Dataset for CDS classical BH3-containing proteins of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4BVX1_BCL2L11      ---atg-----cagaa----------cagtaattactgctgtttt-----
A0A3B4BVX1_BCL2L11      cttctgtccgccagaaaagctcgtttcagtgtttgcccgtgttcttctcc
A0A3B4CNJ8_BMF-01       ---atg-----ga-------------------------------------
A0A3B4CPH6_BAD-01       ---atg-----gctcat--atgttcacattatcggacg------------
A0A3B4DUY7_BAD-01       ---atg-----agcaatcaatatctgcagaaactgaggagagctc-----
                            **                                            

A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      ggaggaccgtatacatcaccttcctcattatctgcggtcaaaccgggccg
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       ----------------------------gttttaattgcgaagaggagcg
                                                                          

A0A3B4BVX1_BCL2L11      --------------------gagcagggggagagtggtcagagcagcgga
A0A3B4BVX1_BCL2L11      gccgcccagccttcttaaaggagcagggggagagtggtcagagcagcgga
A0A3B4CNJ8_BMF-01       ---------------------------tgaagat-------------gaa
A0A3B4CPH6_BAD-01       -------------actcagacac-atctgaagat-------------cta
A0A3B4DUY7_BAD-01       atataagaaagtaattaaaacactgactggagag-------------aaa
                                                    * ***                *

A0A3B4BVX1_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgagcagcctgagcccggcga
A0A3B4BVX1_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgagcagcctgagcccggcga
A0A3B4CNJ8_BMF-01       gatgatgtttttgtgatggatacacaatatt----ggcgttcctcaatca
A0A3B4CPH6_BAD-01       ggagacgc-------------agacca--------gccagaagccagtaa
A0A3B4DUY7_BAD-01       gga-acgccttt--------taacccattgt----gctggaattcattaa
                        *                       *          *        *    *

A0A3B4BVX1_BCL2L11      ggg----------------ggacccggttaggggagggattacaatgcct
A0A3B4BVX1_BCL2L11      ggg----------------ggacccggttaggggagggattacaatgcct
A0A3B4CNJ8_BMF-01       ggg---------------agataaagcaggaggagcgtggcact------
A0A3B4CPH6_BAD-01       gag--------------------------agctgagctgtcaca------
A0A3B4DUY7_BAD-01       gaaccacagcttgcgcaatggaaaagcacagtgaagatggcataa-gtac
                        *                                        *        

A0A3B4BVX1_BCL2L11      aatagccttctgggttaccagtcgcgttcgcctctcttccgaacactatc
A0A3B4BVX1_BCL2L11      aatagccttctgggttaccagtcgcgttcgcctctcttccgaacactatc
A0A3B4CNJ8_BMF-01       --cagactccggggcg-------gccgccagctcggcccaacg-------
A0A3B4CPH6_BAD-01       -------gtctgggca-------gcaccca-cttgttccagag-------
A0A3B4DUY7_BAD-01       catggatgaccaagat-------gaatcca-attggt-cagag-------
                                 *   *         *    *   *     *           

A0A3B4BVX1_BCL2L11      caggtcctcaagcggatacttttcg---tttgagagcgagcccagctctc
A0A3B4BVX1_BCL2L11      caggtcctcaagcggatacttttcg---tttgagagcgagcccagctctc
A0A3B4CNJ8_BMF-01       -gcatgctgccctgtggagtgt------ctgaggagccaagacgcctatt
A0A3B4CPH6_BAD-01       -agattca-----------------------gagagtcaa---g------
A0A3B4DUY7_BAD-01       -acggtcaagaatggtgactctccacagctggacagtcagcaca------
                              *                           **  *           

A0A3B4BVX1_BCL2L11      cgctcctgacct--------------------------ctccttctctgt
A0A3B4BVX1_BCL2L11      cgctcgtgacgcacagc--------gcgtccacgcagacccccagcccgt
A0A3B4CNJ8_BMF-01       ctacggtagcgcaggattgctactactagcaccatctgtccgtcctgaac
A0A3B4CPH6_BAD-01       ----------gcagaggaatcact-ctat-----------------gaat
A0A3B4DUY7_BAD-01       ----------gcatggcaagcaac-atatcaccagcttccccagacgaac
                                                                          

