Dataset for CDS classical BH3-containing proteins of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6EM90_PMAIP1-      atg-----------------------------------------------
A0A2K6GE22_BCL2L11      atggcaaagcaacct---tccgatgtaggttctgagtgtg----------
A0A2K6GE22_BCL2L11      atggcaaagcaacct---tccgatgtaggttctgagtgtg----------
A0A2K6GE22_BCL2L11      atggcaaagcaacct---tccgatgtaggttctgagtgtg----------
A0A2K6GE22_BCL2L11      atggcaaagcaacct---tccgatgtaggttctgagtgtg----------
A0A2K6GE22_BCL2L11      atggcaaagcaacct---tccgatgtaggttctgagtgtg----------
A0A2K6GE22_BCL2L11      atggcaaagcaacct---tccgatgtaggttctgagtgtg----------
A0A2K6FFN3_BMF-01       atg---gagccatcccactgtgtggaggagctggaggatgatgtgttcca
A0A2K6FFN3_BMF-02       atg---gagccatcccactgtgtggaggagctggaggatgatgtgttcca
A0A2K6GWV0_BAD-01       atgttccagatcccagagtttgagccaag---tgagcagg-aagactcca
A0A2K6FM79_BIK-01       atg---------------tctgaggtgagacccgtctcca-cggacctcc
A0A2K6GL98_HRK-01       atg-----------------------------tgcccgtg-c---cccct
A0A2K6FQZ1_BBC3-04      atg------------aaatttggtgcggggtctgcccggg-catgtccct
A0A2K6FQZ1_BBC3-01      atg------------------------------gcccgcg-cacgcc---
A0A2K6FQZ1_BBC3-02      atg------------aaatttggtgcggggtctgcccggg-catgtccct
A0A2K6FQZ1_BBC3-03      atg------------aaatttggtgcggggtctgcccggg-catgtccct

A0A2K6EM90_PMAIP1-      ---------------cccgtgaagaaggcgcgtaagaac-----------
A0A2K6GE22_BCL2L11      ---------------accgagaaggtggacagttgcaatctgtggagaga
A0A2K6GE22_BCL2L11      ---------------accgagaaggtggacagttgcaatctgtggagaga
A0A2K6GE22_BCL2L11      ---------------accgagaaggtggacagttgcaatctgtggagaga
A0A2K6GE22_BCL2L11      ---------------accgagaaggtggacagttgcaatctgtggagaga
A0A2K6GE22_BCL2L11      ---------------accgagaaggtggacagttgcaatctgtggagaga
A0A2K6GE22_BCL2L11      ---------------accgagaaggtggacagttgcaatctgtggagaga
A0A2K6FFN3_BMF-01       gccagaggatggggagtcggggacccagcccgggagcg---------tgc
A0A2K6FFN3_BMF-02       gccagaggatggggagtcggggacccagcccgggagcg---------tgc
A0A2K6GWV0_BAD-01       gctctgcaggtaggggcctgggccccagcccctcaggggacc-----ggc
A0A2K6FM79_BIK-01       tcatg-------------gagacctt--cccgttcgagcatctcctggac
A0A2K6GL98_HRK-01       gcaccgc-------ggccgcggcccc--cc-----------------ggc
A0A2K6FQZ1_BBC3-04      gccaggt-------gcccgggacttc--cttctcatggtgggtcctgggc
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      gccaggt-------gcccgggacttc--cttctcatggtgggtcctgggc
A0A2K6FQZ1_BBC3-03      gccaggt-------gcccgggacttc--cttctcatggtgggtcctgggc

