Dataset for CDS BCL2L11 of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4BVX1_BCL2L11      ---atg-----cagaa----------cagtaattactgctgtttt-----
A0A3B4BVX1_BCL2L11      cttctgtccgccagaaaagctcgtttcagtgtttgcccgtgttcttctcc
                            **     *****          ****  ** *   **** *     

A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      ggaggaccgtatacatcaccttcctcattatctgcggtcaaaccgggccg
                                                                          

A0A3B4BVX1_BCL2L11      --------------------gagcagggggagagtggtcagagcagcgga
A0A3B4BVX1_BCL2L11      gccgcccagccttcttaaaggagcagggggagagtggtcagagcagcgga
                                            ******************************

A0A3B4BVX1_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgagcagcctgagcccggcga
A0A3B4BVX1_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgagcagcctgagcccggcga
                        **************************************************

A0A3B4BVX1_BCL2L11      gggggacccggttaggggagggattacaatgcctaatagccttctgggtt
A0A3B4BVX1_BCL2L11      gggggacccggttaggggagggattacaatgcctaatagccttctgggtt
                        **************************************************

A0A3B4BVX1_BCL2L11      accagtcgcgttcgcctctcttccgaacactatccaggtcctcaagcgga
A0A3B4BVX1_BCL2L11      accagtcgcgttcgcctctcttccgaacactatccaggtcctcaagcgga
                        **************************************************

A0A3B4BVX1_BCL2L11      tacttttcgtttgagagcgagcccagctctccgctcctgacct-------
A0A3B4BVX1_BCL2L11      tacttttcgtttgagagcgagcccagctctccgctcgtgacgcacagcgc
                        ************************************ ****         

A0A3B4BVX1_BCL2L11      -----------ctccttctctgtctg--------------tgtgttccac
A0A3B4BVX1_BCL2L11      gtccacgcagacccccagcccgtctagtcaagtaatcactcacgccctgc
                                   * **    * ****                  *  *  *

A0A3B4BVX1_BCL2L11      a-------------------------------------gaattatggccc
A0A3B4BVX1_BCL2L11      agcgcattgctgaggcgcgagggaacgctcagactttcgaattatggccc
                        *                                     ************

A0A3B4BVX1_BCL2L11      ctctataaccaccatccgccccacggagcagcgcctgcgggggacatgcg
A0A3B4BVX1_BCL2L11      ctctataaccaccatccgccccacggagcagcgcctgcgggggacatgcg
                        **************************************************

A0A3B4BVX1_BCL2L11      accggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagttta
A0A3B4BVX1_BCL2L11      accggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagttta
                        **************************************************

A0A3B4BVX1_BCL2L11      acgagctttattttcacggggtgagtcagctgcatgggtgcgttgctggt
A0A3B4BVX1_BCL2L11      acgagctttattttcacggggtgagtcagctgcatgggtgcgttgctggt
                        **************************************************

A0A3B4BVX1_BCL2L11      atgcaagcgttgagtgctcgagat--ctgcacgatc----aaatgtttgc
A0A3B4BVX1_BCL2L11      atgcaagcgttgagtaatcctgttgccttttcaatcctggggctttttcg
                        ***************  **  * *  **   * ***       * ***  

A0A3B4BVX1_BCL2L11      tttaagctaa
A0A3B4BVX1_BCL2L11      tggacactga
                        *  *  ** *

© 1998-2020Legal notice