Dataset for CDS classical BH3-containing proteins of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6EM90_PMAIP1-      atg-----------------------------------------------
A0A2K6GE31_BCL2L11      atg--------------gcaaagcaaccttccgatgtaggttctgagtgt
A0A2K6GE31_BCL2L11      atg--------------gcaaagcaaccttccgatgtaggttctgagtgt
A0A2K6FM79_BIK-01       atg--------------------------------------------tct
A0A2K6GL98_HRK-01       atg-----------------------------------------------
A0A2K6FQZ1_BBC3-01      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
A0A2K6FQZ1_BBC3-04      atg-----------------------------aaatttggtgcggggtct
A0A2K6GWV0_BAD-01       atg------------------ttccagatcccagagtttgagccaagtga
A0A2K6FFN3_BMF-02       atg------------------gagcc-atcccactgtgtg-----gagga
A0A2K6FFN3_BMF-01       atg------------------gagcc-atcccactgtgtg-----gagga
                        ***                                               

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      gaccgagaa--------------------ggtggacagttg------caa
A0A2K6GE31_BCL2L11      gaccgagaa--------------------ggtggacagttg------caa
A0A2K6FM79_BIK-01       gaggtgagacccgtctccacggacctcctcatggagaccttcccgttc--
A0A2K6GL98_HRK-01       -----------------------------------------------t--
A0A2K6FQZ1_BBC3-01      ggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccctc--
A0A2K6FQZ1_BBC3-04      g--------------------------------------------ccc--
A0A2K6GWV0_BAD-01       gcaggaaga-------ctccagctctgcaggtaggg-gcctgggccccag
A0A2K6FFN3_BMF-02       gctggaggatgatgtgttccagc-cagaggatggggagtcggggacccag
A0A2K6FFN3_BMF-01       gctggaggatgatgtgttccagc-cagaggatggggagtcggggacccag
                                                                          

A0A2K6EM90_PMAIP1-      ---------------------------------------cccgtgaagaa
A0A2K6GE31_BCL2L11      tctgtggagagacctccccag------------------ctcag------
A0A2K6GE31_BCL2L11      tctgtggagagacctccccag------------------ctcag------
A0A2K6FM79_BIK-01       ---------gagcatctcctggaccctctgat-------cctggaggttc
A0A2K6GL98_HRK-01       ---------gcccgtgccc--------------------cct--------
A0A2K6FQZ1_BBC3-01      ---------ggccgtgtcctgcggcctctgcgagcccggcct--------
A0A2K6FQZ1_BBC3-04      ---------gggcatgtc---------------------cct--------
A0A2K6GWV0_BAD-01       cccctcaggggaccggccctcaggccccggcaagcatc-cct--------
A0A2K6FFN3_BMF-02       ccc----gggagcgtgctct-------ctgctgacctg-ttt--------
A0A2K6FFN3_BMF-01       ccc----gggagcgtgctct-------ctgctgacctg-ttt--------
                                                                          

A0A2K6EM90_PMAIP1-      ggcgcgtaagaacg------------------------------------
A0A2K6GE31_BCL2L11      ---gcctggggccc------------------------------------
A0A2K6GE31_BCL2L11      ---gcctggggccc------------------------------------
A0A2K6FM79_BIK-01       tcagcatcatggac------------------------------------
A0A2K6GL98_HRK-01       ---gcaccgcggcc------------------------------------
A0A2K6FQZ1_BBC3-01      ---gcccgctgcccccgccgcccccgccctgctacccgctgcctacctct
A0A2K6FQZ1_BBC3-04      ---gccaggtgccc------------------------------------
A0A2K6GWV0_BAD-01       ---gcacggctcca------------------------------------
A0A2K6FFN3_BMF-02       ---gcccagagcca------------------------------------
A0A2K6FFN3_BMF-01       ---gcccagagcca------------------------------------
                           **                                             

