Dataset for CDS BCL2L11 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6GE22_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE22_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE22_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE22_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE22_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE22_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg

A0A2K6GE22_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE22_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE22_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE22_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE22_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE22_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta

A0A2K6GE22_BCL2L11      cctccctacagacagagcccca----------------------------
A0A2K6GE22_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE22_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE22_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE22_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE22_BCL2L11      cctccctacagacagagcccca----------------------------

A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
A0A2K6GE22_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
A0A2K6GE22_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
A0A2K6GE22_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
A0A2K6GE22_BCL2L11      --------------------------------------------------

A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6GE22_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6GE22_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6GE22_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6GE22_BCL2L11      --------------------------------------------------

A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6GE22_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6GE22_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6GE22_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6GE22_BCL2L11      --------------------------------------------------

A0A2K6GE22_BCL2L11      --------------agcttccatgag------------------------
A0A2K6GE22_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE22_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE22_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE22_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE22_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                      ***  *******                        

A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggtt----
A0A2K6GE22_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A2K6GE22_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaat--------
A0A2K6GE22_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A2K6GE22_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca

A0A2K6GE22_BCL2L11      ----gcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A2K6GE22_BCL2L11      -------------------------------------agagaaataga--
A0A2K6GE22_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A2K6GE22_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc

A0A2K6GE22_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
A0A2K6GE22_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag

A0A2K6GE22_BCL2L11      gaggctg-----gcaaaa--------------------------------
A0A2K6GE22_BCL2L11      --ggaagttgtcgtgtag--------------------------------
A0A2K6GE22_BCL2L11      gaggatgcctct--------------------------------------
A0A2K6GE22_BCL2L11      --gggtatttttgaataa--------------------------------
A0A2K6GE22_BCL2L11      gagggtatttttgaataattaccaagccgacgaagaccaccctcaaatgc
A0A2K6GE22_BCL2L11      gagggtatttttgaataattaccaagccgacgaagaccaccctcaaatgc

A0A2K6GE22_BCL2L11      ---------------tgcctggtaccctccatctga--------------
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      ---------------------------tccatctg-------------at
A0A2K6GE22_BCL2L11      --------------------------------------------------
A0A2K6GE22_BCL2L11      ttatcttgcgactgttacgttacattgtccgcctggtgtggaggaggcat
A0A2K6GE22_BCL2L11      ttatcttgcgactgttacgttacattgtccgcctggtgtggaggaggcat

A0A2K6GE22_BCL2L11      ---
A0A2K6GE22_BCL2L11      ---
A0A2K6GE22_BCL2L11      taa
A0A2K6GE22_BCL2L11      ---
A0A2K6GE22_BCL2L11      tga
A0A2K6GE22_BCL2L11      tga

© 1998-2022Legal notice