Dataset for CDS classical BH3-containing proteins of organism Pseudonaja textilis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A670YRG7_BAD-01       --------------------ttagaa------------------------
A0A670Y3D3_BCL2L11      atg-----------------gcaaaacaatcttctgatttaaattctgag
A0A670XMZ5_BMF-01       atggatcctcctgtttacttggaagatgatttttcccatt--------tg
A0A670ZS96_PMAIP1-      agg-----------------ggagga------------------------
                                              *  *                        

A0A670YRG7_BAD-01       ------------------------------------------ctgagacg
A0A670Y3D3_BCL2L11      tgtgagagagaaggtggacaattgcagcctg-----------ctgaaagg
A0A670XMZ5_BMF-01       gatgggttagatgatgatgtattccactctgacgactgtgaactggtcag
A0A670ZS96_PMAIP1-      --------------------------------------------------
                                                                          

A0A670YRG7_BAD-01       ccgcattgg------------------------------gtcggaccaac
A0A670Y3D3_BCL2L11      ccagctcagcctcatcaccttcggcctggggcccctacctccttacaaac
A0A670XMZ5_BMF-01       tcagtccagcaagatggcctttcgtgg--------cattttcactcaaag
A0A670ZS96_PMAIP1-      --------------------------------------------------
                                                                          

A0A670YRG7_BAD-01       tcgattcggagacctccgatgaggtgggggcttt----------------
A0A670Y3D3_BCL2L11      tgaatatcaaggtaatcatttgggtgaacgggacagttcatcacccggta
A0A670XMZ5_BMF-01       caaatcttacaactgcctcctgggc--aggttccagctcttcccacttac
A0A670ZS96_PMAIP1-      --------------------------------------------------
                                                                          

A0A670YRG7_BAD-01       ---------------------ccgggcccgctcacgct------------
A0A670Y3D3_BCL2L11      gccct----------------cagggaccactggcacc----------ac
A0A670XMZ5_BMF-01       gcactgttgtggcccaggcagcaggcatgccaaacaacaggacaaggcaa
A0A670ZS96_PMAIP1-      ---------------------aaggagagacaaagaac------------
                                               **     *                   

A0A670YRG7_BAD-01       ---------------ctgcccctcccat----------------tttgtg
A0A670Y3D3_BCL2L11      cctccagtcccagtccatttgcaaccagatccccgttgttcatgtttgta
A0A670XMZ5_BMF-01       cacagacccttaatgcatcctcttccag---ccaggatatcatgttacct
A0A670ZS96_PMAIP1-      -------------tgcagcttc----------------------------
                                       *     *                            

A0A670YRG7_BAD-01       ggccgcgcaacgatacggccgagaattacgcagg----------------
A0A670Y3D3_BCL2L11      agaagatccccactgctgtccagatcctccagtgggtatttctcttttga
A0A670XMZ5_BMF-01       tgtggag--tcactg-----aagagcctcagaga-------ctctttt--
A0A670ZS96_PMAIP1-      ----------cactg-----aagagt-------g-------ctctgtc--
                                  *  *       ***                          

A0A670YRG7_BAD-01       -----atg--agcgatg----------------------------aattt
A0A670Y3D3_BCL2L11      catcgacaggagtcctgcacctatgaattgtgacaaagcaacacagactc
A0A670XMZ5_BMF-01       -----atggaaatgctg----------------------gataccgttta
A0A670ZS96_PMAIP1-      -----atgatagctttg---------------------------------
                             *    *    **                                 

A0A670YRG7_BAD-01       cacggcctgccg------cgcccgaaaagcgccg----ggacctgctccc
A0A670Y3D3_BCL2L11      caagtcctccgtgtcaagctatcaatcattatctaagtgcaatggcttcc
A0A670XMZ5_BMF-01       catgtc------------caaccaatcggtttcacattgaa------tcc
A0A670ZS96_PMAIP1-      ------------------cagctacgcag-----aattgga------gac
                                          *                   * *        *

A0A670YRG7_BAD-01       acat---------ggaccgccctcctcccagctggaaagacaccctgcgg
A0A670Y3D3_BCL2L11      agat-------ggcagtcacggccaatacctgaggatatgcagccagaaa
A0A670XMZ5_BMF-01       acatctccaggaggaacctcaggaaagtctgcaggaattgcgtaccgaag
A0A670ZS96_PMAIP1-      aaat--------ggaatctccggca-------aagaatc-----ctgaac
                        * **             * *              **        * *   

A0A670YRG7_BAD-01       tcgtggtggctttactccggatctgacattatggcactgtccagattttc
A0A670Y3D3_BCL2L11      tatggattgc-----------acaggaattacggcgtattggagatgaat
A0A670XMZ5_BMF-01       ttcagattgc-----------acggaagttacagtgcattgcagatcagt
A0A670ZS96_PMAIP1-      ctc----------------------------------------------t
                                                                          

A0A670YRG7_BAD-01       accctctgctcctt-caaccc-----------------------------
A0A670Y3D3_BCL2L11      tt--aatgcttcctactgtccaagaaggggtttattggattac----cag
A0A670XMZ5_BMF-01       tccacaggcttcat-ctgcagaggcaccagcagaacagaaatcaggtctg
A0A670ZS96_PMAIP1-      tctccaagc-tctt-ctgcccagg--------------------------
                               **  * * *                                  

A0A670YRG7_BAD-01       ------------------------taaattaa------------------
A0A670Y3D3_BCL2L11      ggagtaaatcaccagat-----cataattttgcgccttttgcattatatc
A0A670XMZ5_BMF-01       gtggcagatcctcctcttcctccataacttggccttgaacgtggaagcca
A0A670ZS96_PMAIP1-      -------------------------aacttga------------------
                                                 ** **                    

A0A670YRG7_BAD-01       ---------------------------
A0A670Y3D3_BCL2L11      gtccgcttcatatggagaatgcagtga
A0A670XMZ5_BMF-01       atagacagcgtgtgggtca-gaggtga
A0A670ZS96_PMAIP1-      ---------------------------
                                                   

© 1998-2020Legal notice