A0A2K6EM90_PMAIP1-      -----------------------------------------cgcaacc--
A0A2K6GE31_BCL2L11      ----------------------------------------ctacctcc--
A0A2K6GE31_BCL2L11      ----------------------------------------ctacctcc--
A0A2K6FM79_BIK-01       ---------------------------------aacgaggagaatccc--
A0A2K6GL98_HRK-01       ---------------------------------------gcggccccc--
A0A2K6FQZ1_BBC3-01      gcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgc
A0A2K6FQZ1_BBC3-04      ---------------------------------------gggacttcc--
A0A2K6GWV0_BAD-01       -----------------------------agcttcctgggggacgcca--
A0A2K6FFN3_BMF-02       -----------------------------g-----ctggactgccccc--
A0A2K6FFN3_BMF-01       -----------------------------g-----ctggactgccccc--
                                                                      *   

A0A2K6EM90_PMAIP1-      ---------------------gagccc-----------------------
A0A2K6GE31_BCL2L11      ------------ctacagacagagccccaaggtaa---------------
A0A2K6GE31_BCL2L11      ------------ctacagacagagccccaaggtaa---------------
A0A2K6FM79_BIK-01       ----------gacccctcggggtgcctcgaggacagtgacgaggtggccc
A0A2K6GL98_HRK-01       ---------------------cggccgtgtg-------------------
A0A2K6FQZ1_BBC3-01      tggcctgggggtccccgcagccgaccccgaggcccgcgcccggacggtcc
A0A2K6FQZ1_BBC3-04      -----------ttctcatggtgggtcctgggccatattcc----tggtcc
A0A2K6GWV0_BAD-01       -------gtcaccagcaggggcagcccag---------------------
A0A2K6FFN3_BMF-02       -------tcagccggc---ttcagctctt---------------------
A0A2K6FFN3_BMF-01       -------tcagccggc---ttcagctctt---------------------
                                                                          

A0A2K6EM90_PMAIP1-      ---------------------------gacgcggactcgggcagagatc-
A0A2K6GE31_BCL2L11      -----------tcccgaaggcagtcgggaaggcgaaggggaccgctgctc
A0A2K6GE31_BCL2L11      -----------tcccgaaggcagtcgggaaggcgaaggggaccgctgctc
A0A2K6FM79_BIK-01       tgcg-------gctagcctgcatt---ggggatgagatggacctgtgtct
A0A2K6GL98_HRK-01       --------------cgcctgcagc---gcgggtcgcctgggtctgcgct-
A0A2K6FQZ1_BBC3-01      tcagccatcactctcgctggcaga---gcag--cacctggagt--cgcc-
A0A2K6FQZ1_BBC3-04      tcagccatcactctcgctggcaga---gcag--cacctggagt--cgcc-
A0A2K6GWV0_BAD-01       ----------cagcagcagccacc---atggaggagctgggtctgtgga-
A0A2K6FFN3_BMF-02       ----------ccctctcacccact---gctgtggccctgggctt----c-
A0A2K6FFN3_BMF-01       ----------ccctctcacccact---gctgtggccctgggctt----c-
                                                      *       **          

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      ccacggcagccctcagggcccgctggccccaccggccagccctggccctt
A0A2K6GE31_BCL2L11      ccacggcagccctcagggcccgctggccccaccggccagccctggccctt
A0A2K6FM79_BIK-01       caggagcccccgcctggcctggctgcccgggatgaccatgcacagcctgg
A0A2K6GL98_HRK-01       ------cgtccgccgcgc------------------agctcacagccgcc
A0A2K6FQZ1_BBC3-01      ------cgtccccagcgccccgggggccctggcgggcggtcccacccagg
A0A2K6FQZ1_BBC3-04      ------cgtccccagcgccccgggggccctggcgggcggtcccacccagg
A0A2K6GWV0_BAD-01       ----------------gacccggagtcgccacagctcgtaccccgcgggg
A0A2K6FFN3_BMF-02       ----------------gaccca-------------------ccagccagg
A0A2K6FFN3_BMF-01       ----------------gaccca-------------------ccagccagg
                                                                          