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      cctccc--------------------------------------------
A0A2K6GE22_BCL2L11      cctccc--------------------------------------------
A0A2K6GE22_BCL2L11      cctccc--------------------------------------------
A0A2K6GE22_BCL2L11      cctccc--------------------------------------------
A0A2K6GE22_BCL2L11      cctccc--------------------------------------------
A0A2K6GE22_BCL2L11      cctccc--------------------------------------------
A0A2K6FFN3_BMF-01       tctctg--------------------------------------------
A0A2K6FFN3_BMF-02       tctctg--------------------------------------------
A0A2K6GWV0_BAD-01       cctcag--------------------------------------------
A0A2K6FM79_BIK-01       cctctg--------------------------------------------
A0A2K6GL98_HRK-01       cgtgtg--------------------------------------------
A0A2K6FQZ1_BBC3-04      catattcct-----------------------------------------
A0A2K6FQZ1_BBC3-01      -----------------------------------------aggagggca
A0A2K6FQZ1_BBC3-02      catattcctggccccagggagcgccatggcccgcgcacgccaggagggca
A0A2K6FQZ1_BBC3-03      catattcct-----------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      gctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttc
A0A2K6FQZ1_BBC3-02      gctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      ccgctcggccgcctggtgccctcggccgtgtcctgcggcctctgcgagcc
A0A2K6FQZ1_BBC3-02      ccgctcggccgcctggtgccctcggccgtgtcctgcggcctctgcgagcc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cggcctgcccgctgcccccgccgcccccgccctgctacccgctgcctacc
A0A2K6FQZ1_BBC3-02      cggcctgcccgctgcccccgccgcccccgccctgctacccgctgcctacc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      tctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccc
A0A2K6FQZ1_BBC3-02      tctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------ctgacctgtttg
A0A2K6FFN3_BMF-02       --------------------------------------ctgacctgtttg
A0A2K6GWV0_BAD-01       --------------------------gccccggcaagcatccctgcacgg
A0A2K6FM79_BIK-01       ----------------------------------------atcctggagg
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      ------------------------------------------------gg
A0A2K6FQZ1_BBC3-01      cgctggcctgggggtccccgcagccgaccccgaggcccgcgcccggacgg
A0A2K6FQZ1_BBC3-02      cgctggcctgggggtccccgcagccgaccccgaggcccgcgcccggacgg
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      -------------------------------gcgcaa-------------
A0A2K6GE22_BCL2L11      -----------------------------cagctcag---gcctggggcc
A0A2K6GE22_BCL2L11      -----------------------------cagctcag---gcctggggcc
A0A2K6GE22_BCL2L11      -----------------------------cagctcag---gcctggggcc
A0A2K6GE22_BCL2L11      -----------------------------cagctcag---gcctggggcc
A0A2K6GE22_BCL2L11      -----------------------------cagctcag---gcctggggcc
A0A2K6GE22_BCL2L11      -----------------------------cagctcag---gcctggggcc
A0A2K6FFN3_BMF-01       cccagagccagctggactgccccctcagccggcttca---gctcttccct
A0A2K6FFN3_BMF-02       cccagagccagctggactgccccctcagccggcttca---gctcttccct
A0A2K6GWV0_BAD-01       ctccaagcttcctgggggacgccagtcaccagcaggggcagcccagcagc
A0A2K6FM79_BIK-01       ttctcagc-------------atcatggacaacgagg-------agaatc
A0A2K6GL98_HRK-01       -----------------------cgcctgcagcgcgggtcgcctgggtct
A0A2K6FQZ1_BBC3-04      tcctcagccatc------actctcgctggcagagcag--cacctggagt-
A0A2K6FQZ1_BBC3-01      tcctcagccatc------actctcgctggcagagcag--cacctggagt-
A0A2K6FQZ1_BBC3-02      tcctcagccatc------actctcgctggcagagcag--cacctggagt-
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      cctacc-----------------------------------tccctacag
A0A2K6GE22_BCL2L11      cctacc-----------------------------------tccctacag
A0A2K6GE22_BCL2L11      cctacc-----------------------------------tccctacag
A0A2K6GE22_BCL2L11      cctacc-----------------------------------tccctacag
A0A2K6GE22_BCL2L11      cctacc-----------------------------------tccctacag
A0A2K6GE22_BCL2L11      cctacc-----------------------------------tccctacag
A0A2K6FFN3_BMF-01       ctcacccactgctgtggccctgggcttc------------gacccaccag
A0A2K6FFN3_BMF-02       ctcacccactgctgtggccctgggcttc------------gacccaccag
A0A2K6GWV0_BAD-01       agcagccaccatggaggagctgggtctgtggagacccggagtcgccacag
A0A2K6FM79_BIK-01       ccgacccctcggggtgcctcgaggacagtgacga---ggtggccctgcgg
A0A2K6GL98_HRK-01       gcgctcgtccgccgcgc---------------------agctcacagccg
A0A2K6FQZ1_BBC3-04      -cgcccgtccccagcgccccgggggccctggcgg---gcggtcccaccca
A0A2K6FQZ1_BBC3-01      -cgcccgtccccagcgccccgggggccctggcgg---gcggtcccaccca
A0A2K6FQZ1_BBC3-02      -cgcccgtccccagcgccccgggggccctggcgg---gcggtcccaccca
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      -ccgagcccgacgcggactcgggcagagatcgaagaggag----------
A0A2K6GE22_BCL2L11      acagagccccaag-------------------------------------
A0A2K6GE22_BCL2L11      acagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggaccg
A0A2K6GE22_BCL2L11      acagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggaccg
A0A2K6GE22_BCL2L11      acagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggaccg
A0A2K6GE22_BCL2L11      acagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggaccg
A0A2K6GE22_BCL2L11      acagagcccca---------------------------------------
A0A2K6FFN3_BMF-01       ccag------------------------------gaagacaaggccacc-
A0A2K6FFN3_BMF-02       ccag------------------------------gaagacaaggccacc-
A0A2K6GWV0_BAD-01       ctcgtaccccgcggggacagaagaggatgaagggatggaggaagagccc-
A0A2K6FM79_BIK-01       ctag---cct----gcattggggatga------gatggacctgtgtctc-
A0A2K6GL98_HRK-01       cccg---gctcaaggcgc--------------------------------
A0A2K6FQZ1_BBC3-04      ggcg---gccccgggagtccgggggga------ggaggagcagtgggcc-
A0A2K6FQZ1_BBC3-01      ggcg---gccccgggagtccgggggga------ggaggagcagtgggcc-
A0A2K6FQZ1_BBC3-02      ggcg---gccccgggagtccgggggga------ggaggagcagtgggcc-
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      ctgctcccacggcagccctcagggcccgctggccccaccggccag-ccct
A0A2K6GE22_BCL2L11      ctgctcccacggcagccctcagggcccgctggccccaccggccag-ccct
A0A2K6GE22_BCL2L11      ctgctcccacggcagccctcagggcccgctggccccaccggccag-ccct
A0A2K6GE22_BCL2L11      ctgctcccacggcagccctcagggcccgctggccccaccggccag-ccct
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       -----------cagaccctcagcccagcctccccaagccagggtg-----
A0A2K6FFN3_BMF-02       -----------cagaccctcagcccagcctccccaagccagggtg-----
A0A2K6GWV0_BAD-01       -----------agccccttccgg---ggccgctcacgctcggcgcccccc
A0A2K6FM79_BIK-01       -----------aggagcccccgcctggcctggctgcccgggatga-----
A0A2K6GL98_HRK-01       ------------------tcggc---gacgagctgcacca----------
A0A2K6FQZ1_BBC3-04      -----------cgagagatcggg---gcccagctgcggcggatggcagac
A0A2K6FQZ1_BBC3-01      -----------cgagagatcggg---gcccagctgcggcggatggcagac
A0A2K6FQZ1_BBC3-02      -----------cgagagatcggg---gcccagctgcggcggatggcagac
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      ggcccttttgctaccagatccccgcttttcatctttgtgagaagatcctc
A0A2K6GE22_BCL2L11      ggcccttttgctaccagatccccgcttttcatctttgtgagaagatcctc
A0A2K6GE22_BCL2L11      ggcccttttgctaccagatccccgcttttcatctttgtgagaagatcctc
A0A2K6GE22_BCL2L11      ggcccttttgctaccagatccccgcttttcatctttgtgagaagatcctc
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       -----tcatgctgccttg--------------------------------
A0A2K6FFN3_BMF-02       -----tcatgctgccttg--------------------------------
A0A2K6GWV0_BAD-01       aacctctgggctgcacagcgc-----------------------------
A0A2K6FM79_BIK-01       -----cca---tgcacagcctggggctggcgctgtcctgtgaccagccgg
A0A2K6GL98_HRK-01       ------------gcgcaccatgtgg-------------------------
A0A2K6FQZ1_BBC3-04      gacctcaa---tgcgcagtacgagc-------------------------
A0A2K6FQZ1_BBC3-01      gacctcaa---tgcgcagtacgagc-------------------------
A0A2K6FQZ1_BBC3-02      gacctcaa---tgcgcagtacgagc-------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --tgtgcccttcaactcaggagacttggagacaaact-------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      cctgctgtctcgatc-------ctccagtgggtatttctctttt------
A0A2K6GE22_BCL2L11      cctgctgtctcgatc-------ctccagtgggtatttctctttt------
A0A2K6GE22_BCL2L11      cctgctgtctcgatc-------ctccagtgggtatttctctttt------
A0A2K6GE22_BCL2L11      cctgctgtctcgatc-------ctccagtgggtatttctctttt------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       --tggggtgaccga----ggaaccccagagactcttttatggcaatgctg
A0A2K6FFN3_BMF-02       --tggggtgaccga----ggaaccccagagactcttttatg---------
A0A2K6GWV0_BAD-01       --tatggccgcgagctccggaggatgagcgacgagttcgaggactccttc
A0A2K6FM79_BIK-01       tccgctggggcgtgctcgggagccttagcgacggtttcgccaac------
A0A2K6GL98_HRK-01       --cggcgccgcgcgc---ggagccggaggg----cgcc------------
A0A2K6FQZ1_BBC3-04      --ggcggagacaaga---ggagcagcagagacaccgcccctcac------
A0A2K6FQZ1_BBC3-01      --ggcggagacaaga---ggagcagcagagacaccgcccctcac------
A0A2K6FQZ1_BBC3-02      --ggcggagacaaga---ggagcagcagagacaccgcccctcac------
A0A2K6FQZ1_BBC3-03      ------gagacaaga---ggagcagcagagacaccgcccctcac------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       gctaccggcttcctctccctgccagtttccctgcaggcttgccccttggg
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6GWV0_BAD-01       aagaagggacttcct-----------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       gaacagcccgctgaagggcagtggcaacatcgagcagaggtacagattgc
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      -----------------------------------------------gac
A0A2K6GE22_BCL2L11      -----------------------------------------------gac
A0A2K6GE22_BCL2L11      -----------------------------------------------gac
A0A2K6GE22_BCL2L11      -----------------------------------------------gac
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6FFN3_BMF-01       ccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagc
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------

