Dataset for CDS BCL2L11 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6GE31_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A2K6GE31_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
                        **************************************************

A0A2K6GE31_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
A0A2K6GE31_BCL2L11      acagttgcaatctgtggagagacctccccagctcaggcctggggccccta
                        **************************************************

A0A2K6GE31_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A2K6GE31_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
                        **************************************************

A0A2K6GE31_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
A0A2K6GE31_BCL2L11      gaaggggaccgctgctcccacggcagccctcagggcccgctggccccacc
                        **************************************************

A0A2K6GE31_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K6GE31_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
                        **************************************************

A0A2K6GE31_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6GE31_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                        **************************************************

A0A2K6GE31_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6GE31_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                        **************************************************

A0A2K6GE31_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggtt----
A0A2K6GE31_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
                        ******************************************** *    

A0A2K6GE31_BCL2L11      -------------------------------------agagaaataga--
A0A2K6GE31_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
                                                              **** ** **  

A0A2K6GE31_BCL2L11      ----ggaagttgtcgtgtag------------------------------
A0A2K6GE31_BCL2L11      gcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
                             * *****  * ***                               

A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gagggtatttttgaataattaccaagccgacgaagaccaccctcaaatgc
                                                                          

A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ttatcttgcgactgttacgttacattgtccgcctggtgtggaggaggcat
                                                                          

A0A2K6GE31_BCL2L11      ---
A0A2K6GE31_BCL2L11      tga
                           

© 1998-2020Legal notice