A0A2K6EM90_PMAIP1-      -----------------------------------gaagaggagtgtgcc
A0A2K6GE31_BCL2L11      t-------tgctaccagatccccgcttttcatctttgtgagaagatcctc
A0A2K6GE31_BCL2L11      t-------tgctaccagatccccgcttttcatctttgtgagaagatcctc
A0A2K6FM79_BIK-01       --------ggctggcgctgtcc-------------tgtgaccagccggtc
A0A2K6GL98_HRK-01       c-------ggctcaaggcgctc-------------ggcgacgagctgcac
A0A2K6FQZ1_BBC3-01      c-------ggccccgggagtcc-------------gg-ggggaggaggag
A0A2K6FQZ1_BBC3-04      c-------ggccccgggagtcc-------------gg-ggggaggaggag
A0A2K6GWV0_BAD-01       acagaagaggatgaagggatgg-------------aggaagagcccagcc
A0A2K6FFN3_BMF-02       a-agacaaggcc------------------------------acccagac
A0A2K6FFN3_BMF-01       a-agacaaggcc------------------------------acccagac
                                                                          

A0A2K6EM90_PMAIP1-      cttc----------------------------------------------
A0A2K6GE31_BCL2L11      cctg-----------ctgtctcgatcctccagtgggtatttctcttttga
A0A2K6GE31_BCL2L11      cctg-----------ctgtctcgatcctccagtgggtatttctcttttga
A0A2K6FM79_BIK-01       cgct--ggggc----gtgctcgggagccttagcg-acggtttc--gccaa
A0A2K6GL98_HRK-01       cagc--gcacc----atgtggcggc---gccgcgcgcgga-gccggaggg
A0A2K6FQZ1_BBC3-01      cagt--gggcccgagagatcggggcccagctgcg-gcggatggcagacga
A0A2K6FQZ1_BBC3-04      cagt--gggcccgagagatcggggcccagctgcg-gcggatggcagacga
A0A2K6GWV0_BAD-01       ccttccggggccgctcacgctcggcgccccccaacctctgggctgcacag
A0A2K6FFN3_BMF-02       cctc-------------agcccagcctccccaagccagggtgtcatgctg
A0A2K6FFN3_BMF-01       cctc-------------agcccagcctccccaagccagggtgtcatgctg
                        *                                                 

A0A2K6EM90_PMAIP1-      ----------------------------------aactcaggagacttgg
A0A2K6GE31_BCL2L11      cacag-----------------acaggagcccagcacccatgagttgtga
A0A2K6GE31_BCL2L11      cacag-----------------acaggagcccagcacccatgagttgtga
A0A2K6FM79_BIK-01       cctcaggg---a----------gtacgtg-gccaggctctggaggtcg--
A0A2K6GL98_HRK-01       cgccagcgcccg----------gcgcgct---------------------
A0A2K6FQZ1_BBC3-01      cctcaatgcgca----------gtacgagcggcggagacaagaggagcag
A0A2K6FQZ1_BBC3-04      cctcaatgcgca----------gtacgagcggcggagacaagaggagcag
A0A2K6GWV0_BAD-01       cgctatggccgcgagctccggaggatgagcgacgagttcgag-gactcct
A0A2K6FFN3_BMF-02       ccttgtg---------------gggtgaccgaggaaccccagagactctt
A0A2K6FFN3_BMF-01       ccttgtg---------------gggtgaccgaggaaccccagagactctt
                                                                          

A0A2K6EM90_PMAIP1-      ----------------agacaaactgcatttcc-----------------
A0A2K6GE31_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaggccttcaac-------
A0A2K6GE31_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaggccttcaac-------
A0A2K6FM79_BIK-01       -----------------ctcagccc-ccggccctgggtgtg---------
A0A2K6GL98_HRK-01       -----------------caccacctactggccctggctgtg---------
A0A2K6FQZ1_BBC3-01      cagag-----------acaccgccc-ctcaccctggagggt---------
A0A2K6FQZ1_BBC3-04      cagag-----------acaccgccc-ctcaccctggagggt---------
A0A2K6GWV0_BAD-01       tcaag-----------aagggacttcctcgcccgaagag-----------
A0A2K6FFN3_BMF-02       ttatg---------------------------------------------
A0A2K6FFN3_BMF-01       ttatggcaatgctggctaccggcttcctctccctgccagtttccctgcag
                                                                          

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       gcttgccccttggggaacagcccgctgaagggcagtggcaacatcgagca
                                                                          

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       gaggtacagattgcccgaaagcttcagtgcattgcagaccagttccaccg
                                                                          