A0A2K6EM90_PMAIP1-      -------------------------gcatttcc------agcagaaactt
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      acagacaggagcccagcacccatgagttgtgac-aaatcaacacaaaccc
A0A2K6GE22_BCL2L11      acagacaggagcccagcacccatgagttgtgac-aaatcaacacaaaccc
A0A2K6GE22_BCL2L11      acagacaggagcccagcacccatgagttgtgac-aaatcaacacaaaccc
A0A2K6GE22_BCL2L11      acagacaggagcccagcacccatgagttgtgac-aaatcaacacaaaccc
A0A2K6GE22_BCL2L11      --agacaggagcccagcacccatgagttgtgac-aaatcaacacaaaccc
A0A2K6FFN3_BMF-01       aacaccagcagaaccaaaatcgcatgtggtggc----agatc------ct
A0A2K6FFN3_BMF-02       --caccagcagaaccaaaatcgcatgtggtggc----agatc------ct
A0A2K6GWV0_BAD-01       --cgcccgaagagcg-----cgggcacagcgacgcagatacggcagagct
A0A2K6FM79_BIK-01       ----ctcagggagta-----cgtggccaggctc-tggaggtcgctcagcc
A0A2K6GL98_HRK-01       ---------agcgcc-----c-ggcgcg--ctc------accac----ct
A0A2K6FQZ1_BBC3-04      ----cctggagggtc-----c-tgtacaatctc------atcatgggact
A0A2K6FQZ1_BBC3-01      ----cctggagggtc-----c-tgtacaatctc------atcatgggact
A0A2K6FQZ1_BBC3-02      ----cctggagggtc-----c-tgtacaatctc------atcatgggact
A0A2K6FQZ1_BBC3-03      ----cctggagggtc-----c-tgtacaatctc------atcatgggact