A0A3B4BVX1_BCL2L11      ctg--------------tgtgttccaca----------------------
A0A3B4BVX1_BCL2L11      ctagtcaagtaatcactcacgccctgcagcgcattgctg-----------
A0A3B4CNJ8_BMF-01       acgttgagg----gtgccatg--cttcagga-------------------
A0A3B4CPH6_BAD-01       -----gagg---------atgcccttcaggaatctg--------------
A0A3B4DUY7_BAD-01       tgtcagaggttgggtgtcgtgttcggctgtactctgagtcccaggtgtac
                                            *  *  *                       

A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      ------------------------------aggcgcgagggaacgctcag
A0A3B4CNJ8_BMF-01       ------------------------------ggacc---------------
A0A3B4CPH6_BAD-01       ------------------------------gggctgtgagacatgga-ga
A0A3B4DUY7_BAD-01       acggtcagccgctggcaggacaatgaggatgggcttttagcggaggacgg
                                                                          

A0A3B4BVX1_BCL2L11      ------gaattatggcccctcta-------taaccaccatccgccccacg
A0A3B4BVX1_BCL2L11      actttcgaattatggcccctcta-------taaccaccatccgccccacg
A0A3B4CNJ8_BMF-01       ---agctcgccatggaacctcgg---------------agacggccccca
A0A3B4CPH6_BAD-01       tggagctgcagatggagactctttccgccgtcgctgtcgctcggctcccc
A0A3B4DUY7_BAD-01       tggagcaggggatggagctccattccgaggccgatcccagtcggctcctg
                                   ****     *                    ** * *   

A0A3B4BVX1_BCL2L11      gagcagcgcctgcgggggacatgcgaccggagtcgtacgtggcgcaagag
A0A3B4BVX1_BCL2L11      gagcagcgcctgcgggggacatgcgaccggagtcgtacgtggcgcaagag
A0A3B4CNJ8_BMF-01       c-aca----gtgtggaggccc---------------gtatcggtcagaag
A0A3B4CPH6_BAD-01       ctgct----ctgtgggcagcaaagaa----------atat-ggcagacag
A0A3B4DUY7_BAD-01       ctgca----ctgtggaaagccaagaa----------atat-gggcggcag
                           *      ** **    *                   * *      **

A0A3B4BVX1_BCL2L11      ctgcggcgcatcggcgatgagtttaacgagctttattttc----------
A0A3B4BVX1_BCL2L11      ctgcggcgcatcggcgatgagtttaacgagctttattttc----------
A0A3B4CNJ8_BMF-01       ctccagatgatcggagatcagttctatcaagagcacatgctgcaacacag
A0A3B4CPH6_BAD-01       ctgaggaagatgagtgacgagttcga-------caccttgctggacaaag
A0A3B4DUY7_BAD-01       ctgaggaggatgagtgatgaatttga-------cacctggctggataaag
                        **   *   **  * **  * **  *        *  *            

A0A3B4BVX1_BCL2L11      -----acggggtgagtcagctgcatgggtgcgttgc--tggtatgcaagc
A0A3B4BVX1_BCL2L11      -----acggggtgagtcagctgcatgggtgcgttgc--tggtatgcaagc
A0A3B4CNJ8_BMF-01       aa---accaaaggaacca-----------gcagcccttttggttgcgttt
A0A3B4CPH6_BAD-01       gg---atgaagagagtgaggagtgcaggtgcagccc-gtcagatgcacgc
A0A3B4DUY7_BAD-01       gggacacaagaagagcga-----------gcagccc--tgggaagcagac
                             *      **   *           **    *  *     **    

A0A3B4BVX1_BCL2L11      gtt----gagtgctcgagat--ctgcacgatc----aaatgtttgcttta
A0A3B4BVX1_BCL2L11      gtt----gagtaatcctgttgccttttcaatcctggggctttttcgtgga
A0A3B4CNJ8_BMF-01       ggcatcagcgttgtacacgctcctgtttg---agagagagccggtggcta
A0A3B4CPH6_BAD-01       ttcccccagctggttcaccttcttatggagccacaaagagtcagactctg
A0A3B4DUY7_BAD-01       gaaccgaggatggttctcttttctctggggttccaaagaa---------g
                                  *  *         *                          

A0A3B4BVX1_BCL2L11      ag------------------------------------------ctaa
A0A3B4BVX1_BCL2L11      ca------------------------------------------ctga
A0A3B4CNJ8_BMF-01       atgggaggag----------------------agtggaccagaggtga
A0A3B4CPH6_BAD-01       aggccagcagcagtctaacagctccagacacccgtccggcaga-gtga
A0A3B4DUY7_BAD-01       aagaaggaag------------------------------aga-ataa
                                                                     * *

© 1998-2020Legal notice