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      ----------------cattatctcagtgcaatggtt-------------
A0A2K6GE31_BCL2L11      ----------------cattatctcagtgcaatggcttccatgaggcaat
A0A2K6FM79_BIK-01       ----------------ccccgccccggcg---------------------
A0A2K6GL98_HRK-01       ----------------cgcggcc---------------------------
A0A2K6FQZ1_BBC3-01      ----------------cctgtac---------------------------
A0A2K6FQZ1_BBC3-04      ----------------cctgtac---------------------------
A0A2K6GWV0_BAD-01       ----------------cgcgggcacagcg---------------------
A0A2K6FFN3_BMF-02       ----------------caccagcagaacc---------------------
A0A2K6FFN3_BMF-01       gcttcatgtgcagcaacaccagcagaacc---------------------
                                                                          

A0A2K6EM90_PMAIP1-      ---------------------------------agcagaaacttctgaat
A0A2K6GE31_BCL2L11      ----------------------------agagaaataga------ggaag
A0A2K6GE31_BCL2L11      ttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggag
A0A2K6FM79_BIK-01       ----------------------------tggg-agcaggtgctgctg---
A0A2K6GL98_HRK-01       -------------------------------g-cgcaggtggcggcg---
A0A2K6FQZ1_BBC3-01      -------------------------------a-atctcatcatggga---
A0A2K6FQZ1_BBC3-04      -------------------------------a-atctcatcatggga---
A0A2K6GWV0_BAD-01       ----------------------------a----cgcagat-acggcagag
A0A2K6FFN3_BMF-02       ----------------------------aaaatcgcatgtggtggcagat
A0A2K6FFN3_BMF-01       ----------------------------aaaatcgcatgtggtggcagat
                                                                          

A0A2K6EM90_PMAIP1-      -------ctgatagccaaacttttccgctcaggaacttga----------
A0A2K6GE31_BCL2L11      -------ttgtcgtgtag--------------------------------
A0A2K6GE31_BCL2L11      -------ttgcggcgtattggagatgagtttaacgcttattacccaagga
A0A2K6FM79_BIK-01       -------ctgctg--ctggtgctgctgctgctgggcgggggcctgcacct
A0A2K6GL98_HRK-01       -------ctggcggcct--------ggctgctcggc----------aggc
A0A2K6FQZ1_BBC3-01      -------ctcctgcccttacccaggggccacagagc-----ccctgagat
A0A2K6FQZ1_BBC3-04      -------ctcctgcccttacccaggggccacagagc-----ccctgagat
A0A2K6GWV0_BAD-01       ctccagctggacgcgcgtcattcagtcctggtgggatcggaacgtgggca
A0A2K6FFN3_BMF-02       cctcctcttcctacacaaccttgctttgaacggagaagagaacaggaacg
A0A2K6FFN3_BMF-01       cctcctcttcctacacaaccttgctttgaacggagaagagaacaggaacg
                                                                          

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gggtatttttgaataattaccaagccgacgaagaccaccctcaaatgctt
A0A2K6FM79_BIK-01       gct--------------gctcaagtga-----------------------
A0A2K6GL98_HRK-01       gga--------------acttg--tag-----------------------
A0A2K6FQZ1_BBC3-01      gga--------------gcccaattag-----------------------
A0A2K6FQZ1_BBC3-04      gga--------------gcccaattag-----------------------
A0A2K6GWV0_BAD-01       ggggaggttccgccccctcccag-tga-----------------------
A0A2K6FFN3_BMF-02       gggcagg----------tcccag---------------------------
A0A2K6FFN3_BMF-01       gggcagg----------tcccaggtga-----------------------
                                                                          

A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      atcttgcgactgttacgttacattgtccgcctggtgtggaggaggcattg
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
                                                                          

A0A2K6EM90_PMAIP1-      -
A0A2K6GE31_BCL2L11      -
A0A2K6GE31_BCL2L11      a
A0A2K6FM79_BIK-01       -
A0A2K6GL98_HRK-01       -
A0A2K6FQZ1_BBC3-01      -
A0A2K6FQZ1_BBC3-04      -
A0A2K6GWV0_BAD-01       -
A0A2K6FFN3_BMF-02       -
A0A2K6FFN3_BMF-01       -
                         

© 1998-2020Legal notice