A0A2K6EM90_PMAIP1-      ctgaatctgatagccaaactt-----------------------------
A0A2K6GE22_BCL2L11      ---------------------------------------------cttcc
A0A2K6GE22_BCL2L11      caagtcctccttgccaggccttcaaccattatctcagtgcaatggtt---
A0A2K6GE22_BCL2L11      caagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcc
A0A2K6GE22_BCL2L11      caagtcctccttgccaggccttcaaccattatctcagtgcaat-------
A0A2K6GE22_BCL2L11      caagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcc
A0A2K6GE22_BCL2L11      caagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcc
A0A2K6FFN3_BMF-01       cctctt--cctacaca-acct-----------------------------
A0A2K6FFN3_BMF-02       cctctt--cctacaca-acct-----------------------------
A0A2K6GWV0_BAD-01       ccag-----ctggacgcgcgt-----------------------------
A0A2K6FM79_BIK-01       cccggc--cctgggtgtgccc-----------------------------
A0A2K6GL98_HRK-01       actggc--cctggctgtgcgc-----------------------------
A0A2K6FQZ1_BBC3-04      cctgcc--cttacccaggggc-----------------------------
A0A2K6FQZ1_BBC3-01      cctgcc--cttacccaggggc-----------------------------
A0A2K6FQZ1_BBC3-02      cctgcc--cttacccaggggc-----------------------------
A0A2K6FQZ1_BBC3-03      cctgcc--cttacccaggggc-----------------------------

