Dataset for CDS BCL2L11 of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4BSH7_BCL2L11      --------------------------------------------------
A0A3B4BSH7_BCL2L11      ---atgtcca----------------------------------------
A0A3B4BSH7_BCL2L11      cttctgtccgccagaaaagctcgtttcagtgtttgcccgtgttcttctcc

A0A3B4BSH7_BCL2L11      ---------------------------------------atgcagaacag
A0A3B4BSH7_BCL2L11      --------------------------------ggcggtcaaaccgggccg
A0A3B4BSH7_BCL2L11      ggaggaccgtatacatcaccttcctcattatctgcggtcaaaccgggccg
                                                               *  * *  * *

A0A3B4BSH7_BCL2L11      taattactgctgtttt----gagcagggggagagtggtcagagcagcgga
A0A3B4BSH7_BCL2L11      gccgcccagccttcttaaaggagcagggggagagtggtcagagcagcgga
A0A3B4BSH7_BCL2L11      gccgcccagccttcttaaaggagcagggggagagtggtcagagcagcgga
                              * **  * **    ******************************

A0A3B4BSH7_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgagcagcctgagcccggcga
A0A3B4BSH7_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgagcagcctgagcccggcga
A0A3B4BSH7_BCL2L11      gcagcctcctcccgggccgccgagcagtgcgagcagcctgagcccggcga

A0A3B4BSH7_BCL2L11      gggggacccggttaggggagggattacaatgcctaatagccttctgggtt
A0A3B4BSH7_BCL2L11      gggggacccggttaggggagggattacaatgcctaatagccttctgggtt
A0A3B4BSH7_BCL2L11      gggggacccggttaggggagggattacaatgcctaatagccttctgggtt

A0A3B4BSH7_BCL2L11      accagtcgcgttcgcctctcttccgaacactatccaggtcctcaagcgga
A0A3B4BSH7_BCL2L11      accagtcgcgttcgcctctcttccgaacactatccaggtcctcaagcgga
A0A3B4BSH7_BCL2L11      accagtcgcgttcgcctctcttccgaacactatccaggtcctcaagcgga

A0A3B4BSH7_BCL2L11      tacttttcgtttgagagcgagcccagctctccgctcctgacct-------
A0A3B4BSH7_BCL2L11      tacttttcgtttgagagcgagcccagctctccgctcgtgacgcacagcgc
A0A3B4BSH7_BCL2L11      tacttttcgtttgagagcgagcccagctctccgctcgtgacgcacagcgc
                        ************************************ ****         

A0A3B4BSH7_BCL2L11      -----------ctccttctctgtctg--------------tgtgttccac
A0A3B4BSH7_BCL2L11      gtccacgcagacccccagcccgtctagtcaagtaatcactcacgccctgc
A0A3B4BSH7_BCL2L11      gtccacgcagacccccagcccgtctagtcaagtaatcactcacgccctgc
                                   * **    * ****                  *  *  *

A0A3B4BSH7_BCL2L11      a-------------------------------------gaattatggccc
A0A3B4BSH7_BCL2L11      agcgcattgctgaggcgcgagggaacgctcagactttcgaattatggccc
A0A3B4BSH7_BCL2L11      agcgcattgctgaggcgcgagggaacgctcagactttcgaattatggccc
                        *                                     ************

A0A3B4BSH7_BCL2L11      ctctataaccaccatccgccccacggagcagcgcctgcgggggacatgcg
A0A3B4BSH7_BCL2L11      ctctataaccaccatccgccccacggagcagcgcctgcgggggacatgcg
A0A3B4BSH7_BCL2L11      ctctataaccaccatccgccccacggagcagcgcctgcgggggacatgcg

A0A3B4BSH7_BCL2L11      accggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagttta
A0A3B4BSH7_BCL2L11      accggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagttta
A0A3B4BSH7_BCL2L11      accggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagttta

A0A3B4BSH7_BCL2L11      acgagctttattttcacggggtgagtcagctgcatgggtgcgttgctggt
A0A3B4BSH7_BCL2L11      acgagctttattttcacggggc-aggcag--aaatggaggcagagtccag
A0A3B4BSH7_BCL2L11      acgagctttattttcacggggtgagtcagctgcatgggtgcgttgctggt
                        *********************  ** ***    ****  **   *     

A0A3B4BSH7_BCL2L11      atgcaagcgttgagtg--------------------ctcgagatctgcac
A0A3B4BSH7_BCL2L11      ctgccggcggaggaggaacctgccttcatgctgtggctggggctcg---t
A0A3B4BSH7_BCL2L11      atgcaagcgttgagtaatcctgttgccttttcaatcctggggcttt---t
                         ***  ***  *                        ** * * *      

A0A3B4BSH7_BCL2L11      gatcaaatgtttgctttaagc----------------taa
A0A3B4BSH7_BCL2L11      gatcagacgcctattagaggtcctcctaagacgaagatga
A0A3B4BSH7_BCL2L11      tcgtggacac---------------------------tga
                              *                              * *

© 1998-2021Legal notice