A0A2K6EM90_PMAIP1-      -----------------------------------ttccgctcaggaact
A0A2K6GE22_BCL2L11      atgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggat
A0A2K6GE22_BCL2L11      --------------------------------------agagaaataga-
A0A2K6GE22_BCL2L11      atgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggat
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      atgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggat
A0A2K6GE22_BCL2L11      atgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggat
A0A2K6FFN3_BMF-01       ---------------------------------tgctttgaacggagaag
A0A2K6FFN3_BMF-02       ---------------------------------tgctttgaacggagaag
A0A2K6GWV0_BAD-01       ---------------------------------cattcagtcct---ggt
A0A2K6FM79_BIK-01       --------------------------------------cgccccggcgtg
A0A2K6GL98_HRK-01       --------------------------------------ggccgcgcaggt
A0A2K6FQZ1_BBC3-04      ---------------------------------cacagagcccctgagat
A0A2K6FQZ1_BBC3-01      ---------------------------------cacagagcccctgagat
A0A2K6FQZ1_BBC3-02      ---------------------------------cacagagcccc---gat
A0A2K6FQZ1_BBC3-03      ---------------------------------cacagagcccc---gat

A0A2K6EM90_PMAIP1-      tga-----------------------------------------------
A0A2K6GE22_BCL2L11      cgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaa
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      cgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaa
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      cgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaa
A0A2K6GE22_BCL2L11      cgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaa
A0A2K6FFN3_BMF-01       agaacaggaacgg-------------------------------------
A0A2K6FFN3_BMF-02       agaacaggaacgg-------------------------------------
A0A2K6GWV0_BAD-01       gggatcggaacg--------------------------------------
A0A2K6FM79_BIK-01       ggagcaggtgctgctgctgctgctggtgctgct-----------------
A0A2K6GL98_HRK-01       ggcggc--gctggcggcctg------------------------------
A0A2K6FQZ1_BBC3-04      ggagcccaattag-------------------------------------
A0A2K6FQZ1_BBC3-01      ggagcccaattag-------------------------------------
A0A2K6FQZ1_BBC3-02      ggagcccaattaggtgcctgcacccgcctggtggacgtcggagacttggg
A0A2K6FQZ1_BBC3-03      ggagcccaattaggtgcctgcacccgcctggtggacgtcggagacttggg

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      ggaggctg-----gcaaaa-------------------------------
A0A2K6GE22_BCL2L11      ---ggaagttgtcgtgtag-------------------------------
A0A2K6GE22_BCL2L11      ggaggatgcctct-------------------------------------
A0A2K6GE22_BCL2L11      ---gggtatttttgaataa-------------------------------
A0A2K6GE22_BCL2L11      ggagggtatttttgaataattaccaagccgacgaagaccaccctcaaatg
A0A2K6GE22_BCL2L11      ggagggtatttttgaataattaccaagccgacgaagaccaccctcaaatg
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      gggcaggaccctcccacct-----------------------cctgacac
A0A2K6FQZ1_BBC3-03      gggcaggaccctcccacct-----------------------cctgacac

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE22_BCL2L11      ----------------tgcctggtaccctccatctga-------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      ----------------------------tccatctg-------------a
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      cttatcttgcgactgttacgttacattgtccgcctggtgtggaggaggca
A0A2K6GE22_BCL2L11      cttatcttgcgactgttacgttacattgtccgcctggtgtggaggaggca
A0A2K6FFN3_BMF-01       -------ggcagg--------------tcccaggtga-------------
A0A2K6FFN3_BMF-02       -------ggcagg--------------tcccag-----------------
A0A2K6GWV0_BAD-01       -----tgggcaggggaggttccgccccctcccagtga-------------
A0A2K6FM79_BIK-01       gctgctgggcgggggcctgcacctgctgctcaagtga-------------
A0A2K6GL98_HRK-01       gctgctcggcaggcggaact------------tgtag-------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      cctggccagcacgggggactttttctgcaccatgtag-------------
A0A2K6FQZ1_BBC3-03      cctggccagcacgggggactttttctgcaccatgtag-------------

A0A2K6EM90_PMAIP1-      ----
A0A2K6GE22_BCL2L11      ----
A0A2K6GE22_BCL2L11      ----
A0A2K6GE22_BCL2L11      ttaa
A0A2K6GE22_BCL2L11      ----
A0A2K6GE22_BCL2L11      ttga
A0A2K6GE22_BCL2L11      ttga
A0A2K6FFN3_BMF-01       ----
A0A2K6FFN3_BMF-02       ----
A0A2K6GWV0_BAD-01       ----
A0A2K6FM79_BIK-01       ----
A0A2K6GL98_HRK-01       ----
A0A2K6FQZ1_BBC3-04      ----
A0A2K6FQZ1_BBC3-01      ----
A0A2K6FQZ1_BBC3-02      ----
A0A2K6FQZ1_BBC3-03      ----

© 1998-2022Legal notice